Guide editing system PE-Nt8 and gene editing method mediated thereby

Abstract

The application discloses a prime editing system PE-Nt8 and a gene editing method mediated by the prime editing system. The complete system comprises a fusion protein, a substance for reducing the content and / or activity of RDR6 protein and a pegRNA. The fusion protein comprises a nuclease, a reverse transcriptase and a small RNA binding protein La. The pegRNA comprises an sgRNA, a reverse transcription template sequence and a primer binding site sequence. The sgRNA targets an editing strand target sequence. Experiments prove that the PE-Nt8 prime editing system can improve the co-editing efficiency of three genes from 4.5% to 21% in tobacco T0 seedlings, and the improvement factor is 4.6 times. The application optimizes the PE system, significantly improves the overall gene editing effect of the PE system in tobacco, and provides a more accurate and powerful tool for tobacco gene function research.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the guided editing system PE-Nt8 and the gene editing method mediated by it. Background Technology

[0002] Prime editors (PEs) are a novel, precise gene-editing technology developed in recent years based on the CRISPR / Cas9 system, showing broad application prospects in the field of plant gene editing. The PE system achieves high-precision genome editing by fusing a nuclease-deficient Cas9n (H840A) with reverse transcriptase (M-MLV RT) and designing specific pegRNAs (the 3' end of an elongated sgRNA containing a primer-binding sequence and a reverse transcription template sequence).

[0003] Compared to the traditional CRISPR / Cas9 system, the PE system offers higher editing accuracy and significantly reduces off-target effects. Currently, the PE system has achieved initial success in monocotyledonous plants such as rice, wheat, and maize. In contrast, the editing efficiency of the PE system in dicotyledonous plants such as tobacco remains very low, which greatly limits its widespread application. Therefore, it is urgent to optimize or improve the PE system to increase its editing efficiency in dicotyledonous plants, thereby overcoming this bottleneck in its application. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to improve the editing efficiency of the PE system in dicotyledonous plants (such as tobacco).

[0005] To address the aforementioned technical problems, the present invention first provides a complete system.

[0006] The complete system provided by this invention includes a fusion protein, a substance that reduces the content and / or activity of RDR6 protein, and pegRNA; The fusion protein includes a nuclease, a reverse transcriptase, and a small RNA-binding protein, La. The pegRNA includes sgRNA, a reverse transcription template sequence, and a primer binding site sequence; the sgRNA targets the editing strand target sequence.

[0007] In the above-mentioned complete system, the RDR6 protein is a key protein in the gene silencing pathway.

[0008] The substance that reduces the activity of RDR6 protein can be a protein, polypeptide, or small molecule compound that inhibits the function of RDR6 protein.

[0009] The substance that reduces RDR6 protein content may be a substance that inhibits RDR6 protein synthesis, promotes RDR6 protein degradation, or knocks down (reduces) or eliminates the RDR6 protein encoding gene.

[0010] Furthermore, the substance that knocks down (reduces) the RDR6 protein-coding gene can be any nucleic acid molecule that can inhibit (or interfere with) the expression of the RDR6 protein-coding gene, such as gRNA (e.g., sgRNA), siRNA, dsRNA, shRNA, miRNA, antisense RNA, etc.

[0011] The substance used to knock out the RDR6 protein-coding gene can be any substance that prevents the host cell from producing the functional protein product of that gene. Specific methods include removing all or part of the coding gene sequence, introducing mutations to prevent the production of the functional protein, removing or altering regulatory components (e.g., promoter editing) to prevent transcription of the coding gene sequence, or blocking translation by binding to mRNA. Typically, knockout is performed at the genomic DNA level, ensuring that the cell's offspring permanently carry the knockout.

[0012] Furthermore, the RDR6 protein can be any RDR6 protein derived from dicotyledonous plants, such as AtRDR6 from Arabidopsis thaliana, NtRDR6 from tobacco, SIRDR6 from tomato, and StRDR6 from potato.

[0013] Furthermore, the nucleic acid molecule that inhibits the expression of the RDR6 protein-coding gene can be a miRNA that inhibits the expression of the RDR6 protein-coding gene.

[0014] In some embodiments, the miRNA that inhibits the expression of the RDR6 protein-coding gene is a miRNA that inhibits the expression of the NtRDR6 protein-coding gene.

[0015] In some preferred embodiments, the nucleotide sequence of the miRNA that inhibits the expression of the NtRDR6 protein-coding gene is shown in Sequence 8 or Sequence 9. Sequence 8 is the precursor sequence of the miRNA that inhibits the expression of the NtRDR6 protein-coding gene, and Sequence 9 is the mature sequence of the miRNA that inhibits the expression of the NtRDR6 protein-coding gene.

[0016] In the above-mentioned complete system, in the fusion protein, the nuclease is fused to the N-terminus of the reverse transcriptase, and the small RNA binding protein La is fused to the C-terminus of the reverse transcriptase.

[0017] In some embodiments, the fusion protein further includes the nucleocapsid protein NC.

[0018] In some preferred embodiments, the fusion protein comprises, from the N-terminus, a nuclease, a nucleocapsid protein NC, a reverse transcriptase, and a small RNA-binding protein La.

[0019] In some embodiments, the N-terminus and / or C-terminus of the fusion protein further includes a nuclear localization signal peptide.

[0020] In some specific embodiments, the fusion protein, starting from the N-terminus, sequentially includes a nuclear localization signal peptide, a nuclease, a nucleocapsid protein NC, a reverse transcriptase, a small RNA-binding protein La, and a nuclear localization signal peptide.

[0021] In some preferred embodiments, the nuclear localization signal peptide is a 4×NLS nuclear localization signal peptide.

[0022] In the above-mentioned complete system, the nuclease can be a Cas9 nuclease.

[0023] In some embodiments, the Cas9 nuclease is a Cas9 nicking enzyme. The Cas9 nicking enzyme can be any Cas9n or its variants known in the art, including bacterial Cas9n (such as SpCas9n, SaCas9n, SaCas9n-KKH, etc.), SpCas9 variant nicking enzymes that recognize different PAMs (such as xCas9n, Cas9n-NG, Cas9n-VQR, Cas9n-VRER, etc.), and Cas9 high-fidelity enzyme variant nicking enzymes (such as HypaCas9n, eSpCas9(1.1)n, Cas9-HF1n, etc.).

[0024] In some preferred embodiments, the Cas9 nicking enzyme is Cas9Max; the Cas9Max is any of the following: A1) The amino acid sequence is that of the protein shown in sequence 2; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in A1); The amino acid sequence shown in A3) has 75% or more identity with that shown in A1) and encodes the protein of the Cas9Max.

[0025] The coding gene for Cas9Max is any one of the following: a1) The DNA molecule shown in positions 3919-8019 of sequence 1; a2) has 75% or more identity with the nucleotide sequence defined in a1) and encodes the DNA molecule of the Cas9Max.

[0026] In the above-mentioned complete system, the nucleocapsid protein NC is any one of the following: B1) The amino acid sequence of the protein is shown in sequence 3; B2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in B1); B3) has 75% or more of the same amino acid sequence as B1) and encodes the nucleocapsid protein NC.

[0027] The gene encoding the nucleocapsid protein NC is any one of the following: b1) The DNA molecule shown in positions 8068-8235 of sequence 1; b2) has 75% or more identity with the nucleotide sequence defined in b1) and is a DNA molecule encoding the nucleocapsid protein NC.

[0028] In the above-described complete system, the reverse transcriptase is MMLVΔRNaseH, and MMLVΔRNaseH is any one of the following: C1) The amino acid sequence is the protein shown in sequence 4; C2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in C1); C3) has 75% or more of the same amino acid sequence as C1) and encodes the protein of the MMLVΔRNaseH; The gene encoding MMLV△RNaseH is any one of the following: c1) The DNA molecule shown in positions 8365-9906 of sequence 1; c2) has 75% or more identity with the nucleotide sequence defined by c1) and encodes the DNA molecule of the MMLVΔRNaseH.

[0029] In the above-described complete system, the small RNA binding protein La is any one of the following: D1) The amino acid sequence is that of the protein shown in sequence 6; D2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in D1); The amino acid sequence shown in D3) has 75% or more identity with that shown in D1) and encodes the small RNA-binding protein La.

[0030] The gene encoding the small RNA-binding protein La is any one of the following: d1) The DNA molecule shown in sequence 5; d2) has 75% or more identity with the nucleotide sequence defined by d1) and encodes the DNA molecule of the small RNA binding protein La.

[0031] The amino acid sequence of the 4×NLS nuclear localization signal peptide is shown in Sequence 13, and its encoding gene sequence is shown in positions 3715-3918 of Sequence 1.

[0032] In the above-mentioned complete system, the pegRNA includes, in sequence, esgRNA, reverse transcription template sequence (RT sequence), and primer binding site sequence (PBS sequence).

[0033] The esgRNA comprises a target sequence (denoted as target sequence A) and an esgRNA backbone. The esgRNA backbone is an RNA molecule obtained by replacing T with U in positions 2054-2139 of sequence 1. This esgRNA targets the editing strand target sequence, which can be any sequence in the genome sequence, but is preferably a target gene sequence.

[0034] The RT sequence is the reverse complementary sequence of the three bases at the 3' end of the target sequence (target sequence A) and the subsequent continuous genomic sequence, in which a target mutation is introduced. This mutation serves as a reverse transcription template for reverse transcriptase, producing cDNA, which is then used as a repair template to repair genomic DNA. The RT sequence size can further be 8-34 bp.

[0035] The PBS sequence (primer binding site sequence) is the reverse complementary sequence (1≤n<17) of the target sequence (target sequence A) from the nth to the 17th base of the 5' end of the target sequence.

[0036] The design methods or principles of the RT sequence and the PBS sequence can refer to the design methods or principles related to the RT sequence and PBS sequence of pegRNA in prime editing (PE) techniques that have been reported in the prior art.

[0037] The number of pegRNAs can be one, two, or more.

[0038] In some embodiments, the pegRNA further includes a tRNA sequence and a tevopreQ1 motif sequence, wherein the pegRNA is composed of a tRNA sequence, an esgRNA, an RT sequence, a PBS sequence, and a tevopreQ1 motif sequence in sequence.

[0039] In some preferred embodiments, the tRNA sequence is shown as positions 1957-2033 of sequence 1.

[0040] The tevopreQ1 motif sequence is shown as positions 2178-2214 of sequence 1.

[0041] In some embodiments, the pegRNA further includes an HDV sequence, which, when used in conjunction with the tRNA sequence, can be used to cleave and generate the pegRNA.

[0042] In some preferred embodiments, the HDV sequence is as shown in positions 2468-2535 of sequence 1.

[0043] The aforementioned system further includes sgRNA', which is used to generate non-editable strand cuts, and the non-editable strand cut sites can be arbitrarily selected. The number of sgRNA' can be one, two, or more. The number of sgRNA' can be the same as or different from the number of pegRNA.

[0044] In some embodiments, the sgRNA' is a nesgRNA, which sequentially comprises a target sequence (denoted as target sequence B) and a nesgRNA backbone. Target sequence B and the aforementioned target sequence A are located on opposite strands of the target DNA, and they may be complementary or partially complementary, or they may be some distance apart.

[0045] In some implementations, the nesgRNA further includes a tRNA sequence, which is composed of tRNA, a target sequence (denoted as target sequence B), and a nesgRNA backbone in sequence.

[0046] In some specific implementations, the tRNA sequence is shown as positions 338-414 of Sequence 1.

[0047] The nesgRNA backbone is an RNA molecule obtained by replacing T with U in positions 435-520 of sequence 1.

[0048] The aforementioned system also includes screening marker proteins, which are used to screen transgenic plants or transgenic plant cells. These screening marker proteins include, but are not limited to, color screening marker proteins (such as green fluorescent protein, red fluorescent protein, anthocyanin-related proteins, etc.) and resistance screening marker proteins (such as hygromycin resistance protein, kanamycin resistance protein, herbicide phosphinic acid resistance protein, glyphosate resistance protein, etc.).

[0049] In some embodiments, the screening marker protein is the resistance screening marker protein Neomycin.

[0050] The resistance selection marker protein Neomycin is any one of the following: E1) The amino acid sequence of the protein is shown in sequence 12; E2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in E1); The amino acid sequence shown in E3) has 75% or more identity with that shown in E1) and encodes the protein of the resistance selection marker protein Neomycin.

[0051] The gene encoding the resistance selection marker protein Neomycin is any one of the following: e1) The DNA molecule shown in positions 11057-11859 of sequence 1; The nucleotide sequence defined by e2) has 75% or more identity with e1) and encodes the DNA molecule of the resistance selection marker protein Neomycin.

[0052] In any of the proteins described above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tags include, but are not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0053] In any of the proteins described above, the identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained. The identity includes amino acid sequences that are 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher than the amino acid sequences shown in Sequence 2, Sequence 3, Sequence 4, Sequence 6 and Sequence 12 of the present invention.

[0054] Any of the proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0055] Identity in any of the aforementioned coding genes refers to sequence similarity to natural nucleic acid sequences. This identity includes nucleotide sequences having 75% or higher, or 80% or higher, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0056] The aforementioned system includes a fusion protein expression cassette, a miRNA expression cassette that inhibits the expression of the RDR6 protein-coding gene, an sgRNA expression cassette, and a pegRNA expression cassette.

[0057] The fusion protein expression cassette sequentially includes a promoter for driving the expression of the fusion protein, the gene encoding the fusion protein, and a terminator for terminating the expression of the fusion protein.

[0058] The miRNA expression cassette that inhibits the expression of the RDR6 protein-encoding gene includes, in sequence, a promoter for driving the transcription of the miRNA, a DNA sequence for transcribing the miRNA, and a terminator for terminating the transcription of the miRNA.

[0059] The sgRNA' expression cassette sequentially includes a promoter for driving the transcription of the sgRNA', a DNA sequence for transcribing the sgRNA', and a terminator for terminating the transcription of the sgRNA'.

[0060] The pegRNA expression cassette sequentially includes a promoter for driving pegRNA transcription, a DNA sequence for transcribing the pegRNA, and a terminator for terminating pegRNA transcription.

[0061] Furthermore, the complete system also includes a screening marker protein expression cassette. The screening marker protein expression cassette sequentially includes a promoter for driving the expression of the screening marker protein, a gene encoding the screening marker protein, and a terminator for terminating the expression of the screening marker protein.

[0062] Furthermore, the promoter used to drive the expression of the fusion protein is preferably a 2×35S promoter. The nucleotide sequence of the 2×35S promoter is shown at positions 2823-3705 of Sequence 1.

[0063] The promoter used to drive miRNA transcription is preferably the PCE8 promoter. The nucleotide sequence of the PCE8 promoter is shown in positions 1-601 of sequence 7.

[0064] The promoter used to drive sgRNA transcription is preferably the OsU3 promoter. The nucleotide sequence of the OsU3 promoter is shown in positions 1-337.

[0065] The promoter used to drive pegRNA transcription is preferably the OsU3 Complex promoter. The nucleotide sequence of the OsU3 Complex promoter is shown in positions 710-1955 of Sequence 1.

[0066] The promoter used to drive the expression of the selection marker protein is preferably the TCUP2 promoter. The nucleotide sequence of the TCUP2 promoter is shown in positions 10547-11048 of Sequence 1.

[0067] Furthermore, the terminator used to terminate the expression of the fusion protein is preferably the tEXT terminator. The nucleotide sequence of the tEXT terminator is shown in positions 10067-10546 of Sequence 1.

[0068] The terminator used to terminate miRNA transcription is preferably... t35s Termination unit. The aforementioned t35s The nucleotide sequence of the terminator is shown in positions 1014-1208 of sequence 7.

[0069] The terminator used to terminate sgRNA transcription is preferably a PolyT sequence. The nucleotide sequence of the PolyT sequence is shown at positions 704-709 of Sequence 1.

[0070] The terminator used to terminate pegRNA transcription is preferably a PolyT+tHsp sequence. The nucleotide sequence of the PolyT+tHsp is shown in positions 2536-2814 of Sequence 1.

[0071] The terminator used to terminate the expression of the screening marker protein is the tNos terminator. The nucleotide sequence of the tNos terminator is shown in positions 11860-12114 of Sequence 1.

[0072] In this invention, the various elements or expression cassettes included in the complete system can be expressed using one, two, or more recombinant expression vectors. Recombinant vectors containing sequences encoding or transcribing the aforementioned elements or expression cassettes can be constructed using existing plant expression vectors.

[0073] In some implementations, the complete system is expressed via a recombinant expression vector.

[0074] In some embodiments, the complete system is expressed using the PE-Nt8 recombinant expression vector. The nucleotide sequence of the PE-Nt8 recombinant expression vector is obtained by inserting the gene sequence encoding the small RNA binding protein La shown in Sequence 5 between positions 9906 and 9907 of Sequence 1, and replacing the small fragment between positions 2815 and 2822 of Sequence 1 with the amiR-NtRDR6 expression cassette shown in Sequence 7.

[0075] To address the aforementioned technical problems, the present invention also provides new applications for the aforementioned complete system.

[0076] This invention provides the application of the above-described complete system in any of the following: 1) Editing of dicotyledonous plant genome sequences; 2) Preparation of products for editing the genome sequence of dicotyledonous plants; 3) Improve the efficiency of genome sequence editing in dicotyledonous plants; 4) Prepare products that improve the efficiency of genome sequence editing in dicotyledonous plants; 5) Prepare dicotyledonous plant mutants.

[0077] To address the aforementioned technical problems, this invention also provides a method for editing the genome sequence of dicotyledonous plants.

[0078] The method for editing the genome sequence of dicotyledonous plants provided by the present invention includes the following steps: importing the above-mentioned complete system into dicotyledonous plants to achieve the editing of the genome sequence of dicotyledonous plants.

[0079] To address the aforementioned technical problems, this invention also provides a method for improving the efficiency of editing dicotyledonous plant genome sequences.

[0080] The method for improving the editing efficiency of dicotyledonous plant genome sequences provided by the present invention includes the following steps: introducing the above-mentioned complete system into dicotyledonous plants to improve the editing efficiency of dicotyledonous plant genome sequences.

[0081] In the above method, the complete system is introduced into dicotyledonous plants via recombinant expression vectors. The number of recombinant expression vectors can be one, two, or more.

[0082] The methods of introduction include, but are not limited to: transfecting dicotyledonous plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and then culturing the transfected dicotyledonous plant cells or tissues into plants.

[0083] In some implementations, the complete system is introduced into dicotyledonous plants via the aforementioned PE-Nt8 recombinant expression vector.

[0084] To address the aforementioned technical problems, this invention ultimately provides a method for preparing dicotyledonous plant mutants.

[0085] The method for preparing dicotyledonous plant mutants provided by the present invention includes the following steps: editing the dicotyledonous plant genome sequence according to the above-mentioned method for editing dicotyledonous plant genome sequences to obtain dicotyledonous plant mutants.

[0086] The amino acid sequence of any of the NtRDR6 proteins described above is shown in Sequence 10, and the gene sequence encoding the NtRDR6 protein is shown in Sequence 11.

[0087] Editing any of the aforementioned genome sequences includes base substitution, base insertion, and / or base deletion at the genome sequence editing site.

[0088] The bases include monobasic and / or polybasic bases.

[0089] The edit site may include one, two, or more. The site may be a neighboring site or a non-neighboring site.

[0090] In some implementations, the editing of the genome sequence is a base substitution of the genome sequence. The base substitution can be a single base substitution, the simultaneous substitution of several adjacent bases, or the simultaneous substitution of several non-adjacent bases.

[0091] Editing of any of the aforementioned genome sequences includes editing one, two, or more genes.

[0092] In some embodiments, the gene is at least one of the following genes: NtBADH2a gene, NtBADH2b gene, and NtCPS2 gene.

[0093] In some specific implementations, the editing of the genome sequence is a co-editing (or simultaneous editing) of three genes, such as the co-editing (or simultaneous editing) of the NtBADH2a gene, the NtBADH2b gene, and the NtCPS2 gene.

[0094] Any of the dicotyledonous plants mentioned above can be plants of the Solanales order.

[0095] Furthermore, the plants in the order Solanales can be plants of the family Solanaceae.

[0096] Furthermore, the Solanaceae plants mentioned may be plants of the Tobacco genus.

[0097] Furthermore, the *Nicotiana* species are *Nicotiana tabacum*. The *Nicotiana tabacum* includes cultivated *Nicotiana scabra* (such as *Nicotiana scabra*) and model *Nicotiana* (such as *Nicotiana benthamiana*).

[0098] In some implementations, the tobacco is safflower safflower.

[0099] To overcome the application bottleneck of the PE system in dicotyledonous plants, this invention combines the following two strategies to obtain a novel guided editing system, PE-Nt8: 1. By introducing a small RNA-binding protein La into the core protein element of PE, this protein binds to the 3' end of pegRNA, physically blocking the cleavage sites of exonucleases (such as XRN1 and DIS3L2), thereby prolonging the intracellular half-life of pegRNA and increasing its effective concentration, thus improving the editing efficiency of the PE system in tobacco; 2. By adding an additional amiR-NtRDR6 expression cassette to the PE system expression vector, miRNA targeting NtRDR6 family homologous genes is obtained through transcription, thereby inhibiting the expression of the NtRDR6 encoding gene, a key protein in the gene silencing pathway, and increasing the expression level of the PE core protein nCas9-MMLV, thus improving the editing efficiency of the PE system in tobacco. Experiments have shown that the combination of the above two strategies can synergistically enhance the effect in tobacco, significantly increasing the editing efficiency of the PE system in tobacco. This invention significantly improves the overall gene editing effect of the PE system in tobacco by optimizing the PE system, providing a more precise and powerful tool for tobacco gene function research. Attached Figure Description

[0100] Figure 1 The diagram shows the structure of the expression vectors for each guided editing system. Note: The structures of the nesgRNA expression cassette, pegRNA expression cassette, and selection marker protein expression cassette are identical in the PE-Nt5, PE-Nt6, PE-Nt7, and PE-Nt8 system expression vectors. The only difference is the composition of the fusion protein expression cassette. Therefore, only the structure of the fusion protein expression cassette is shown in the PE-Nt5, PE-Nt6, PE-Nt7, and PE-Nt8 system expression vectors.

[0101] Figure 2 To analyze the efficiency of precise editing of target bases in different target genes of tobacco T0 seedlings using different guided editing systems.

[0102] Figure 3 To analyze the proportion of homozygous edited seedlings in tobacco T0 seedlings with precise editing of target bases of different target genes by different guided editing systems.

[0103] Figure 4 To analyze the co-editing efficiency of three genes in tobacco T0 seedlings using different guided editing systems. Detailed Implementation

[0104] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0105] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the experimental methods in the following embodiments are performed at least three times.

[0106] The tobacco variety Honghua Dajinyuan used in the following examples is described in the literature "Xiang Haiying, Liu Xin, Pang Tao, et al. Differential analysis of the metabolic profile of tobacco leaves at different growth stages of Honghua Dajinyuan based on non-targeted metabolomics [J]. Chinese Tobacco Science, 2022, 28(04):77-84". It is available to the public from the applicant. This biological material is only used to repeat the relevant experiments of this invention and cannot be used for other purposes.

[0107] Example 1: Design of main components and expression carriers of different guided editing systems I. Design of Main Components in Different Guided Editing Systems The guided editing systems designed in this invention are named PE-Nt5, PE-Nt6, PE-Nt7, and PE-Nt8, respectively.

[0108] The PE-Nt5 guided editing system includes a fusion protein, nesgRNA, and pegRNA. The fusion protein comprises, in sequence, a Cas9 nicking enzyme (e.g., Cas9Max), an NC protein, and a reverse transcriptase (e.g., MMLVΔRNaseH); the nesgRNA is used to generate a non-editing strand cut; the pegRNA consists of, in sequence, esgRNA, a reverse transcription template sequence (RT sequence), a primer binding site sequence (PBS sequence), and a tevopreQ1 motif sequence, wherein the esgRNA targets the editing strand's target sequence.

[0109] The PE-Nt6 guided editing system includes a fusion protein, nesgRNA, and pegRNA. The fusion protein comprises, in sequence, a Cas9 nicking enzyme (e.g., Cas9Max), an NC protein, a reverse transcriptase (e.g., MMLVΔRNaseH), and a La protein; the nesgRNA is used to generate a non-editing strand cut; the pegRNA consists of, in sequence, esgRNA, a reverse transcription template sequence (RT sequence), a primer binding site sequence (PBS sequence), and a tevopreQ1 motif sequence, wherein the esgRNA targets the editing strand's target sequence.

[0110] The PE-Nt7 guided editing system includes a fusion protein, amiR-NtRDR6, nesgRNA, and pegRNA. The fusion protein comprises, in sequence, a Cas9 nicking enzyme (e.g., Cas9Max), an NC protein, and a reverse transcriptase (e.g., MMLVΔRNaseH); amiR-NtRDR6 is a small RNA (sRNA) that inhibits the expression of the NtRDR6 protein-encoding gene; nesgRNA is used to generate a non-editing strand cut; and pegRNA consists, in sequence, esgRNA, a reverse transcription template sequence (RT sequence), a primer binding site sequence (PBS sequence), and a tevopreQ1 motif sequence, wherein the esgRNA targets the editing strand's target sequence.

[0111] The PE-Nt8 guided editing system includes a fusion protein, amiR-NtRDR6, nesgRNA, and pegRNA. The fusion protein comprises, in sequence, a Cas9 nicking enzyme (e.g., Cas9Max), an NC protein, a reverse transcriptase (e.g., MMLVΔRNaseH), and a La protein; amiR-NtRDR6 is a small RNA (sRNA) that inhibits the expression of the NtRDR6 protein-encoding gene; nesgRNA is used to generate a non-editing strand cut; and pegRNA consists of esgRNA, a reverse transcription template sequence (RT sequence), a primer binding site sequence (PBS sequence), and a tevopreQ1 motif sequence, wherein the esgRNA targets the editing strand's target sequence.

[0112] II. Design of Expression Carriers for Different Guided Editing Systems The PE-Nt5 guided editing system's expression vectors include the Cas9Max&NC&MMLVΔRNaseH fusion protein expression cassette, the nesgRNA expression cassette, the pegRNA expression cassette, and the selection marker protein expression cassette. The Cas9Max&NC&MMLVΔRNaseH expression cassette is driven by a 2×35S promoter; the nesgRNA expression cassette is driven by an OsU3 promoter; the pegRNA expression cassette is driven by an OsU3Complex promoter; and the selection marker protein expression cassette is driven by a TCUP2 promoter.

[0113] The PE-Nt6 guided editing system's expression vectors include the Cas9Max&NC&MMLV△RNaseH&La fusion protein expression cassette, the nesgRNA expression cassette, the pegRNA expression cassette, and the selection marker protein expression cassette. The Cas9Max&NC&MMLV△RNaseH&La expression cassette is driven by a 2×35S promoter; the nesgRNA expression cassette is driven by an OsU3 promoter; the pegRNA expression cassette is driven by an OsU3 Complex promoter; and the selection marker protein expression cassette is driven by a TCUP2 promoter.

[0114] The expression vectors of the PE-Nt7 guided editing system include the Cas9Max&NC&MMLVΔRNaseH expression cassette, the amiR-NtRDR6 expression cassette, the nesgRNA expression cassette, the pegRNA expression cassette, and the selection marker protein expression cassette. The Cas9Max&NC&MMLVΔRNaseH expression cassette is driven by a 2×35S promoter; the amiR-NtRDR6 expression cassette is driven by a PCE8 promoter; the nesgRNA expression cassette is driven by an OsU3 promoter; the pegRNA expression cassette is driven by an OsU3 Complex promoter; and the selection marker protein expression cassette is driven by a TCUP2 promoter.

[0115] The PE-Nt8 guided editing system's expression vectors include the Cas9Max&NC&MMLV△RNaseH&La fusion protein expression cassette, the amiR-NtRDR6 expression cassette, the nesgRNA expression cassette, the pegRNA expression cassette, and the selection marker protein expression cassette. The Cas9Max&NC&MMLV△RNaseH&La fusion protein expression cassette is driven by a 2×35S promoter; the amiR-NtRDR6 expression cassette is driven by a PCE8 promoter; the nesgRNA expression cassette is driven by an OsU3 promoter; the pegRNA expression cassette is driven by an OsU3Complex promoter; and the selection marker protein expression cassette is driven by a TCUP2 promoter.

[0116] The structural diagrams of the expression carriers of the above-mentioned guided editing systems are as follows: Figure 1 As shown.

[0117] Example 2: Construction of recombinant expression vectors with different guided editing systems and their application in tobacco gene editing I. Construction of Expression Carriers for Different Guided Editing Systems Using NtBADH2a, NtBADH2b, and NtCPS2 as target genes, recombinant expression vectors for each guided editing system in Example 1 were constructed. The specific steps are as follows: 1. Design of pegRNA and nesgRNA PegRNAs and nesgRNAs were designed based on the gene sequences of NtBADH2a, NtBADH2b, and NtCPS2. A separate pegRNA was designed for the NtCPS2 gene, while a shared pegRNA was designed for NtBADH2a and NtBADH2b, as they are homologous genes. The target sequences, RT+PBS sequences, and nesgRNA target sequences of the pegRNAs are shown in Table 1.

[0118] Table 1

[0119] 2. Construction of recombinant expression vectors Based on the pegRNA and nesgRNA designed in step 1, recombinant expression vectors for each guided editing system in Example 1 were artificially synthesized. Each vector was a circular plasmid, and each recombinant expression vector contained two nesgRNAs and two pegRNAs, simultaneously editing three genes.

[0120] The nucleotide sequence of the PE-Nt5 recombinant expression vector is shown in Sequence 1. In Sequence 1, positions 1-337 are the nucleotide sequence of the OsU3 promoter, positions 338-414 are the tRNA nucleotide sequence, positions 415-434 are the nesgRNA target sequence for generating the non-edited strand cleavage of the NtCPS2 gene, positions 435-520 are the nesgRNA backbone sequence, positions 521-597 are the tRNA nucleotide sequence, positions 598-617 are the nesgRNA target sequence for generating the non-edited strand cleavage of the NtBADH2a & NtBADH2b genes, positions 618-703 are the nesgRNA backbone sequence, and positions 7... Positions 04-709 are the polyT sequence; positions 710-1955 are the nucleotide sequence of the OsU3 Complex promoter; positions 1957-2033 are the nucleotide sequence of the tRNA; positions 2034-2053 are the pegRNA target sequence of the NtCPS2 gene; positions 2054-2139 are the esgRNA backbone sequence; positions 2140-2157 are the RT sequence on the pegRNA; positions 2158-2169 are the PBS sequence on the pegRNA; positions 2170-2177 are the linker sequence on the pegRNA; and positions 2... Positions 178-2214 are the tevopreQ1 motif sequence on the pegRNA; positions 2215-2291 are the nucleotide sequence of the tRNA; positions 2292-2311 are the pegRNA target sequence of the NtBADH2a & NtBADH2b genes; positions 2312-2397 are the esgRNA backbone sequence; positions 2398-2411 are the RT sequence on the pegRNA; positions 2412-2422 are the PBS sequence on the pegRNA; positions 2423-2430 are the linker sequence on the pegRNA; and positions 2431... Position -2467 is the tevopreQ1 motif sequence on the pegRNA; positions 2468-2535 are the HDV sequence; positions 2536-2814 are the PolyT+tHsp sequence; positions 2823-3705 are the nucleotide sequence of the 2×35S promoter; positions 3715-3918 are the coding sequence of the 4×NLS nuclear localization signal peptide, which is shown in sequence 13; positions 3919-8019 are the coding sequence of the Cas9Max protein (without a stop codon), which is shown in sequence 2.Positions 8020-8067 are the coding sequence for the XTEN Linker; positions 8068-8235 are the coding sequence for the NC protein (without a stop codon), encoding the NC protein shown in sequence 3; positions 8236-8358 are the NLS+ Linker sequence; positions 8365-9906 are the coding sequence for the MMLV△RNaseH protein (without a stop codon), encoding the MMLV△RNaseH protein shown in sequence 4; positions 9925-10035 are the coding sequence for the 4×NLS nuclear localization signal peptide; positions 10067-10546 are the nucleotide sequence for the tEXT terminator; positions 10547-11048 are the TCUP2 promoter sequence; positions 11057-11859 are the Neomycin gene sequence, encoding the Neomycin protein shown in sequence 12; positions 11860-12114 are the tNos terminator sequence.

[0121] The nucleotide sequence of the PE-Nt6 recombinant expression vector is obtained by inserting the La protein-coding gene sequence between positions 9906 and 9907 of the PE-Nt5 recombinant expression vector nucleotide sequence. The La protein-coding gene sequence is shown in Sequence 5, encoding the La protein shown in Sequence 6.

[0122] The nucleotide sequence of the PE-Nt7 recombinant expression vector is obtained by replacing the small fragment between positions 2815 and 2822 of the PE-Nt5 recombinant expression vector nucleotide sequence with the amiR-NtRDR6 expression cassette. The nucleotide sequence of the amiR-NtRDR6 expression cassette is shown in Sequence 7, where positions 1-601 are the nucleotide sequence of the PCE8 promoter, positions 602-1013 are the amiR-NtRDR6 gene sequence, and positions 1014-1208 are... t35s The nucleotide sequence of the terminator. The amiR-NtRDR6 expression cassette can express the repressor. NtRDR6 The miRNA expressed by the gene, the precursor sequence of which is shown in Sequence 8, and the mature sequence of which is shown in Sequence 9.

[0123] The nucleotide sequence of the PE-Nt8 recombinant expression vector is obtained by inserting the La protein-coding gene sequence between positions 9906 and 9907 of the PE-Nt5 recombinant expression vector nucleotide sequence and replacing the small fragment between positions 2815 and 2822 of the PE-Nt5 recombinant expression vector nucleotide sequence with the amiR-NtRDR6 expression cassette.

[0124] II. Obtaining Tobacco-Positive T0 Seedlings The recombinant expression vectors PE-Nt5, PE-Nt6, PE-Nt7, and PE-Nt8 obtained in step one were processed according to steps 1-6 below: 1. The recombinant expression vector was introduced into Agrobacterium GV3101, and after identification, recombinant Agrobacterium containing the recombinant expression vector was obtained.

[0125] 2. The recombinant Agrobacterium obtained in step 1 was cultured in YEP medium containing 50 µg / mL kanamycin and 25 µg / mL rifampin (composed of solvent and solute; the solvent was water, and the solute and its concentration were 10.0 g / L yeast extract, 10.0 g / L peptone, 5.0 g / L sodium chloride, and 15.0 g / L agar powder, with a pH of 7.0). The cells were centrifuged at 2500 rpm / min for 1 min at 4 °C, and the cells were collected. The cells were resuspended in MS medium, and acetylsuccione (final concentration 25 mg / L) was added to obtain the Agrobacterium infection solution.

[0126] 3. Cut the sterile leaves of tobacco (Safflower Dajinyuan) into small pieces and soak them in the Agrobacterium infection solution obtained in step 2 for 8-15 minutes, shaking occasionally during the process. Then, place the tobacco leaves on sterile filter paper to absorb the bacterial solution on the surface and inoculate them onto the pre-medium (composed of solvent and solute, with water as the solvent and the solute and its concentration as follows: MS solid medium 4.4 g / L, sucrose 30 g / L, NAA (naphthaleneacetic acid) 0.2 mg / L, 6-BA (benzyladenine) 1.5 mg / L, agar powder 8 g / L, pH 5.8). Incubate in the dark at 25°C for 2-4 days.

[0127] 4. Transfer the explants obtained in step 3 to a selection medium containing 50 mg / L kanamycin (composed of solvent and solute; the solvent is water, and the solute and its concentration are 4.4 g / L MS solid medium, 30 g / L sucrose, 0.2 mg / L NAA (naphthaleneacetic acid), 1.5 mg / L 6-BA (benzyladenine), 100 mg / L termethin, 8 g / L agar powder, pH 5.8), and culture at 25℃ with alternating light and dark conditions. When the differentiated shoots grow to more than 1 cm, cut them off and inoculate them onto a rooting medium containing 50 mg / L kanamycin (composed of solvent and solute; the solvent is water, and the solute and its concentration are 4.4 g / L MS solid medium, 30 g / L sucrose, 8 g / L agar powder, pH 5.8), and culture for one month. Transplant and harden off the seedlings. When the plants grow to about 10 cm, transplant them into a greenhouse for further cultivation to obtain tobacco T0 seedlings.

[0128] 5. Using the genomic DNA of tobacco T0 seedlings as a template, PCR amplification was performed using primers F1 (cactatccttcgcaagaccct) and R1 (ccatctcgttggagaagatctcc) to obtain the PCR product. The PCR product was then subjected to agarose gel electrophoresis, and the following judgment was made: if the PCR amplification yielded a DNA fragment of 675 bp, the corresponding tobacco T0 seedling was a tobacco-positive T0 seedling; if the PCR amplification did not yield a DNA fragment of 675 bp, the corresponding tobacco T0 seedling was not a tobacco-positive T0 seedling.

[0129] III. Analysis of Editing Efficiency of Different Guided Editing Systems 1. PCR amplification and sequencing of PCR products Genomic DNA from the tobacco-positive T0 seedlings obtained in step 5 of step two was used as a template for each vector. PCR amplification was performed using primer pairs corresponding to different target genes, and the PCR products were then sequenced using the Sanger sequencing method. The primer pairs used for PCR amplification are as follows: NtCPS2 The primer pair sequences corresponding to the gene are as follows: NtCPS2-F: 5'-CACTCAAAAAACTCCGAAGAAAAG-3'.

[0130] NtCPS2-R: 5'-CCATAATGTCAATGCAATAACACAT-3'.

[0131] NtBADH2a The primer pair sequences corresponding to the gene are as follows: NtBADH2a-F: 5'-GTACACATCTTCACAGACCTATGC-3'.

[0132] NtBADH2a-R: 5'-CAATAGATTGCAAGAGATCTTTGA-3'.

[0133] NtBADH2b The primer pair sequences corresponding to the gene are as follows: NtBADH2b-F: 5'-ATCTGTCCAGTGGACGTGACTA-3'.

[0134] NtBADH2b-R: 5'-AAGTTATCAAAACGCTTTAGCAG-3'.

[0135] 2. Analysis of the efficiency of precise editing of target bases of different target genes in tobacco T0 seedlings by different guided editing systems The precision editing efficiency of different target bases in different target genes of tobacco T0 seedlings using different guided editing systems was analyzed. The precision editing efficiency of target bases in T0 seedlings was calculated as (number of tobacco plants with precise target base editing / total number of sequencing-positive seedlings) × 100%. Specifically, precise editing of the NtCPS2 gene target bases refers to the change from ACAGATGAAAGGTTTGACAT to ACAGATGAA. G GG C TTGACA G (The underlined bases are the target mutant bases). Precise editing of the target bases in the NtBADH2a gene refers to changing GGCAGCTGTTCATCGACGGT to GGCAGCTGTTCAT. T GAC T G A (The underlined bases are the target mutant bases). Precise editing of the target bases in the NtBADH2b gene refers to the change from GGCAGCTGTTCATCGACGGT to GGCAGCTGTTCAT. T GAC T G A (The underlined bases are the target mutant bases).

[0136] The results are as follows Figure 2 As shown in the figure, compared to the PE-Nt5 system, the PE-Nt6, PE-Nt7, and PE-Nt8 systems all exhibited varying degrees of improvement in the precise editing efficiency of target bases. Among them, the PE-Nt8 system showed the greatest improvement. This indicates that the addition of the La protein downstream of the M-MLV reverse transcriptase, along with the addition of the amiR-NtRDR6 expression cassette, can synergistically and significantly enhance the precise editing efficiency of the PE system in tobacco.

[0137] 3. Analysis of the proportion of homozygous edited seedlings with precise editing of different target bases in tobacco T0 seedlings using different guided editing systems. The proportion of homozygous edited seedlings with precise target base editing of different target genes in tobacco T0 seedlings under different guided editing systems was analyzed. The proportion of homozygous edited seedlings with precise target base editing in T0 seedlings was calculated as (number of tobacco plants with homozygous precise target base editing / total number of sequencing-positive seedlings) × 100%. Among them, homozygous precise editing of the target base of the NtCPS2 gene refers to the change from ACAGATGAAAGGTTTGACAT to ACAGATGAA on all four homologous chromosomes. G GG C TTGACA G(The underlined bases are the target mutant bases). Homozygous precise editing of the NtBADH2a gene target bases refers to the change of GGCAGCTGTTCATCGACGGT to GGCAGCTGTTCAT on all four homologous chromosomes. T GAC T G A (The underlined bases are the target mutant bases). Homozygous precise editing of the NtBADH2b gene target bases means that GGCAGCTGTTCATCGACGGT is changed to GGCAGCTGTTCAT on all four homologous chromosomes. T GAC T G A (The underlined bases are the target mutant bases).

[0138] The results are as follows Figure 3 As shown in the figure, compared with other PE systems, the PE-Nt8 system greatly increases the proportion of homozygous edited seedlings that undergo precise editing of the target base.

[0139] 4. Analysis of the efficiency of three-gene co-editing in tobacco T0 seedlings by different guided editing systems The co-editing efficiency of three genes in tobacco T0 seedlings using different guided editing systems was analyzed. The co-editing efficiency was calculated as (number of tobacco plants with simultaneous precise editing of the target bases in all three target genes / total number of sequencing-positive seedlings) × 100%. Simultaneous precise editing of the target bases in all three target genes refers to precise editing of the target bases in the NtCPS2 gene, the NtBADH2a gene, and the NtBADH2b gene. Specifically, precise editing of the target bases in the NtCPS2 gene refers to the change from ACAGATGAAAGGTTTGACAT to ACAGATGAA. G GG C TTGACA G (The underlined bases are the target mutant bases). Precise editing of the target bases in the NtBADH2a gene refers to changing GGCAGCTGTTCATCGACGGT to GGCAGCTGTTCAT. T GAC T G A (The underlined bases are the target mutant bases). Precise editing of the target bases in the NtBADH2b gene refers to the change from GGCAGCTGTTCATCGACGGT to GGCAGCTGTTCAT. T GAC T G A (The underlined bases are the target mutant bases).

[0140] The results are as follows Figure 4As shown in the figure, the PE-Nt8 system increased the efficiency of three-gene co-editing in tobacco T0 seedlings from 4.5% to 21%, an increase of 4.6 times.

[0141] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A complete system comprising a fusion protein, a substance that reduces the content and / or activity of RDR6 protein, and pegRNA; The fusion protein includes a nuclease, a reverse transcriptase, and a small RNA-binding protein, La. The pegRNA includes sgRNA, a reverse transcription template sequence, and a primer binding site sequence; the sgRNA targets the editing strand target sequence.

2. The complete system according to claim 1, characterized in that: The substance that reduces the content and / or activity of RDR6 protein is a nucleic acid molecule that inhibits the expression of the RDR6 protein encoding gene; Alternatively, the nucleic acid molecule that inhibits the expression of the RDR6 protein-coding gene is a miRNA that inhibits the expression of the RDR6 protein-coding gene.

3. The complete system according to claim 1 or 2, characterized in that: The system also includes sgRNA', which is used to generate non-editable strand cuts.

4. The complete system according to any one of claims 1-3, characterized in that: The fusion protein, starting from the N-terminus, comprises a nuclease, a nucleocapsid protein NC, a reverse transcriptase, and a small RNA-binding protein La.

5. The complete system according to any one of claims 1-4, characterized in that: The nuclease is a Cas9 nuclease; Alternatively, the Cas9 nuclease may be a Cas9 nicking enzyme; Alternatively, the Cas9 nicking enzyme is Cas9Max; the Cas9Max is any of the following: A1) The amino acid sequence is that of the protein shown in sequence 2; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in A1); A3) has 75% or more of the same amino acid sequence as A1) and encodes the protein of the Cas9Max. Alternatively, the nucleocapsid protein NC may be any of the following: B1) The amino acid sequence of the protein is shown in sequence 3; B2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in B1); B3) has 75% or more of the same amino acid sequence as B1) and encodes the nucleocapsid protein NC. Alternatively, the reverse transcriptase is MMLVΔRNaseH; the MMLVΔRNaseH is any one of the following: C1) The amino acid sequence is the protein shown in sequence 4; C2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in C1); C3) has 75% or more of the same amino acid sequence as C1) and encodes the nucleocapsid protein NC. Alternatively, the small RNA-binding protein La may be any of the following: D1) The amino acid sequence is that of the protein shown in sequence 6; D2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in D1); The amino acid sequence shown in D3) has 75% or more identity with that shown in D1) and encodes the small RNA-binding protein La.

6. The complete system according to any one of claims 1-5, characterized in that: The complete system includes a fusion protein expression cassette, a miRNA expression cassette that inhibits the expression of the RDR6 protein-coding gene, an sgRNA expression cassette, and a pegRNA expression cassette. Alternatively, the miRNA expression cassette that inhibits the expression of the RDR6 protein-coding gene includes a promoter for driving the transcription of the miRNA; Alternatively, the promoter may be a PCE8 promoter; Alternatively, the nucleotide sequence of the PCE8 promoter is shown in positions 1-601 of sequence 7.

7. The application of the complete system according to any one of claims 1-6 in any of the following: 1) Editing of dicotyledonous plant genome sequences; 2) Preparation of products for editing the genome sequence of dicotyledonous plants; 3) Improve the efficiency of genome sequence editing in dicotyledonous plants; 4) Prepare products that improve the efficiency of genome sequence editing in dicotyledonous plants; 5) Prepare dicotyledonous plant mutants.

8. A method for editing the genome sequence of a dicotyledonous plant, comprising the following steps: introducing the complete system described in any one of claims 1-6 into a dicotyledonous plant to achieve the editing of the genome sequence of the dicotyledonous plant.

9. A method for improving the editing efficiency of dicotyledonous plant genome sequences, comprising the following steps: introducing the complete system according to any one of claims 1-6 into dicotyledonous plants to improve the editing efficiency of dicotyledonous plant genome sequences.

10. A method for preparing a dicotyledonous plant mutant, comprising the following steps: editing the genome sequence of a dicotyledonous plant according to the method described in claim 8 to obtain a dicotyledonous plant mutant.

Images