Perforin ca macpfl and application thereof in improving plant tolerance to hypoxia stress

Abstract

The application discloses a perforin CaMACPF1 and application thereof in improving plant tolerance to low-oxygen stress. CaMACPF1 The application extracts a gene from a pepper, uses T-DNA insertion technology and Agrobacterium-mediated plant transgenic technology, and successfully overexpresses the gene in Arabidopsis thaliana CaMACPF1 ; under 3% low-oxygen conditions, the seeds of pure overexpressed perforin CaMACPF1 Arabidopsis thaliana plants Ca1OE-1 and Ca1OE-2 are cultured, and the results show that the germination rate and root length elongation of the seeds are significantly higher than those of wild-type Arabidopsis thaliana seeds under the same treatment. That is to say, under a low-oxygen stress environment, overexpressed perforin CaMACPF1 can improve the tolerance of plants to low-oxygen stress, and has obvious growth promotion advantages. The application provides a gene resource for creating new germplasm of crops resistant to waterlogging and other low-oxygen stress, and is favorable for reducing the influence of flood disasters on crop growth.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a perforating protein CaMACPF1 and its application in improving plant tolerance to hypoxia stress. Background Technology

[0002] Hypoxia stress is one of the most common abiotic stresses in plants. In actual production, floods, excessive irrigation, soil compaction, and hydroponics can easily lead to insufficient oxygen supply to plant roots, resulting in hypoxia stress. If plants are exposed to a low-oxygen environment for a prolonged period, they cannot effectively exchange gases with the external environment. Oxygen in the soil is rapidly consumed by plant roots and soil microorganisms, severely affecting normal plant growth, development, and physiological metabolism, leading to yellowing leaves and decreased quality and yield. Floods are the most common cause of hypoxia stress, making research into crop flood resistance mechanisms and the development of new flood-resistant crop germplasm of great significance.

[0003] MACPF (Membrane Attack Complex and Perforin) was initially discovered in animals, where it plays important roles in animal immunity, embryonic development, neural migration, tumor suppression, and prokaryotic toxicity. In plants, only Arabidopsis thaliana currently possesses it. MACPF Gene families have been studied in considerable detail, such as NSL1, NSL2 and MACP2 It has been reported that it can regulate plant immunity through defense signaling pathways mediated by phenolic compounds and salicylic acid, thereby limiting fungal invasion. No reports have yet been found regarding the association between MACPF proteins in peppers, especially CaMACPF1, and plant tolerance to hypoxia stress. Summary of the Invention

[0004] In view of the shortcomings and deficiencies of the prior art, the present invention provides the application of overexpression of perforin CaMACPF1 in improving the tolerance of plants to hypoxia stress.

[0005] A second objective of this invention is to provide the application of overexpression of the perforin CaMACPF1 in the creation of plant lines resistant to waterlogging / hypoxia stress.

[0006] A third objective of this invention is to provide the application of biomaterials overexpressing the perforin CaMACPF1 in improving plant tolerance to hypoxia stress or in creating waterlogging-resistant / hypoxia-tolerant plant lines.

[0007] A fourth objective of this invention is to provide the application of formulations that enhance the expression of perforin CaMACPF1 in improving plant tolerance to hypoxia stress or in creating waterlogging-resistant / hypoxia-tolerant plant lines.

[0008] The fifth objective of this invention is to provide a method for constructing a plant that is resistant to waterlogging and hypoxia stress.

[0009] The above-mentioned objective of this invention is achieved through the following technical solution: This invention extracts from chili peppers CaMACPF1 Using T-DNA insertion technology and Agrobacterium-mediated plant transgenic technology, the perforin gene was successfully overexpressed in Arabidopsis thaliana. CaMACPF1 Homozygous Arabidopsis plants overexpressing the perforin CaMACPF1 were obtained through identification. Furthermore, seeds from the obtained homozygous and CaMACPF1-overexpressing Arabidopsis plants Ca1OE-1 and Ca1OE-2 were cultured under 3% hypoxia. The results showed that, compared with the wild type, overexpression of CaMACPF1 improved the germination rate of Arabidopsis seeds under hypoxia stress and increased root elongation, indicating that CaMACPF1 can enhance the tolerance of Arabidopsis to hypoxia stress and has a significant growth-promoting advantage.

[0010] Therefore, the present invention provides the application of overexpression of perforin CaMACPF1 in improving the tolerance of plants to hypoxia stress, the amino acid sequence of which is shown in SEQ ID NO.2.

[0011] The present invention also provides the application of overexpression of perforin CaMACPF1 in the creation of plant lines resistant to waterlogging / hypoxia stress, the amino acid sequence of which is shown in SEQ ID NO.2.

[0012] The present invention also provides the application of biomaterials overexpressing perforin CaMACPF1 in improving the tolerance of plants to hypoxia stress or in creating plant lines resistant to waterlogging / hypoxia stress, wherein the amino acid sequence of perforin CaMACPF1 is shown in SEQ ID NO.2.

[0013] Furthermore, the biological material is an expression cassette, expression vector, or expression strain containing a nucleotide sequence encoding the perforin CaMACPF1.

[0014] Furthermore, the expressed strain is Agrobacterium GV1301.

[0015] The present invention also provides the application of a formulation that enhances the expression of perforin CaMACPF1 in improving the tolerance of plants to hypoxia stress or in creating plant lines that are resistant to waterlogging / hypoxia stress, wherein the amino acid sequence of the perforin CaMACPF1 is shown in SEQ ID NO.2.

[0016] Furthermore, the formulation for enhancing the expression of perforin CaMACPF1 includes primer pairs as shown in SEQ ID NO. 3-4.

[0017] The present invention also provides a method for constructing a plant that is resistant to waterlogging / hypoxia stress by improving the expression level of perforating protein CaMACPF1 in plants through transgenic methods; the amino acid sequence of the perforating protein CaMACPF1 is shown in SEQ ID NO.2.

[0018] Furthermore, the genetic modification method is Agrobacterium-mediated transformation.

[0019] Preferably, the transgenic method is Agrobacterium-mediated inflorescence immersion.

[0020] Furthermore, the plant is Arabidopsis thaliana or pepper.

[0021] Furthermore, the nucleotide sequence of the perforin CaMACPF1 is shown in SEQ ID NO.1.

[0022] Specifically, the present invention provides a feasible method for constructing plants resistant to waterlogging / tolerant to hypoxia stress, comprising the following steps: S1. Transfected with the overexpression vector in LB liquid medium containing rifampin and kanamycin. pEGOEP35S- CaMACPF1-H-EGFP Agrobacterium GV1301, collect bacterial cells; S2. Resuspend the bacterial cells from step S1 in the infection solution (prepared with 5% (M / V) sucrose and 0.02% (V / V) Silwet-L77) to obtain a resuspension; S3. The inflorescences of flowering wild-type Arabidopsis thaliana were immersed in a resuspension solution. The infected Arabidopsis thaliana were wrapped in black plastic bags and placed in a plant room for overnight cultivation, followed by normal cultivation (16 hours of light, 23℃ / 8 hours of darkness, 21℃). S4. Screening and identification of overexpressing genes CaMACPF1 The plants were harvested and planted.

[0023] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a perforating protein, CaMACPF1, and its application in improving plant tolerance to hypoxia stress. This invention obtains it from chili peppers. CaMACPF1 The gene was successfully overexpressed in Arabidopsis thaliana using T-DNA insertion technology and Agrobacterium-mediated plant transgenic technology. CaMACPF1Seeds from Arabidopsis plants Ca1OE-1 and Ca1OE-2, which expressed pure and overexpressed perforin CaMACPF1, were cultured under 3% hypoxia. The results showed that the germination rate and root elongation of these seeds were significantly higher than those of wild-type Arabidopsis seeds under the same treatment. This indicates that overexpression of CaMACPF1 can improve plant tolerance to hypoxia stress and has a significant growth-promoting effect. This invention provides genetic resources for creating new germplasm of crops resistant to waterlogging and other hypoxia stresses, which is beneficial for reducing the impact of floods on crop growth, enabling them to survive and maintain yields during floods, and has significant economic value and application prospects. Attached Figure Description

[0024] Figure 1 To identify the expression level of CaMACPF1 in Arabidopsis plants that overexpress the perforin CaMACPF1.

[0025] Figure 2 Wild-type (WT) Arabidopsis thaliana and negative control ( erfⅦ Arabidopsis thaliana and CaMACPF1 The germination status and germination rate of seeds overexpressing Arabidopsis thaliana (Ca1OE-1, Ca1OE-2) after hypoxia treatment were compared. Figure 2 In the figure, a is a plate image of the germination of each Arabidopsis seed after 11 days of treatment with 3% hypoxia; b is the statistical result of the germination rate of each Arabidopsis seed after 11 days of treatment with 3% hypoxia. The horizontal axis represents the sample name and the vertical axis represents the germination rate; the scale bar is 10 mm.

[0026] Figure 3 Wild-type (WT) Arabidopsis thaliana and negative control ( erfⅦ Arabidopsis thaliana and CaMACPF1 Root growth and root length comparison of seeds overexpressing Arabidopsis thaliana (Ca1OE-1, Ca1OE-2) after hypoxia treatment. Figure 3 In the figure, a represents the root growth of each Arabidopsis thaliana after 11 days of treatment with 3% hypoxia; b represents the statistical results of the root length of each Arabidopsis thaliana after 11 days of treatment with 3% hypoxia. The horizontal axis represents the sample name, and the vertical axis represents the root length. The scale bar is 10 mm, and *P<0.05. Detailed Implementation

[0027] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0028] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0029] The wild-type (WT) Arabidopsis thaliana used in the embodiments of this invention ( Arabidopsis thaliana ) is the Columbia (Col-0) ecotype.

[0030] Example 1: Construction of Arabidopsis plants overexpressing perforin CaMACPF1 This invention utilizes T-DNA insertion technology and Agrobacterium-mediated plant transgenic technology to construct Arabidopsis thaliana plants overexpressing the perforin CaMACPF1, in order to study the regulatory effect of CaMACPF1 on the plant's tolerance to hypoxia stress. The construction process of the Arabidopsis thaliana plants overexpressing CaMACPF1 is as follows: 1. Overexpression vector ( pEGOEP35S-CaMACPF1-H-EGFP Construction of ) Total RNA was extracted from chili peppers and reverse transcribed into cDNA. Using the obtained cDNA as a template, PCR amplification was performed on the total cDNA from chili peppers using primer pairs CaMACPF1CDS-F (ACTAGGGTCTCGCACCATGGAGAATCCAAACCCCAACAAGTG, SEQ ID NO.3) and CaMACPF1CDS-R (ACTAGGGTCTCTCGCCGTAATTCAACAGGGAGTACTTCACTCTTAGCACAA, SEQ ID NO.4). CaMACPF1 ( Capana02g001689 The CDS of the gene encoding the perforin CaMACPF1 described in this invention is 1695 bp in length, and its nucleotide sequence is shown below (SEQ ID NO.1):

[0031] CaMACPF1 The amino acid sequence of the encoded perforin CaMACPF1 is shown below (SEQ ID NO.2), and its length is 564 aa.

[0032] .

[0033] The amplified gene encoding the perforin CaMACPF1 was inserted into an overexpression vector, and the overexpression vector was verified by sequencing. pEGOEP35S-CaMACPF1-H-EGFP .

[0034] 2. Agrobacterium-mediated genetic transformation This invention utilizes Agrobacterium-mediated inflorescence transfection to transform wild-type Arabidopsis thaliana. The overexpression vector is then transferred into LB liquid medium containing rifampin and kanamycin by vigorous shaking. pEGOEP35S-CaMACPF1-H-EGFPAgrobacterium (GV1301, VidiBio) was used. When the bacterial suspension turned orange-yellow, the bacteria were harvested and resuspended in the infection solution (formulation shown in Table 1). The inflorescences of flowering wild-type Arabidopsis thaliana were immersed in the infection solution and gently rotated. The infected Arabidopsis thaliana were wrapped in black plastic bags and placed in a plant room for overnight cultivation, followed by normal cultivation (16 hours of light, 23℃ / 8 hours of darkness, 21℃) until seed harvest.

[0035] Table 1 Infection solution formulation

[0036] 3. Identification of Arabidopsis plants overexpressing perforin CaMACPF1 Total RNA was extracted from plants, and cDNA was obtained through reverse transcription. The selected plants were then identified using real-time quantitative PCR (qRT-PCR).

[0037] Among Arabidopsis thaliana plants, CaMACPF1 level of expression, such as Figure 1 As shown, it can be observed that compared with the wild type, the transgenic materials (Ca1OE-1, Ca1OE-2) have... CaMACPF1 High gene expression indicates that the selected plant is CaMACPF1 Gene overexpression materials. Specifically, this invention successfully constructed Arabidopsis thaliana lines Ca1OE-1 and Ca1OE-2 that expressed pure and overexpressed the perforating protein CaMACPF1, and conducted subsequent experiments after harvesting the seeds.

[0038] Example 2: Cultivation of Arabidopsis thaliana Combine wild type and CaMACPF1 Overexpressing Arabidopsis seeds were surface-sterilized with 20% disinfectant (20% NaClO) for 15 minutes, rinsed 5 times with sterile double-distilled water, and then resuspended in sterile water. The treated seeds were separated and evenly sown on solid 1 / 2 MS (Morishige and Skoog) medium (the medium formula is shown in Table 2, the pH was adjusted to 5.8, and sterilized at 121℃ for 20 minutes). The sown seeds were vernalized in the dark at 4℃ for 3-4 days and then transferred to the plant room and cultured under the conditions of 16 hours of light, 23℃ / 8 hours of darkness, and 21℃. Ten-day-old seedlings were transplanted into peat moss and placed in the plant room for further culture.

[0039] Table 2 Formulation of solid 1 / 2MS medium (1L)

[0040] Example 3 Comparison of hypoxia stress tolerance between wild-type Arabidopsis and overexpressing Arabidopsis Wild-type (WT) Arabidopsis thaliana seeds and negative control seeds were used. erfⅦ Arabidopsis seeds ( erfⅦThe paper cites the mutant Arabidopsis seed: "Marín-de la Rosa, N., Sotillo, B., Miskolczi, P., Gibbs, DJ,Vicente, J., Carbonero, P., Oñate-Sánchez, L., Holdsworth, MJ, Bhalerao, R., Alabadí, D., and Blázquez, MA (2014). Large-Scale Identification of Gibberellin-Related Transcription Factors Defines Group VII ETHYLENE RESPONSEFACTORS as Functional DELLA Partners." Plant Physiology 166, 1022-1032.”) and CaMACPF1 Overexpressing Arabidopsis thaliana (Ca1OE-1, Ca1OE-2) seeds were sown on 1 / 2 MS medium as described in Example 2 and germinated in a 3% hypoxic environment. A control group was set up in a normoxic environment. The culture temperature and photoperiod were kept consistent for both groups (16 hours of light, 23°C / 8 hours of darkness, 21°C). After 15 days of culture, the germination of each Arabidopsis seed was observed and the germination rate was calculated. At the same time, the root growth of each Arabidopsis was observed and the average root length was measured and calculated.

[0041] Wild-type (WT) Arabidopsis thaliana, negative control ( erfⅦ Arabidopsis thaliana and CaMACPF1 The germination status and germination rate of Arabidopsis thaliana seeds overexpressing (Ca1OE-1, Ca1OE-2) after hypoxia treatment are compared as follows: Figure 2 As shown: Figure 2 In the figure, 'a' represents a plate image of the germination of each Arabidopsis thaliana seed after 11 days of treatment with 3% hypoxia. Figure 2 In the figure, b represents the germination rate of each Arabidopsis seed after 11 days of treatment under 3% hypoxia. The horizontal axis represents the sample name, and the vertical axis represents the germination rate.

[0042] Wild-type Arabidopsis thaliana, negative control Arabidopsis thaliana and CaMACPF1 The following figure shows the root growth and root length comparison of Arabidopsis thaliana seeds after hypoxia treatment. Figure 3 As shown: Figure 3 In the figure, 'a' represents the root growth of each Arabidopsis species after 11 days of treatment under 3% hypoxia. Figure 3In Table 3, b represents the root length statistics of each Arabidopsis species after 11 days of treatment with 3% hypoxia. The horizontal axis represents the sample name, and the vertical axis represents the root length. Table 3 shows the germination rate and average root length statistics of each Arabidopsis species after 11 days of treatment with 3% hypoxia.

[0043] Table 3. Germination rate and root length of each strain under 3% hypoxia treatment.

[0044] Combination Figure 1 , Figure 2 As shown in Table 3, compared with the wild type, overexpression of perforin under 3% hypoxia treatment resulted in a higher rate of change. CaMACPF1 The germination rate of Arabidopsis seeds from the gene-derived strain was significantly higher than that of the wild type, and its root length was also significantly longer. These results indicate that the perforin CaMACPF1 can improve the plant's tolerance to hypoxia stress.

[0045] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of overexpression of perforin CaMACPF1 in improving plant tolerance to hypoxia stress, characterized in that, The amino acid sequence of the perforin CaMACPF1 is shown in SEQ ID NO.

2.

2. The application of overexpression of perforin CaMACPF1 in the creation of plant lines resistant to waterlogging / hypoxia stress, characterized in that, The amino acid sequence of the perforin CaMACPF1 is shown in SEQ ID NO.

2.

3. The application of biomaterials overexpressing perforin CaMACPF1 in improving plant tolerance to hypoxia stress or creating waterlogging-resistant / hypoxia-tolerant plant lines, characterized in that... The amino acid sequence of the perforin CaMACPF1 is shown in SEQ ID NO.

2.

4. The application according to claim 3, characterized in that, The biological material is an expression cassette, expression vector, or expression strain containing a nucleotide sequence encoding the perforin CaMACPF1.

5. The application of a formulation that enhances the expression of perforin CaMACPF1 in improving plant tolerance to hypoxia stress or creating waterlogging-resistant / hypoxia-tolerant plant lines, characterized in that... The amino acid sequence of the perforin CaMACPF1 is shown in SEQ ID NO.

2.

6. The application according to claim 5, characterized in that, The formulation for enhancing the expression of perforin CaMACPF1 includes primer pairs as shown in SEQ ID NO.3-4.

7. A method for constructing a plant that is resistant to waterlogging / tolerant to low oxygen stress, characterized in that, The expression level of perforin CaMACPF1 in plants was increased by transgenic method; the amino acid sequence of perforin CaMACPF1 is shown in SEQ ID NO.

2.

8. The construction method according to claim 7, characterized in that, The genetic modification method is Agrobacterium-mediated transformation.

9. The application according to any one of claims 1 to 3 or 5, or the construction method according to claim 7, characterized in that, The plant in question is either Arabidopsis thaliana or pepper.

10. The application according to any one of claims 1 to 3 or 5, or the construction method according to claim 7, characterized in that, The nucleotide sequence of the perforin CaMACPF1 is shown in SEQ ID NO.1.

Images