A method for breeding soybeans resistant to soybean mosaic virus

Abstract

The application discloses a method for cultivating soybean resistant to soybean mosaic virus, which comprises the following steps: introducing a CRISPR / Cas system into a soybean genome; the CRISPR / Cas system is selected from a CRISPR / FnCas9 system or a CRISPR / LshCas13a system; the nucleotide sequence of sgRNA of the CRISPR / FnCas9 system is shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the nucleotide sequence of sgRNA of the CRISPR / LshCas13a system is shown in SEQ ID NO. 3 or SEQ ID NO. 4. The soybean plant cultivated by the method has resistance to the soybean mosaic virus. The research of the application provides technical support for the application of the CRISPR / Cas system in soybean disease resistance and the exploration of the optimal disease resistance strategy, and has important significance for soybean gene editing disease resistance breeding.

Description

Technical Field

[0001] This invention relates to a method for cultivating soybeans resistant to soybean mosaic virus, belonging to the field of genetic engineering technology. Background Technology

[0002] Soybean mosaic virus (SMV) is an RNA virus and one of the most prevalent pathogens of soybeans, widely distributed in soybean-producing regions worldwide, severely impacting soybean yield and quality. SMV uses seed-borne infection as the primary source, and is subsequently spread non-persistently by over 30 different types of aphids, causing widespread disease outbreaks in the field. Infected soybeans exhibit symptoms such as mosaic and necrosis, resulting in reduced photosynthetic area and capacity, decreased growth, stunted growth, and brown spots on the grains, leading to reduced yields or even total crop failure. Given the significant damage and widespread prevalence of SMV, improving soybean resistance is of paramount importance for soybean production in my country.

[0003] Currently, there are no effective chemical agents to control SMV, making the breeding of disease-resistant varieties the most economical, safe, and effective approach. In recent years, the emerging CRISPR / Cas genome editing technology has become a powerful tool for improving plant traits. The development of the CRISPR / FnCas9 and CRISPR / LshCas13a gene editing systems has provided new avenues for directly targeting the genome of RNA viruses and improving plant resistance to RNA viruses. It also offers new breeding strategies for accelerating the improvement of soybean disease resistance, and holds promise for breeding new soybean germplasm with high SMV resistance. This provides technical support for the application of CRISPR / Cas systems in soybean disease resistance and the exploration of optimal disease resistance strategies, which has profound significance for soybean gene editing and disease resistance breeding in my country. Summary of the Invention

[0004] In view of the above-mentioned prior art, the present invention provides a method for cultivating soybeans resistant to soybean mosaic virus.

[0005] This invention is achieved through the following technical solution:

[0006] A method for cultivating soybean resistant to soybean mosaic virus is as follows: A CRISPR / Cas system is introduced into the soybean genome; the CRISPR / Cas system is selected from the CRISPR / FnCas9 system or the CRISPR / LshCas13a system.

[0007] The nucleotide sequence of the sgRNA of the CRISPR / FnCas9 system is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide sequence of the sgRNA of the CRISPR / LshCas13a system is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0008] SEQ ID NO.1 (direction 5'-3'): GACCATGCGTGTCAAACCA, the target sequence of which is nucleotides 2284 to 2302 of the HC-Pro gene of soybean mosaic virus;

[0009] SEQ ID NO.2 (direction 5'-3'): TGGTTTGACACGCATGGTC, the target sequence of which is nucleotides 7288 to 7306 of the HC-Pro gene of soybean mosaic virus;

[0010] SEQ ID NO.3 (direction 5'-3'): CACTGATGCAGACAGGATGTACATAGCT, the target sequence of which is nucleotides 2046 to 2073 of the HC-Pro gene of soybean mosaic virus;

[0011] SEQ ID NO.4 (direction 5'-3'): CTTTAGCTATGTACATCCTGTCTGCATC, the target sequence is nucleotides 7513-7540 of the HC-Pro gene of soybean mosaic virus.

[0012] Furthermore, the introduction is carried out using Agrobacterium-mediated soybean cotyledonary node method, specifically as follows: using mature soybean cotyledonary nodes as explants, the bar gene as a selection marker, and glufosinate (PPT) as a selection agent, soybean transgenic operations are performed, and the tissue culture steps of seed imbibition, explant preparation, Agrobacterium infection solution preparation, infection, co-culture, shoot induction, shoot elongation, rooting, hardening, acclimatization, and transplanting are carried out in sequence to obtain resistant tissue culture seedlings.

[0013] Furthermore, the soybean variety is Williams 82.

[0014] Soybean plants cultivated using the above method are resistant to soybean mosaic virus (specifically, they are resistant to soybean mosaic virus infection). The strains of soybean mosaic virus include the following 13 strains: G1, G2, G3, G4, G6, G7, N, SC3, SC6, 6067-1, 6202-2, HH5, and HZ.

[0015] This invention utilizes CRISPR / FnCas9 and CRISPR / LshCas13a genome editing technologies to design specific sgRNA sequences targeting conserved sequences in the HC-Pro gene. Resistant tissue culture seedlings were then obtained through a soybean genetic transformation system. This invention further compared the disease resistance effects of the CRISPR / FnCas9 and CRISPR / LshCas13a systems targeting the positive and negative strands of the SMV gene. The disease resistance of progeny materials to SMV was clarified at the phenotypic, RNA, and protein levels. The results showed that both CRISPR / FnCas9 and CRISPR / LshCas13a vectors achieved disease resistance regardless of whether they targeted the positive or negative strand of the SMV gene, with the positive strand targeting showing a superior effect compared to the negative strand. This research provides technical support for the application of the CRISPR / Cas system in soybean disease resistance and for exploring optimal disease resistance strategies, and is of great significance for soybean gene editing-based disease-resistant breeding.

[0016] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description

[0017] Figure 1 Schematic diagram of electrophoresis results of CRISPR / FnCas9(+) plasmid extraction.

[0018] Figure 2 Schematic diagram of electrophoresis results of CRISPR / FnCas9(-) plasmid extraction.

[0019] Figure 3 Schematic diagram of electrophoresis results of CRISPR / LshCas13a(+) plasmid extraction.

[0020] Figure 4 Schematic diagram of electrophoresis results of CRISPR / LshCas13a(-) plasmid extraction.

[0021] Figure 5 Schematic diagram of the T-DNA vector structure.

[0022] Figure 6 : Schematic diagram of the working mode of the vector CRISPR / FnCas9(+).

[0023] Figure 7 : Schematic diagram of the working mode of the vector CRISPR / FnCas9(-).

[0024] Figure 8 : Schematic diagram of the working mode of the vector CRISPR / LshCas13a(+).

[0025] Figure 9: Schematic diagram of the working mode of the vector CRISPR / LshCas13a(-).

[0026] Figure 10 Among them, a. imbibition; b. infection; c. co-culture; d. bud induction; e. bud elongation; f. rooting; g. acclimatization; h. transplanting.

[0027] Figure 11 Photographs of herbicide application identification results for T0 generation soybean materials.

[0028] Figure 12 PCR detection results of T0 generation soybean materials.

[0029] Figure 13 : Identification results of T0 generation soybean material using PAT / bar transgenic test strip.

[0030] Figure 14 SMV inoculation identification results of T2 generation materials.

[0031] Figure 15 : Statistical diagram of the results of resistance identification of positive T2 generation soybean plants to SMV.

[0032] Figure 16 qRT-PCR test results.

[0033] Figure 17 Serological analysis results of DAS-ELISA for CRISPR / FnCas9(+) and CRISPR / FnCas9(-).

[0034] Figure 18 Serological analysis results of DAS-ELISA for CRISPR / LshCas13a(+) and CRISPR / LshCas13a(-). Detailed Implementation

[0035] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0036] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0037] Experiment 1: CRISPR / Cas system-mediated improvement of soybean resistance to soybean mosaic virus

[0038] This experiment utilized soybean genetic transformation systems based on CRISPR / FnCas9 and CRISPR / LshCas13a genome editing technologies to obtain resistant tissue culture seedlings and screen for positive edited materials. The disease resistance effects of the CRISPR / FnCas9 and CRISPR / LshCas13a systems targeting the sense and negative strands of SMV were compared to explore the optimal disease resistance strategy. The resistance of progeny materials to SMV was clarified at the phenotypic, RNA, and protein levels, and new soybean germplasm with high SMV resistance was screened.

[0039] 1. SMV HC-Pro gene target design

[0040] The whole genome nucleotide sequences of 13 prevalent SMV strains from both domestic and international sources were searched on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), including G1 (Genebank accession number: FJ640977), G2 (Genebank accession number: S42280), G3 (Genebank accession number: FJ640978), G4 (Genebank accession number: FJ640979), G6 (Genebank accession number: FJ640980), G7 (Genebank accession number: AF241739), N (Genebank accession number: D00507), SC3 (Genebank accession number: JF833013), and SC6 (Genebank accession number: FJ640977). Accession number: HM590054), 6067-1 (Genebank accession number: JF833015), 6202-2 (Genebank accession number: JF833014), HH5 (Genebank accession number: AJ310200), HZ (Genebank accession number: AJ312439).

[0041] The complete sequence of the SMV HC-Pro gene was extracted using BioXM 2.6 software, and multiple nucleotide sequence homology analysis was performed using BioEdit 7.0 software to determine the conserved regions of the sense and negative sense strands of the SMV HC-Pro gene, which are nucleotide sites 2039–2309 nt and 7281–7551 nt, respectively.

[0042] Based on the working principles of the CRISPR / FnCas9 and CRISPR / LshCas13a systems, sgRNA target sequences with 100% sequence similarity were designed and synthesized to target conserved regions of the sense and negative sense strands of the SMV HC-Pro gene, respectively. The target sequences for the sense and negative sense strands of the CRISPR / FnCas9 system were named FsgRNA(+) and FsgRNA(-), respectively, and the target sequences for the sense and negative sense strands of the CRISPR / LshCas13a system were named LsgRNA(+) and LsgRNA(-), respectively. Relevant information for the sgRNA target sequences is shown in Table 1.

[0043] Table 1 sgRNA target sequence information

[0044]

[0045] 2. Construction of CRISPR / FnCas9 and CRISPR / LshCas13a gene editing vectors

[0046] Specific recombination sites TTG / GAG and AAC / AAG were added to the 5' ends of FsgRNA and LsgRNA, respectively. CRISPR / FnCas9 and CRISPR / LshCas13a gene editing vectors were constructed via homologous recombination. These vectors were transformed into *E. coli* DH5α using the heat shock method for selection and cloning. After identification by PCR and sequencing, plasmids were extracted and transformed into *Agrobacterium* EHA105 using the electroporation method. The plasmids were then stored at -80°C with glycerol for subsequent soybean genetic transformation. The CRISPR / Cas vectors contain the nptII resistance gene for vector cloning and the bar selection marker gene for selecting positive soybean plants. FsgRNA and LsgRNA carry the *Arabidopsis thaliana* AtU6 promoter, while FnCas9 and LshCas13a carry the 2×CaMV 35S promoter. The primers used for vector construction are shown in Table 2 (Note: underlined sites are specific recombination sites), and the nucleotide sequences are shown in SEQ ID NO. 5–18.

[0047] Table 2. Primers related to vector construction

[0048]

[0049] A schematic diagram of the electrophoresis results of CRISPR / FnCas9(+) plasmid extraction is shown below. Figure 1 As shown in the diagram, the electrophoresis results of CRISPR / FnCas9(-) plasmid extraction are as follows: Figure 2 As shown in the diagram, the electrophoresis results of CRISPR / LshCas13a(+) plasmid extraction are as follows: Figure 3 As shown in the diagram, the electrophoresis results of CRISPR / LshCas13a(-) plasmid extraction are as follows: Figure 4 As shown.

[0050] A schematic diagram of the vector T-DNA structure is shown below. Figure 5 As shown in the diagram. A schematic diagram of the working mode of the CRISPR / FnCas9(+) vector is shown below. Figure 6 As shown, a schematic diagram of the working mode of the CRISPR / FnCas9(-) vector is as follows. Figure 7 As shown, the schematic diagram of the working mode of the vector CRISPR / LshCas13a(+) is as follows. Figure 8 As shown, the schematic diagram of the working mode of the vector CRISPR / LshCas13a(-) is as follows. Figure 9 As shown.

[0051] 3. Soybean genetic transformation and offspring family screening

[0052] A genetic transformation system mediated by Agrobacterium-mediated transformation of soybean cotyledonary nodes was employed. The SMV-susceptible soybean variety Williams 82 was selected as the recipient material. Mature soybean cotyledonary nodes 24 hours after germination were used as explants. The bar gene was used as a selection marker, and glufosinate was used as a selection agent. The process involved tissue culture steps including seed imbibition, explant preparation, Agrobacterium infection preparation, infection, co-culture, shoot induction, shoot elongation, rooting, hardening, acclimatization, and transplanting to obtain resistant tissue culture seedlings. Photos of the Agrobacterium-mediated genetic transformation process of soybean cotyledonary nodes are shown below. Figure 10 As shown; once the seedlings are healthy, they are moved into a greenhouse for subsequent screening and identification of positive materials.

[0053] Positive T0 generation soybean materials were screened using herbicides (200 mg / L Basta + 0.1% Tween-20), PCR (sgRNA, FnCas9 / LshCas13a, bar), and PAT / bar transgenic test strips. Results: Herbicide application identification results for T0 generation soybean materials are shown in the following images. Figure 11 As shown, no obvious herbicide damage symptoms were observed in the soybean leaves. The PCR detection results of the T0 generation soybean material are as follows: Figure 12 As shown, all three genes detected by PCR showed bands of the correct size. The results of the PAT / bar transgenic test strip identification of T0 generation soybean materials are as follows... Figure 13 As shown, the PAT / bar transgenic test strip exhibits two color bands: a control line and a test line.

[0054] Using four constructed CRISPR / Cas gene editing vectors—CRISPR / FnCas9(+), CRISPR / FnCas9(-), CRISPR / LshCas13a(+), and CRISPR / LshCas13a(-)—a total of 11,821 explants from the cotyledonary nodes of soybean from Williams 82 were infected. 186 positive T0 generation soybean plants were obtained through screening, with an average transformation efficiency (%) of 1.53 ± 0.83 (as shown in Table 3; all positive T0 plants were identified by herbicide testing, PCR, and PAT / bar test strips). The positive transgenic soybean plants matured in a greenhouse, and after single-plant harvesting, they were propagated for subsequent SMV disease resistance identification.

[0055] Table 3 Agrobacterium-mediated genetic transformation of soybean cotyledonary nodes

[0056]

[0057] 4. Identification of SMV resistance in offspring families

[0058] 4.1 SMV vaccination identification (phenotypic level)

[0059] SMV inoculation identification of positive T2 generation soybean materials was performed using the sap friction inoculation method. Specifically, the SMV SC3 line was propagated and activated on the highly susceptible soybean variety Nannong 1138-2. After disease onset, leaves with typical symptoms were collected and placed in a cooled, high-temperature sterilized mortar. An appropriate amount of SMV inoculation solution (0.01 M phosphate buffer, pH=7.4, approximately 3–5 ml buffer per 1 g leaf tissue) and a small amount of carborundum (600 mesh) were added, and the mixture was ground into a homogenate in the mortar. The homogenate was then applied to the flattened true leaves of the T2 generation soybean materials using a UV-sterilized brush. After inoculation, the plants were rinsed with tap water. Non-transgenic plants inoculated with the SMV SC3 line or 0.01 M phosphate buffer served as positive and negative controls, respectively. The SMV symptoms of the T2 plants were investigated and recorded. Based on the disease incidence, the resistance and susceptibility types of the plants were classified, thus clarifying the resistance of the T2 generation materials to SMV at the phenotypic level.

[0060] SMV inoculation identification results (photos) of T2 generation materials (including plants and seeds) are shown below. Figure 14 As shown in Table 4, the results of the resistance identification of positive T2 generation soybean plants to SMV are illustrated in Table 4. A statistical diagram illustrating the results of the resistance identification of positive T2 generation soybean plants to SMV is shown below. Figure 15 As shown.

[0061] Table 4. Results of resistance identification of positive T2 generation soybean plants to SMV

[0062]

[0063] Depend on Figure 14 It can be seen that: the negative control CK showed no virus symptoms in its leaves and seeds; the positive control NT showed obvious mosaic and seed brown spot symptoms; the positive T2 generation resistant material was consistent with CK, with healthy leaves and seeds; the susceptible T2 generation material was consistent with NT, showing obvious mosaic and seed brown spot symptoms. (From Table 4 and...) Figure 15 It can be seen that: a total of 20 positive control (NT) strains were identified, all of which were susceptible; a total of 52 T2 generation materials were identified, of which 30 were resistant (57.7%) and 22 were susceptible (42.3%). Among them, 15 materials were identified by CRISPR / FnCas9(+), of which 10 were resistant (66.7%) and 5 were susceptible (33.3%); 7 materials were identified by CRISPR / FnCas9(-), of which 3 were resistant (42.9%) and 4 were susceptible (57.1%); 17 materials were identified by CRISPR / LshCas13a(+), of which 12 were resistant (70.6%) and 5 were susceptible (29.4%); and 13 materials were identified by CRISPR / LshCas13a(-), of which 5 were resistant (38.5%) and 8 were susceptible (61.5%).

[0064] The above experimental results show that both CRISPR / FnCas9 and CRISPR / LshCas13a vectors can achieve anti-disease effects regardless of whether they target the positive or negative strand of SMV, and the anti-disease effect of targeting the positive strand of SMV is better than that of targeting the negative strand.

[0065] 4.2 qRT-PCR detection (RNA level)

[0066] Twelve young leaves were collected from the top of T2 plants and their non-transgenic control (NT) at 14 days (14 dpi) and 28 days (28 dpi) after SMV inoculation. Total RNA was extracted using an RNA extraction kit and analyzed using PrimeScript. ® First-strand cDNA was synthesized using a reverse transcription kit and processed using SYBR. ® Premix Ex Taq TM The kit was used for qRT-PCR experiments on a Roche LC 480Ⅱ real-time PCR instrument to detect the expression levels of CRISPR / Cas vector elements (FsgRNA, LsgRNA, FnCas9, LshCas13a) and the accumulation of SMV virus at the RNA level. The soybean housekeeping gene GmTubulin (gene ID AY907703) was used as an internal control. Each sample was tested in triplicate, and data were automatically read by the real-time PCR instrument. -ΔΔCt Relative quantitative analysis was performed using this method. The primers used in qRT-PCR are shown in Table 5.

[0067] Table 5 Primers for qRT-PCR Real-Time Fluorescent Quantitative Analysis

[0068]

[0069] The reaction system is as follows: Template (cDNA), 2 μl; 2×SYBR; ® PremixEx Taq, 10μl; F primer (10μM), 0.4μl; R primer (10μM), 0.4μl; ddH2O, 7.2μl; total 20μl.

[0070] The PCR reaction program was as follows: 95℃, 30 s; 95℃, 5 s; 60℃, 30 s; 40 cycles; 95℃, 15 s.

[0071] This study selected some resistant (R) and susceptible (S) T2 plants and their non-transgenic control (NT) for qRT-PCR experiments. The qRT-PCR real-time quantitative PCR information for soybean materials is shown in Table 6. The qRT-PCR detection results are as follows: Figure 16 As shown.

[0072] Table 6 Information on soybean materials for qRT-PCR real-time fluorescence quantitative quantification

[0073]

[0074] The results showed that ( Figure 16 At 14 dpi and 28 dpi, the expression of corresponding sgRNA and Cas proteins was detected in almost all T2 generation plants, indicating that the gene editing vector could operate stably in the T2 generation materials. Furthermore, the expression level of the vector original in the resistant material (R) was significantly higher than that in the susceptible material (S), indicating a positive correlation between the expression levels of sgRNA and Cas proteins and the SMV resistance level of the T2 plants. On the other hand, the SMV virus accumulation in the control material NT showed extremely high expression levels at both 14 dpi and 28 dpi, while the SMV virus accumulation in the resistant T2 generation material (R) was much lower than that in the control material at both 14 dpi and 28 dpi. Notably, although the SMV virus accumulation in the susceptible T2 generation material (S) was higher than that in the resistant T2 generation material (R) at both 14 dpi and 28 dpi, it was significantly lower than that in the control material, indicating that the susceptible T2 generation material (S) also possessed a certain degree of SMV resistance.

[0075] 4.3 DAS-ELISA Serological Analysis (Protein Level)

[0076] At 14 days (14 dpi) and 28 days (28 dpi) post-SMV inoculation, terminal young leaves of T2 plants and their non-transgenic control (NT) were collected (same as qRT-PCR). Serological analysis of SMV was performed using a double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) to detect SMV content at the protein level. The DAS-ELISA kit was purchased from ACD (USA). Each sample was tested in triplicate, with a positive control (NT inoculated with SMV SC3), a negative control (NT inoculated with 0.01 M phosphate buffer), and a blank control (substrate buffer). After 1 hour of color development, the optical density (OD) was measured at 405 nm using a microplate reader, and the experimental results were analyzed according to the following standards:

[0077] (1) The OD values ​​of the control wells (substrate wells, negative control wells, and positive control wells) should be within the product quality control range;

[0078] (2) Substrate well OD value < 0.15;

[0079] (3) Positive control OD value / negative control OD value > 10.0;

[0080] (4) Sample OD value = Original OD value - Substrate well OD value;

[0081] (5) If the OD value of the sample is greater than or equal to the OD value of the negative control, the result is considered positive (+).

[0082] (6) If the OD value of the sample is less than 2.0 compared to the OD value of the negative control, it is considered negative (-).

[0083] This study selected some resistant (R) and susceptible (S)T2 plants and their non-transgenic control (NT) for DAS-ELISA experiments (same as Table 6, same as qRT-PCR). The serological analysis results of CRISPR / FnCas9(+) and CRISPR / FnCas9(-) DAS-ELISA are as follows: Figure 17 As shown, the serological analysis results of CRISPR / LshCas13a(+) and CRISPR / LshCas13a(-) by DAS-ELISA are as follows: Figure 18 As shown in the figure. The results showed that at both 14 dpi and 28 dpi, the T2 generation resistant material (R) was SMV negative (-), while the T2 generation susceptible material (S) and the non-transgenic control plant (NT) were SMV positive (+), thus supporting the results of SMV phenotypic identification and qRT-PCR identification.

[0084] 5. Conclusion

[0085] This invention utilizes CRISPR / FnCas9 and CRISPR / LshCas13a genome editing technologies to design specific sgRNA sequences targeting conserved sequences in the HC-Pro gene. Resistant tissue culture seedlings were then obtained through a soybean genetic transformation system. This invention compares the disease resistance effects of the CRISPR / FnCas9 and CRISPR / LshCas13a systems targeting the positive and negative strands of the SMV gene. The disease resistance of progeny materials to SMV was clarified at the phenotypic, RNA, and protein levels. The results show that both CRISPR / FnCas9 and CRISPR / LshCas13a vectors can achieve disease resistance regardless of whether they target the positive or negative strand of the SMV gene, and the disease resistance effect of targeting the positive strand of the SMV gene is superior to that of targeting the negative strand.

[0086] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. A method for cultivating soybeans resistant to soybean mosaic virus, characterized in that: The CRISPR / Cas system was introduced into the soybean genome; the CRISPR / Cas system was selected from the CRISPR / FnCas9 system or the CRISPR / LshCas13a system. The nucleotide sequence of the sgRNA of the CRISPR / FnCas9 system is shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleotide sequence of the sgRNA of the CRISPR / LshCas13a system is shown in SEQ ID NO.3 or SEQ ID NO.

4.

2. The method for cultivating soybeans resistant to soybean mosaic virus according to claim 1, characterized in that: The introduction was performed using Agrobacterium-mediated soybean cotyledon node introduction.

3. The method for cultivating soybeans resistant to soybean mosaic virus according to claim 2, characterized in that, The specific method of Agrobacterium-mediated soybean cotyledon node method is as follows: using mature soybean cotyledon nodes as explants, bar Using genes as selection markers and glufosinate as selection agent, soybean transgenic operations were carried out in sequence, including seed imbibition, explant preparation, Agrobacterium infection solution preparation, infection, co-culture, shoot induction, shoot elongation, rooting, hardening, domestication, and transplanting, to obtain resistant tissue culture seedlings.

4. The method for cultivating soybeans resistant to soybean mosaic virus according to claim 1, characterized in that: The soybean variety mentioned is Williams 82.

5. Soybean plants resistant to soybean mosaic virus obtained by the cultivation method according to any one of claims 1 to 4.

6. The soybean plant resistant to soybean mosaic virus according to claim 5, characterized in that, It exhibits resistance to one or more of the following 13 soybean mosaic virus strains: G1, G2, G3, G4, G6, G7, N, SC3, SC6, 6067-1, 6202-2, HH5, and HZ.

Images