Application and method of miR168-1 and target gene GhNAC087 in regulating cotton cold stress tolerance

Abstract

The application discloses application and a method of miR168-1 and a target gene GhNAC087 in regulation of cotton cold stress tolerance, and belongs to the technical field of genetic engineering. A precursor sequence of the miR168-1 is shown as SEQ ID NO. 1, and a mature body sequence is shown as SEQ ID NO. 2. The application aims to provide application and a method of miR168-1 and the target gene GhNAC087 in regulation of cotton cold stress tolerance. The application effectively improves the cotton cold stress tolerance by silencing the miR168-1 and negatively regulating the target gene GhNAC087, and obtains a transformation material with cold stress tolerance.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the application and method of miR168-1 and its target gene GhNAC087 in regulating cotton's tolerance to cold stress. Background Technology

[0002] Cotton is a vital global economic crop and a major source of natural fiber, playing a crucial role in the textile industry. However, with the intensification of global climate change and the deterioration of the ecological environment, cotton growth and development are increasingly affected by various abiotic stresses, including drought, salinity, low temperature, and high temperature. Among these, cold stress is one of the key environmental factors restricting plant growth, development, and geographical distribution. After being subjected to continuous or brief low-temperature stress, the physiological and biochemical metabolic processes within plant cells are disrupted, photosynthesis is inhibited, leading to slowed plant growth, reduced yield, and deterioration in quality. To cope with adverse environments, plants have evolved a series of complex stress response mechanisms. Inducing the expression of stress-related genes is considered one of the core strategies for plants to improve their environmental adaptability. Therefore, in-depth analysis of the molecular mechanisms of cotton's cold stress response and the discovery of key regulatory genes are of great significance for breeding cold-resistant cotton varieties and ensuring the sustainable development of the cotton industry.

[0003] miRNAs are a class of endogenous non-coding small RNAs, typically 21-24 nucleotides in length. They mediate mRNA cleavage or inhibit translation by binding to target mRNAs, thereby downregulating the expression levels of target genes. Existing research indicates that miRNAs play an important regulatory role in plant responses to cold stress. For example, some reports suggest that miRNAs can affect plant cold tolerance by binding to target genes and downregulating their expression levels. However, these studies have largely focused on model plants such as Arabidopsis thaliana and rice, or some economic crops. In cotton, the specific regulatory mechanisms by which miRNAs participate in cold stress responses remain unclear, especially the function of regulatory modules formed by specific miRNAs and their target genes in cotton cold tolerance has not been systematically reported. Summary of the Invention

[0004] The purpose of this invention is to provide the application and method of miR168-1 and its target gene GhNAC087 in regulating cotton cold stress tolerance. This invention effectively improves cotton cold stress tolerance by silencing miR168-1 and negatively regulating its target gene GhNAC087, thus obtaining transformant materials tolerant to cold stress.

[0005] To achieve the above objectives, the present invention provides the following solution: The application of miR168-1 in regulating cotton's cold stress tolerance, wherein the precursor sequence of miR168-1 is shown in SEQ ID NO.1 and the mature sequence is shown in SEQ ID NO.2.

[0006] Preferably, the target gene of miR168-1 is GhNAC087, and the nucleotide sequence of GhNAC087 is shown in SEQ ID NO.3.

[0007] Preferably, cotton cold stress tolerance is improved by silencing miR168-1.

[0008] The present invention also provides the application of the GhNAC087 gene in improving the cold stress tolerance of cotton. The nucleotide sequence of the GhNAC087 gene is shown in SEQ ID NO.3. Overexpression of the GhNAC087 gene improves the cold stress tolerance of cotton.

[0009] This invention also provides the application of the miR168-1 or GhNAC087 gene in the breeding of cold-resistant cotton varieties.

[0010] This invention also provides the application of the miR168-1 or GhNAC087 gene in the preparation of biological agents to improve cotton's tolerance to cold stress.

[0011] The present invention also provides a recombinant vector containing an STTM168-1 sequence that targets and silences miR168-1, the nucleotide sequence of which is shown in SEQ ID NO.14.

[0012] The present invention also provides a recombinant strain comprising the recombinant vector described above.

[0013] The present invention also provides the application of the recombinant vector or the recombinant strain in improving the cold stress tolerance of cotton.

[0014] The present invention also provides a method for improving the cold stress tolerance of cotton, comprising the following steps: A recombinant vector targeting and silencing miR168-1 was constructed and used to transform cotton using Agrobacterium tumefaciens-mediated transformation to obtain cotton with improved cold stress tolerance. The precursor sequence of miR168-1 is shown in SEQ ID NO.1, and the mature sequence is shown in SEQ ID NO.2. The recombinant vector contains the STTM168-1 sequence, and the nucleotide sequence of STTM168-1 is shown in SEQ ID NO.14.

[0015] The present invention discloses the following technical effects: This invention provides the application and method of miR168-1 and its target gene GhNAC087 in regulating cold stress tolerance in cotton. The interaction between miR168-1 and GhNAC087 was preliminarily verified using GUS staining. Experimental results showed that miR168-1 significantly inhibited the expression of GhNAC087, verifying the negative regulatory relationship between miR168-1 and GhNAC087. This invention successfully constructed an STTM silencing vector for miR168-1 and transformed it into cotton, obtaining transformed materials with improved cold stress tolerance. Phenotypic identification results showed that the growth status of miR168-1-silenced plants was significantly better than that of wild-type plants, while overexpressing plants showed more severe damage phenotypes after cold treatment, indicating that the miR168-1 gene negatively regulates plant cold stress tolerance. GhNAC087-silenced plants showed significant cold damage after cold treatment, indicating that GhNAC087 plays a positive regulatory role in plant low-temperature stress response. This invention provides key genetic resources for cold-resistant crop breeding, and has significant economic benefits and broad application prospects. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 Results of target prediction analysis for miR168-1 and GhNAC087; Figure 2 The results of transient conversion of miR168-1 and GhNAC087 tobacco GUS activity analysis are shown. In the figure, A is stained tobacco tissue and B is a statistical graph of GUS expression level. express P <0.0001; Figure 3 Artificially designed STTM sequence for miR168-1; Figure 4 Figure 1 shows the expression analysis results of miR168-1 and GhNAC087 in TRV:00, TRV:miR168-1, TRV:STTM168-1, and TRV:GhNAC087; where A represents the target gene expression analysis results in TRV:00 and TRV:miR168-1, B represents the target gene expression analysis results in TRV:00 and TRV:STTM168-1, and C represents the target gene expression analysis results in TRV:00 and TRV:GhNAC087. Figure 5The figure shows the phenotypic analysis results of miR168-1 and GhNAC087 conversion materials. Detailed Implementation

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0021] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0022] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0023] In the following examples, the cotton variety is upland cotton TM-1, and this biomaterial is available to the public through common means.

[0024] Example 1 Verification of the interaction between miR168-1 and the target gene GhNAC087 1. RNA extraction and cDNA synthesis: Total RNA was extracted from the upland cotton TM-1 sample using a plant total RNA extraction kit (Tiangen Biotech Co., Ltd., Polysaccharide and Polyphenol Plant Total RNA Extraction Kit). After verifying its integrity by 1.0% agarose gel electrophoresis, cDNA was synthesized using a reverse transcription kit (Tiangen Biotech Co., Ltd., FastKing cDNA First Strand Synthesis Kit).

[0025] 2. Obtaining the target gene and linearized vector: The miRNA precursor fragment was amplified using DNA as a template, and the target gene CDS fragment was amplified using cDNA as a template. Amplification primers with homologous arms were designed based on the vector restriction site sequence, as follows: Amplifying miRNA precursor fragments using DNA as a template: (1) Primers (1301-168-1-F and 1301-168-1-R) were designed based on the miR168-1 precursor sequence (SEQ ID NO.1). Cotton DNA was used as a PCR template. The miR168-1 precursor sequence was amplified using a PCR amplification system with high-fidelity enzyme P515 (2×Phanta Max Master Mix, P515-01, Vazyme) to obtain the miR168-1 target gene fragment. The nucleotide sequence of primer 1301-168-1-F is shown in SEQ ID NO.4, and the nucleotide sequence of primer 1301-168-1-R is shown in SEQ ID NO.5.

[0026] (2) The pCAMBIA1301 was linearized by digesting the restriction endonuclease Nco I (TaKaRa Biotechnology Co., Ltd.). The miR168-1 target gene fragment obtained in step (1) was constructed downstream of the pCAMBIA1301 vector pCAM35S promoter by homologous recombination to obtain the pCAMBIA1301-miR168-1 recombinant plasmid. The obtained recombinant plasmid was transformed into Agrobacterium GV3101.

[0027] The PCR amplification system for P515 was as follows: 25 μL of 2×Phanta Max Master Mix, 1.5 μL each of forward and reverse primers, 500 ng of DNA / cDNA, and ddH2O to a final volume of 50 μL.

[0028] The amplification program was as follows: 95℃ for 3 min, 95℃ for 15 s, 56℃ for 15 s, 72℃ for 6 s, 72℃ for 5 min, for a total of 35 cycles from denaturation to extension. After amplification, the fragments were separated by 1.0% agarose gel electrophoresis, and the target fragment was identified by gel imaging. The target fragment was recovered using a gel recovery kit, and after concentration determination, it was stored at -20℃ for later use.

[0029] The enzyme digestion reaction system consisted of 25 μL of empty vector plasmid, 1 μL of restriction enzyme, 5 μL of Cutsmart, and ddH2O to a final volume of 50 μL. The reaction conditions were 37℃ for 4–6 h.

[0030] The homologous recombination reaction system consisted of: 2 μL ddH₂O, 4 μL target gene fragment, 1 μL linearized vector, 2 μL 5×CE II Buffer, and 1 μL Exnase II (ClonExpress II One Step Cloning Kit, Vazyme). The reaction conditions were 37℃ for 30 min. After recombination, the ligation product was obtained. This product was then transformed into *E. coli*, and positive clones were identified. Positive recombinant plasmids were extracted using a plasmid extraction kit, and after concentration determination, stored at -20℃ for later use.

[0031] Amplification of target gene CDS fragments using cDNA as a template: (1) Primers (1301-NAC087-F and 1301-NAC087-R) were designed based on the GhNAC087 gene sequence (SEQ ID NO.3). Cotton cDNA was used as a PCR template. The GhNAC087 gene sequence was amplified using a PCR amplification system with high-fidelity enzyme P515 (NovaZyn Biotech Co., Ltd., 2×Phanta Max Master Mix, P515-01) to obtain the GhNAC087 target gene fragment. The nucleotide sequence of primer 1301-NAC087-F is shown in SEQ ID NO.6, and the nucleotide sequence of primer 1301-NAC087-R is shown in SEQ ID NO.7.

[0032] (2) pCAMBIA1301-GUS was digested with restriction endonuclease Nco I (TaKaRa Biotechnology Co., Ltd.) to obtain a linearized vector. The GhNAC087 target gene fragment obtained in step (1) was constructed downstream of the pCAM35S promoter of the pCAMBIA1301-GUS vector by homologous recombination and upstream of the GUS gene was fused to obtain the pCAMBIA1301-GhNAC087 recombinant plasmid. The obtained recombinant plasmid was transformed into Agrobacterium GV3101.

[0033] The PCR amplification system for P515 is the same as above.

[0034] The amplification program was as follows: 95℃ for 3 min, 95℃ for 15 s, 56℃ for 15 s, 72℃ for 66 s, 72℃ for 5 min, for a total of 35 cycles from denaturation to extension. After amplification, the fragments were separated by 1.0% agarose gel electrophoresis, and the target fragment was identified by gel imaging. The target fragment was recovered using a gel recovery kit, and after concentration determination, it was stored at -20℃ for later use.

[0035] The double enzyme digestion reaction system and the homologous recombination reaction system are the same as above.

[0036] SEQ ID NO.1: GAAAGAAAGATAACCAAAAAAAAACAATTTATATATTTAAAAAAAAAAATCCCAAATCTAATGATTCAGAAGCAAATCTGTAGTTTCCATAATAATAAAACAAATCAATAGTCATAATAATTTTTTTTTTAAAAAAGCTACCAAAAA CAAGCAAGAAGGAAAATAAAATCCCAACCTGAGATCTGAATCATAAGCCTAAAAGTGAACAAAAAGGAAAGATCCACGCAACCTTCACCGCGGTCTCCGATTCAGTTGATGCAAGGCGGGATCCGATTCGCGCTTCCTCCAATCACGCCC.

[0037] SEQ ID NO.3:

[0038] SEQ ID NO.4: GAAAGAAAGATAACCAAAAAAAAACAA.

[0039] SEQ ID NO. 5: GGGCGTGATTGGAGGAAGC.

[0040] SEQ ID NO. 6: ATGGAAGAAGCTATTGTTGTGAACA.

[0041] SEQ ID NO.7: GTAATCCCATAAACATCTCAAATCTTCA.

[0042] 3. Verification of the transient co-expression and interaction of miR168-1-GhNAC087 in tobacco. Using tobacco leaves that have been incubated for approximately 6 weeks, and activating Agrobacterium tumefaciens containing the aforementioned recombinant plasmids, the specific experimental groups are as follows: (1) Agrobacterium tumefaciens suspension with pCAMBIA1301-miR168-1 vector; (2) Agrobacterium tumefaciens suspension with pCAMBIA1301-GhNAC087 (fusion GUS tag) vector; (3) mixed suspension of pCAMBIA1301-miR168-1 and pCAMBIA1301-GhNAC087 vectors (volume ratio 1:1); (4) pCAMBIA1301-GUS empty vector as a positive control. The suspensions were injected into tobacco leaves, kept in the dark for 2 hours, and then the resuspension was injected from the back of the tobacco leaf to fill the entire leaf. After 1 day of dark incubation, the leaves were cultured normally for 2 days. Tobacco leaves from the injection area were taken using a punch and placed in the staining solution prepared with the GUS staining kit, and stained at 37°C in the dark for 12-24 hours. After staining, the leaves were decolorized with 75% ethanol and immersed for 3-4 hours. This process was repeated 3-4 times to remove chlorophyll. The leaves were then stored in ethanol and the blue-colored areas were observed using a regular optical microscope to verify the effect of miRNA-target gene binding on GUS expression.

[0043] Stained tobacco tissue was collected, and total plant protein was extracted according to the GUS quantitative detection kit (Beijing Coollab Technology Co., Ltd., GUS gene quantitative detection kit, SL7161-50T). Protein extracts were prepared, and protein concentrations were measured. After a light-protected reaction, fluorescence intensity was detected using a fluorescence microplate reader. GUS expression levels were quantitatively detected using a 4-MU standard curve, and GUS activity was calculated. The GUS expression level regulated by miR168-1 under the target gene GhNAC087 was analyzed, and the binding efficiency between the two was verified. The results of the miR168-1 and GhNAC087 targeting prediction analysis are as follows: Figure 1 As shown in the figure, the results of the transient conversion GUS activity analysis of miR168-1 and GhNAC087 tobacco are as follows: Figure 2 As shown.

[0044] Depend on Figure 2 It was found that GUS activity remained high in the pCAMBIA1301-GhNAC087 vector. The pCAMBIA1301-miR168-1 vector showed no GUS staining because it lacked a fused GUS tag. When pCAMBIA1301-miR168-1 and pCAMBIA1301-GhNAC087 were co-expressed, GUS activity significantly decreased, indicating that miR168-1 significantly inhibited GhNAC087 expression, thus validating the negative regulatory relationship of miR168-1 on GhNAC087. These results demonstrate that miR168-1 inhibits GhNAC087 expression by targeting specific sites on GhNAC087 mRNA.

[0045] Example 2 Acquisition and phenotypic analysis of miR168-1 and GhNAC087 conversion materials 1. Construction of the overexpression vector of recombinant plasmid pTRV2-miR168-1 (1) Primers (TRV2-miR168-1-F and TRV2-miR168-1-R) were designed based on the miR168-1 precursor sequence (SEQ ID NO.1). Cotton DNA was used as a PCR template, and the miR168-1 precursor sequence was amplified using a PCR amplification system with high-fidelity enzyme P515 (2×Phanta Max Master Mix, P515-01, Vazyme) to obtain the miR168-1 target gene fragment. The nucleotide sequence of primer TRV2-miR168-1-F is shown in SEQ ID NO.8, and the nucleotide sequence of primer TRV2-miR168-1-R is shown in SEQ ID NO.9.

[0046] (2) The pTRV2 empty vector plasmid was digested with restriction endonucleases EcoR I and Xho I (NEB) to obtain a linearized vector. The miR168-1 target gene fragment obtained in step (1) was ligated into the vector pTRV2 by homologous recombination to obtain the recombinant plasmid pTRV2-miR168-1.

[0047] The PCR amplification system and procedure for P515 are the same as above.

[0048] The double enzyme digestion reaction system and the homologous recombination reaction system are the same as above.

[0049] (3) The recombinant plasmid pTRV2-miR168-1 obtained in step (2) was introduced into Agrobacterium tumefaciens GV3101 to obtain miR168-1 overexpressing recombinant Agrobacterium.

[0050] SEQ ID NO. 8: GAAAGAAAGATAACCAAAAAAAAACAAT.

[0051] SEQ ID NO.9: GGGCGTGATTGGAGGAAG.

[0052] 2. Construction of the recombinant plasmid pTRV2-STTM168-1 silencing vector The VIGS vector, constructed based on the short tandem target mimic (STTM) sequence, can silence miRNAs and enable the study of the mechanisms by which miRNAs function in plant growth, development, and stress responses.

[0053] (1) Based on the mature sequence of miR168-1 (SEQ ID NO.2) and its complementary sequence on the stem-loop, design a sequence of STTM168-1 (SEQ ID NO.14) (e.g. Figure 3 As shown in the figure, the middle section is a fixed 48nt sequence, and the two sides have base sequences that are not completely complementary to miR168-1, which can bind miRNA without being cleaved by RISC.

[0054] (2) The STTM168-1 sequence was synthesized by Xinjiang Youkang Biotechnology Co., Ltd. The STTM sequence obtained by homologous recombination ligation and amplification, and the vector pTRV2 after enzyme digestion (EcoR I, Xho I, NEB), were used to obtain the recombinant plasmid pTRV2-STTM168-1, involving primers: STTM168-1-F (SEQ ID NO.10) and STTM168-1-R (SEQ ID NO.11). The PCR amplification system and procedure for P515 are the same as above.

[0055] The double enzyme digestion reaction system and the homologous recombination reaction system are the same as above.

[0056] (3) The recombinant plasmid pTRV2-STTM168-1 was introduced into Agrobacterium tumefaciens GV3101 to obtain miR168-1 silent recombinant Agrobacterium.

[0057] SEQ ID NO. 2: AUUCAGUUGAUGCAAGGCGGGAUC.

[0058] SEQ ID NO. 10: GATCCCGCCTTGCACTATCAACTGAATGTT.

[0059] SEQ ID NO. 11: ATTCAGTTGATAGTGCAAGGCGGGATCATT.

[0060] SEQ ID NO.14: GATCCCGCCTTGCActaTCAACTGAATGTTGTTGTTGTTATGGTCTAATTTAAATATGGTCTAAAGAAGAAGAATGATCCCGCCTTGCActaTCAACTGAAT.

[0061] 3. Construction of the recombinant plasmid pTRV2-GhNAC087 silencing vector (1) Primers (TRV2-NAC087-F and TRV2-NAC087-R) were designed based on the GhNAC087 gene sequence (SEQ ID NO.3). Cotton cDNA was used as a PCR template. The GhNAC087 gene sequence was amplified using a high-fidelity enzyme P515 (2×Phanta Max Master Mix, P515-01, Vazyme) PCR amplification system to obtain the GhNAC087 target gene fragment. The nucleotide sequence of primer TRV2-NAC087-F is shown in SEQ ID NO.12, and the nucleotide sequence of primer TRV2-NAC087-R is shown in SEQ ID NO.13.

[0062] (2) The GhNAC087 sequence obtained by homologous recombination ligation and the vector pTRV2 after enzyme digestion (EcoR I, Xho I, NEB) were used to obtain the recombinant plasmid pTRV2-GhNAC087.

[0063] The PCR amplification system for P515 is the same as above.

[0064] The amplification program was as follows: 95℃ for 3 min, 95℃ for 15 s, 56℃ for 15 s, 72℃ for 66 s, 72℃ for 5 min, for a total of 35 cycles from denaturation to extension. After amplification, the fragments were separated by 1.0% agarose gel electrophoresis, and the target fragment was identified by gel imaging. The target fragment was recovered using a gel recovery kit, and after concentration determination, it was stored at -20℃ for later use.

[0065] The double enzyme digestion reaction system and the homologous recombination reaction system are the same as above.

[0066] (3) The recombinant plasmid pTRV2-GhNAC087 was introduced into Agrobacterium tumefaciens GV3101 to obtain GhNAC087 silent recombinant Agrobacterium.

[0067] SEQ ID NO. 12: GATAAGAATAATACAGGGACCAAGAAAG.

[0068] SEQ ID NO. 13: GGCTTGATGGAAGACGATG.

[0069] Obtaining transformation materials: Using TRV:00 Agrobacterium as a negative control, cotton was infected with VIGS by Agrobacterium miR168-1 overexpressing recombinant, Agrobacterium miR168-1 silent, and Agrobacterium GhNAC087 silent recombinant. Upland cotton TM-1 was used as the VIGS injection material. After soaking, TM-1 seeds were transferred to small black pots filled with nutrient soil and placed in a greenhouse for cultivation. The greenhouse conditions were 28℃ during the day and 25℃ at night, with a light cycle of 16h / 8h darkness. After the seedlings had two cotyledons fully expanded, VIGS injection was performed. The back of the cotyledons was incised with a syringe, and the bacterial solution was injected to completely fill the cotyledons. After injection, the cotton was placed in darkness for 24h, after which the plants were transferred to normal conditions for cultivation. The expression of miR168-1 and GhNAC087 in TRV:00, TRV:miR168-1, TRV:STTM168-1, and TRV:GhNAC087 was detected by RT-qPCR. The gene expression analysis results of the transformed materials are as follows: Figure 4 As shown, the control is TRV:00; TRV:STTM168-1 is the silenced line; TRV:miR168-1 is the overexpression line; and TRV:GhNAC087 is the silenced line.

[0070] Depend on Figure 4 It can be seen that the expression level of miR168-1 gene in TRV:miR168-1 plants is significantly increased and higher than that in TRV:00, indicating that miR168-1 overexpression was successful and led to a decrease in the expression level of the target gene. The expression level of miR168-1 in TRV:STTM168-1 plants is significantly decreased and lower than that in TRV:00, indicating that miR168-1 gene silencing was successful and affected the expression of the target gene GhNAC087, further verifying the negative regulatory relationship of miR168-1 on GhNAC087. In addition, in the TRV:GhNAC087 line, the expression of GhNAC087 was effectively silenced.

[0071] Phenotypic analysis of miR168-1 and GhNAC087 conversion materials yielded the following results: Figure 5 As shown.

[0072] Depend on Figure 5It was found that before cold stress treatment, the growth of TRV:00, TRV:STTM168-1, TRV:miR168-1, and TRV:GhNAC087 was consistent. After 12 hours of low-temperature stress treatment, compared with the control group, plants with overexpression of miR168-1 and silenced GhNAC087 suffered more severe damage: leaves withered and stems softened, indicating that overexpression of the miR168-1 gene reduced the plant's cold tolerance, while TRV:STTM168-1 plants showed good cold tolerance. These results suggest that miR168-1 negatively regulates plant tolerance to low-temperature stress by negatively regulating the expression of GhNAC087.

[0073] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of miR168-1 in regulating cotton's cold stress tolerance, characterized in that, The precursor sequence of miR168-1 is shown in SEQ ID NO.1, and the mature sequence is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The target gene of miR168-1 is GhNAC087, and the nucleotide sequence of GhNAC087 is shown in SEQ ID NO.

3.

3. The application according to claim 1, characterized in that, Improving cotton's cold stress tolerance by silencing miR168-1.

4. The application of the GhNAC087 gene in improving cotton's tolerance to cold stress, characterized in that... The nucleotide sequence of the GhNAC087 gene is shown in SEQ ID NO.

3. Overexpression of the GhNAC087 gene improves the cold stress tolerance of cotton.

5. The application of the miR168-1 gene as described in claim 1 or the GhNAC087 gene as described in claim 4 in the breeding of cold-resistant cotton varieties.

6. The use of the miR168-1 gene as described in claim 1 or the GhNAC087 gene as described in claim 4 in the preparation of biological agents to improve the cold stress tolerance of cotton.

7. A recombinant vector, characterized in that, The recombinant vector contains the STTM168-1 sequence that targets and silences miR168-1, and the nucleotide sequence of the STTM168-1 is shown in SEQ ID NO.

14.

8. A recombinant bacterial strain, characterized in that, The recombinant strain comprises the recombinant vector of claim 7.

9. The application of the recombinant vector as described in claim 7 or the recombinant strain as described in claim 8 in improving the cold stress tolerance of cotton.

10. A method for improving the cold stress tolerance of cotton, characterized in that, Includes the following steps: A recombinant vector targeting and silencing miR168-1 was constructed and used to transform cotton using Agrobacterium tumefaciens-mediated transformation to obtain cotton with improved cold stress tolerance. The precursor sequence of miR168-1 is shown in SEQ ID NO.1, and the mature sequence is shown in SEQ ID NO.

2. The recombinant vector contains the STTM168-1 sequence, and the nucleotide sequence of STTM168-1 is shown in SEQ ID NO.14.

Images