A precise editing method for sugarcane

Abstract

The application discloses a precise editing method for sugarcane, and belongs to the field of genetic engineering. Specifically, the application relates to a method for precisely replacing cytosine bases in the genome of sugarcane. The gene editing method for sugarcane provided by the application can realize efficient and precise editing of the genome of sugarcane. Compared with the current gene editing method for sugarcane, the editing copy ratio of the obtained mutant is significantly improved, and the proportion of editing by-products is significantly reduced.

Description

[0001] Priority and related applications

[0002] This invention claims priority to Chinese Patent Application No. 202511037785.4, filed on July 25, 2025, entitled “A Method for Precise Editing of Sugarcane”, the entire contents of which, including its appendices, are incorporated herein by reference. Technical Field

[0003] This invention belongs to the field of genetic engineering and relates to a method for precise editing of sugarcane. Specifically, this invention relates to a method for precisely replacing cytosine bases in the sugarcane genome. This invention utilizes three cytosine base editors—A3A-PBE, minisdd7-PBE, and QBEmax—to precisely replace C to T bases in the sugarcane genome. Furthermore, it was found that treating sugarcane callus bombarded with a gene gun for 72 hours at 37 degrees Celsius for 48 hours significantly improves the efficiency of precise editing and reduces the proportion of byproducts. Under 37-degree Celsius treatment, the Guitang 42 sugarcane mutant with a precise mutation in the SoALS gene was successfully created using A3A-PBE and minisdd7-PBE. Background Technology

[0004] Sugarcane is the world's most important sugar crop, contributing approximately 80% of sugar and 40% of ethanol, generating over US$90 billion in revenue annually (FAO). However, sugarcane production currently faces multiple challenges, including climate change and varietal degradation. As a perennial, aneuploid, and asexually propagated crop with a highly complex genome, traditional sugarcane breeding suffers from significant bottlenecks such as a narrow genetic base and a long breeding cycle. CRISPR / Cas genome editing technology has revolutionized crop breeding, successfully enhancing agronomic traits such as yield, quality, and resistance in various crops. [1] Currently, gene editing technology has undergone four iterations. The first-generation CRISPR / Cas9 nuclease creates DNA double-strand breaks in the genome, achieving knockout. The second-generation base editing technology fuses nCas9 (D10A) with a deaminase to achieve precise single-base replacement. The third-generation guided editing technology fuses nCas9 (H840A) with reverse transcriptase to achieve precise arbitrary replacement of small fragments. The fourth-generation large fragment manipulation technology can achieve multiple functions such as insertion, deletion, replacement, inversion, translocation, and replication of large fragments. [2, 9] .

[0005] However, sugarcane is a typical polyploid crop with an extremely complex genome structure and difficult-to-determine gene copy number, which brings many technical bottlenecks to gene editing, such as low editing efficiency and inability to determine genotype. Sugarcane gene editing technology has a slow start and low efficiency, and so far only nuclease-mediated first-generation gene knockout has been successfully achieved. In 2021, Fredy Altpeter's team pioneered the use of CRISPR / Cas9 technology, delivered via gene gun bombardment, to knock out the magnesium chelate gene (MgCh), which is related to chlorophyll synthesis. [3] The study employed both first-generation and second-generation sequencing for mutant detection, achieving a maximum single-target mutation rate of 67.9% in sugarcane, which produced a yellowing phenotype. In the same year, the team used CRISPR / Cas9-induced homologous recombination to substitute the W574L and S653I amino acids in the sugarcane ALS gene, but only achieved a maximum target mutation rate of 6.6%. [4] Subsequently, in 2024, the team further conducted CRISPR / Cas9 gene knockout experiments targeting the LG1 gene (LIGULELESS1), which regulates leaf angle, successfully obtaining a complete sugarcane mutant with 99.9% copy number editing, but its single sgRNA editing efficiency was only 14.8%. [5] In one edited line, leaf tilt angle decreased by 56%, tiller number increased by 31%, and plant dry matter biomass increased by 18%. In 2024, a team from China designed two gRNAs targeting the MTL gene and used Agrobacterium-mediated transformation to perform CRISPR / Cas9 gene knockout. Forty-nine transgenic plants were obtained, of which only one was a gene-edited mutant. The target gene was amplified and ligated into single clones, followed by Sanger sequencing. Of the 30 single clones, 6 were edited, 4 from gRNA1 and 2 from gRNA2. [6] In the same year, a team from Thailand used Agrobacterium delivery to knock out the LIM gene in sugarcane, finding that the mutants had reduced lignin content by 9.74–51.46%, but the specific copy number edited and the agronomic phenotype of these mutants were unclear. [7] Furthermore, Fredy Altpeter's team also experimented with a dCas9-mediated transcriptional repression system in sugarcane. By fusing dCas9 with three copies of the SRDX repressor domain, they achieved gene repression of the MgCh gene. [8] .

[0006] Currently, precise gene editing technology for sugarcane is lacking, and simple gene knockout cannot meet the personalized needs of improving various traits in sugarcane. Therefore, it is necessary to establish efficient base editing technology in sugarcane.

[0007] References:

[0008] [1] Gao, C. (2021). Genome engineering for crop improvement andfuture agriculture. Cell 184, 1621-1635.

[0009] [2] Li, B., Sun, C., Li, J., and Gao, C. (2024). Targeted genome-modification tools and their advanced applications in crop breeding. NatureReviews Genetics 25, 603-622.

[0010] [3] Eid, A., Mohan, C., Sanchez, S., Wang, D., and Altpeter, F.(2021). Multiallelic, Targeted Mutagenesis of Magnesium Chelatase WithCRISPR / Cas9 Provides a Rapidly Scorable Phenotype in Highly PolyploidSugarcane. Frontiers in Genome Editing 3.

[0011] [4] Oz, M.T., Altpeter, A., Karan, R., Merotto, A., and Altpeter, F.(2021). CRISPR / Cas9-Mediated Multi-Allelic Gene Targeting in SugarcaneConfers Herbicide Tolerance. Frontiers in Genome Editing 3.

[0012] [5] Brant, E.J., Eid, A., Kannan, B., Baloglu, M.C., and Altpeter, F.(2024). The extent of multiallelic, co‐editing of LIGULELESS1 in highlypolyploid sugarcane tunes leaf inclination angle and enables selection of theideotype for biomass yield. Plant Biotechnology Journal 22, 2660-2671.

[0013] [6] Guo, Y., Sun, S., Chen, S., Zhang, Y., Wang, W., Deng, Z., Liu,Z., Yu, Z., Xu, H., Guo, J., Zhang, S., Zhong, Y., Zhang, W., Chen, J., Zhou,F., Chang, H., Gao, S.-J., and Wang, Q. (2024). In vivo induction ofsugarcane (Saccharum spp.) haploids by genome editing. Plant Physiology 196,731-734.

[0014] [7] Laksana, C., Sophiphun, O., and Chanprame, S. (2024). Ligninreduction in sugarcane by performing CRISPR / Cas9 site-direct mutation ofSoLIM transcription factor. Plant Science 340.

[0015] [8] Hooghvorst, I., and Altpeter, F. (2023). dCas9-3xSRDX-mediatedtranscriptional repression in sugarcane. Plant Cell Reports 42, 1837-1840.

[0016] [9] Zhang, R., He, Z., Shi, Y., Sun, Amplificationediting enables efficient and precise duplication of DNA from short sequence to megabase and chromosomal scale. Cell 187, 3936-3952.e3919. Summary of the Invention

[0017] The problem the invention aims to solve

[0018] To address the current challenge of precisely editing sugarcane, this invention provides an efficient and precise sugarcane gene editing technology.

[0019] Solution for solving the problem

[0020] [1]. A method for precise gene editing of sugarcane, wherein the method comprises introducing (a) a base editor and (b) an expression construct containing a nucleotide sequence encoding a guide RNA (sgRNA) targeting a target site into a plant cell, and culturing the plant cell at 25°C to 37°C, thereby resulting in the editing of the genome sequence of at least one of the plant cells;

[0021] Preferably, the plant cells are cultured at 30-37°C, thereby resulting in the editing of the genome sequence of at least one of the plant cells;

[0022] The method can replace bases in the sugarcane genome and reduce the proportion of byproducts.

[0023] [2]. According to the method of [1], wherein the base editor comprises (i) a polynucleotide programmable DNA binding domain and (ii) a base-specific deaminase;

[0024] Preferably, the base-specific deaminase includes cytosine deaminase.

[0025] [3]. According to the method of [2], wherein the cytosine deaminase is selected from APOBEC3A, minisdd7 and minisdd9, or a cytosine deaminase having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of the same amino acid sequence as the aforementioned proteins.

[0026] [4]. The method according to [2] or [3], wherein the method can achieve the substitution of C to T in the sugarcane genome and reduce the proportion of by-products.

[0027] [5]. The method according to any one of [2] to [4], wherein the polynucleotide programmable DNA binding domain comprises Cas9 nickase or a variant thereof.

[0028] [6]. The method according to [5], wherein the Cas9 nickase variant comprises nCas9(D10A).

[0029] [7]. The method according to any one of [1] to [6], wherein the base editor further comprises a uracil glycosylation inhibitor (UGI) domain.

[0030] [8]. The method according to any one of [1] to [7], wherein the base editor further comprises a nuclear localization signal (NLS) and / or an XTEN spacer peptide.

[0031] [9]. The method according to any one of [1] to [8], wherein the base editor comprises A3A-PBE, minisdd7-PBE and / or QBEmax.

[0032]

[10] . The method according to any one of [1] to [9], wherein the guide RNA comprises a backbone sequence as shown in SEQ ID NO:1.

[0033]

[11] . The method according to any one of [1] to

[10] , wherein the plant cells comprise sugarcane protoplasts and / or callus tissue.

[0034] The effects of the invention

[0035] The gene editing method for sugarcane provided by this invention can achieve efficient and precise editing of the sugarcane genome, especially the precise replacement of cytosine bases.

[0036] Compared to current gene editing methods used in sugarcane, the method provided in this invention significantly increases the proportion of edited copies and significantly reduces the proportion of editing byproducts. Attached Figure Description

[0037] Figure 1 Schematic diagram of three different cytosine base editor vectors.

[0038] Figure 2 Editing efficiency of three different cytosine base editors on eight sugarcane endogenous targets.

[0039] Figure 3 : Editing windows for three different cytosine base editors.

[0040] Figure 4 Efficiency analysis of sugarcane cytosine base editor in protoplasts under culture conditions at 25°C and 37°C.

[0041] Figure 5 Analysis of cytosine base editing mutants in sugarcane cultured at 25°C and 37°C.

[0042] Figure 6 Three typical sugarcane plants with deleted mutant genotypes were cultured at 25 degrees Celsius.

[0043] Figure 7 : Create an amino acid substitution mutant of the SoALS protein using cytosine base editing. Detailed Implementation

[0044] Various exemplary embodiments, features, and aspects of the present invention will be described in detail below. The term "exemplary" as used herein means "serving as an example, embodiment, or illustration." Any embodiment described herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0045] Furthermore, to better illustrate the present invention, numerous specific details are set forth in the following detailed embodiments. Those skilled in the art should understand that the present invention can be practiced without certain specific details. In other instances, methods, means, apparatus, and steps well known to those skilled in the art have not been described in detail in order to highlight the spirit of the present invention.

[0046] Unless otherwise stated, all units used in this specification are international standard units, and all numerical values ​​and ranges appearing in this invention should be understood to include systematic errors that are unavoidable in industrial production.

[0047] In this specification, the word "may" has two meanings: to perform a certain process and not to perform a certain process.

[0048] In this specification, references to "some specific / preferred embodiments," "other specific / preferred embodiments," "implementation," etc., refer to specific elements (e.g., features, structures, properties, and / or characteristics) related to that embodiment, which are included in at least one of the embodiments described herein and may or may not be present in other embodiments. Furthermore, it should be understood that these elements may be combined in any suitable manner in various embodiments.

[0049] In this specification, "optional" and "optionally" mean that the events or circumstances described below may or may not occur, and the description includes both cases where the events or circumstances occur and cases where the events or circumstances do not occur.

[0050] In this specification, the range of values ​​referred to as "value A to value B" refers to the range including the endpoint values ​​A and B.

[0051] As used herein, the term “and / or” covers all combinations of items connected by the term and should be regarded as if each combination had been listed separately herein. For example, “A and / or B” covers “A,” “A and B,” and “B.” For example, “A, B, and / or C” covers “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.”

[0052] When the term "comprising" is used herein to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist of the stated sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still possessing the activities described in this invention. Furthermore, those skilled in the art will understand that the methionine encoded by the start codon at the N-terminus of a polypeptide may be retained in certain practical situations (e.g., when expressed in a specific expression system) without substantially affecting the polypeptide's function. Therefore, when describing a specific polypeptide amino acid sequence in this specification and claims, although it may not contain the methionine encoded by the start codon at the N-terminus, the sequence containing that methionine is still included, and correspondingly, its encoding nucleotide sequence may also contain the start codon; and vice versa.

[0053] In this invention, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. For example, the standard recombinant DNA and molecular cloning techniques used in this invention are well known to those skilled in the art and are described more fully in the following reference: Sambrook, Joseph Frank et al. “Molecular Cloning: A Laboratory Manual.” (2001). Meanwhile, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0054] In this invention, the term "genome" (when applied to plant cells) encompasses not only chromosomal DNA found in the cell nucleus, but also organelle DNA found in subcellular components (e.g., mitochondria, plastids).

[0055] In this invention, the terms "polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: "A" for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), "C" for cytidine or deoxycytidine, "G" for guanosine or deoxyguanosine, "U" for uridine, and "T" for deoxythymidine.

[0056] In this invention, the terms "polypeptide," "peptide," and "protein" are used interchangeably to refer to polymers of amino acid residues. This term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers.

[0057] In this invention, the terms "deaminase," "deaminase domain," and "base-specific deaminase" are used interchangeably, as used herein, to refer to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase or deaminase domain is a cytosine deaminase that catalyzes the hydrolytic deamination of cytidine to uridine or deoxycytidine to deoxyuridine. In some embodiments, the deaminase or deaminase domain is a cytosine deaminase that catalyzes the hydrolytic deamination of cytosine to uracil, ultimately converting to thymine (T) during cellular modification and DNA replication. In some embodiments, the deaminase is a naturally occurring deaminase derived from an organism, such as a microorganism, plant, or animal, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, or mouse. In some embodiments, the deaminase is a variant of a naturally occurring deaminase derived from an organism that does not exist in nature. For example, in some embodiments, the deaminase is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a naturally occurring deaminase from an organism.

[0058] In this invention, "guide RNA" or "gRNA" means a polynucleotide that is specific to a target sequence and can form a complex with a polynucleotide-programmable nucleotide-binding domain protein (e.g., Cas9 or Cpf1). In one embodiment, the guide polynucleotide is guide RNA (gRNA). gRNA can exist as a complex of two or more RNAs or as a single RNA molecule. gRNA existing as a single RNA molecule may be referred to as single-guide RNA (sgRNA), although "gRNA" is used interchangeably to refer to guide RNA existing as a single molecule or as a complex of two or more molecules. Typically, gRNA existing as a single RNA species includes two domains: (1) a domain that shares homology with the target nucleic acid (e.g., and guides the Cas9 complex to bind to the target); and (2) a domain that binds to the Cas9 protein. In some embodiments, domain (2) corresponds to a sequence called tracrRNA and includes a stem-loop structure. For example, in some implementations, the domain (2) is the same as or homologous to the tracrRNA provided in Jinek et al., Science 337:816-821 (2012) (the entire contents of which are incorporated herein by reference).

[0059] In this invention, an "expression construct" refers to an artificially designed DNA fragment that can be used to introduce genetic material into target cells (e.g., using a recombinant expression structure to produce a base editor or a component thereof). The term "expression" refers to the transcription and translation of a nucleic acid coding sequence to produce a coding polypeptide.

[0060] In this invention, "UGI" refers to a protein capable of inhibiting uracil-DNA glycosylase base excision repair enzyme. In some embodiments, the UGI domain includes wild-type UGI or a fragment of wild-type UGI. In some embodiments, the UGI protein provided herein comprises a fragment of UGI and a protein homologous to UGI or a UGI fragment.

[0061] In this invention, the terms "linker," "spacer peptide," and "linker" are used interchangeably and, as used herein, can refer to a covalent linker (e.g., a covalent bond), a non-covalent linker, a chemical group, or a molecule that links two molecules or portions thereof, such as two components of a protein complex or ribonucleoprotein complex, or two domains of a fusion protein, such as, for example, a polynucleotide-programmable DNA-binding domain (e.g., dCas9) and one or more deaminase domains (e.g., cytosine deaminase). Linkers can connect different components or different portions of a base editor system. For example, in some embodiments, a linker can connect a guide polynucleotide-binding domain of a polynucleotide-programmable nucleotide-binding domain to a catalytic domain of a deaminase. In some embodiments, a linker can connect a CRISPR peptide and a deaminase. In some embodiments, a linker can connect Cas9 and a deaminase. In some embodiments, a linker can connect nCas9 and a deaminase. In some embodiments, a linker can connect a guide polynucleotide and a deaminase. In some embodiments, the linker can connect the deamination component of the base editor system and the polynucleotide programmable nucleotide-binding component. The linker can be located between or on either side of two groups, molecules, or other parts, and is linked to each of them via covalent bonds or non-covalent interactions, thereby linking the two together. In some embodiments, the linker is a spacer peptide of 5-100 amino acids in length, such as 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids. Longer or shorter spacer peptides were also considered.

[0062] In some embodiments, the linker may be one amino acid or a plurality of amino acids (e.g., a peptide or protein). In some embodiments, the linker may be about 5-100 amino acids in length, for example, about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30-35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. In some embodiments, the linker may be about 10-15, 15-20, 20-25, 25-30, or 30-35 amino acids in length. Longer or shorter connectors can also be expected.

[0063] The term "mutation," as used herein, refers to the substitution of one residue in a sequence (e.g., a nucleic acid or amino acid sequence) by another residue, or the deletion or insertion of one or more residues in a sequence. In this document, mutations are typically described by first identifying the original residue, then its location within the sequence, and finally the identity of the newly substituted residue. Various methods for producing the amino acid substitutions (mutations) described herein are well known in the art, for example, as provided by Green and Sambrook, *Molecular Cloning: A Laboratory Manual* (4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)). In some embodiments, the base editors disclosed herein are capable of efficiently generating "intended mutations" (such as point mutations) within nucleic acids (e.g., nucleic acids within a subject's genome) without generating a significant number of unintended mutations (such as unintended point mutations). In some embodiments, the intended mutation is generated by a specific base editor that binds to a guide polynucleotide (e.g., gRNA) specifically designed to produce the intended mutation.

[0064] In this invention, the terms "nuclear localization sequence," "nuclear localization signal," or "NLS" refer to the amino acid sequence that facilitates the delivery of proteins into the cell nucleus.

[0065] In this invention, "editing byproducts" refers to unintended base changes, non-target editing, base conversion byproducts, large fragment deletions, or rearrangements caused by enzyme activity or repair mechanisms during base editing or lead editing. In some embodiments of this invention, editing byproducts mostly refer to byproducts obtained due to base conversions, such as non-target conversions like C→G or C→A that may occur during C→T conversions.

[0066] In this invention, "deletion of byproducts" refers to the process in which the base editor directly converts a specific base (C→T) through deaminase during gene editing. However, the deamination action of the deaminase will trigger the cell's base excision repair (BER) pathway. If the repair process goes wrong, it may lead to the deletion of small fragments (such as 1~10bp).

[0067] In this invention, AC1 refers to the first cytosine (C) in the target DNA sequence being edited to adenine (A); AC2 refers to the second cytosine (C) in the target sequence being edited to adenine (A). CC8 refers to the eighth cytosine (C) in the target sequence being edited to cytosine (C). Similarly, TC8, AC13, GC11, TC16, GC16, CC18, CC19, etc. in this invention can all be understood as described above.

[0068] The technical solution of the present invention will be described in detail below:

[0069] This invention relates to a precise editing method for sugarcane. Specifically, cytosine deaminase is fused with nCas9 (D10A) and tandemly linked with a uracil-DNA glycosylase inhibitor (UGI). This invention tested three cytosine base editors: A3A-PBE, minisdd7-PBE, and QBEmax, all of which can induce highly efficient C-to-T precise mutations in sugarcane. The vector conformations of the three cytosine base editors are as follows... Figure 1 As shown. Furthermore, high-temperature treatment at 37 degrees Celsius on the sugarcane callus delivering the editing vector can improve base editing efficiency and reduce byproducts. Using this method, the SoALS gene was edited, creating sugarcane with potential herbicide resistance.

[0070] In one aspect of the invention, a method for precise gene editing in sugarcane is provided, wherein the method comprises introducing (a) a base editor and (b) an expression construct containing a nucleotide sequence encoding a guide RNA (sgRNA) targeting a target site into plant cells to obtain transformed plant cells. Further, the plant cells are cultured at 25°C–37°C, 30°C–37°C, for example, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C, thereby resulting in the editing of the genome sequence of at least one of the plant cells.

[0071] In some exemplary embodiments, the above (a) and (b) are introduced into plant cells by gene gun (particle bombardment) method. The entire introduction process is carried out at 23-25 ​​degrees Celsius. After the introduction process is completed, the transformed plant cells are cultured at 23-25 ​​degrees Celsius for no less than 48h, 50h, 52h, 54h, 56h, 60h, 62h, 64h, 66h, 68h, 70h, and 72h. After the culture is completed, the plant cells are cultured at 25℃-37℃.

[0072] In some specific implementation plans, the plant cells are cultured at 25℃~37℃ for no less than 36h, no less than 40h, no less than 42h, no less than 44h, no less than 46h, and no less than 48h.

[0073] In some implementations, the above method can be used to replace bases in the sugarcane genome and reduce the proportion of byproducts, including editing byproducts and deletion byproducts.

[0074] In some embodiments, the base editor comprises (i) a polynucleotide-programmable DNA-binding domain and (ii) a base-specific deaminase;

[0075] In some preferred embodiments, the base-specific deaminase includes cytosine deaminase.

[0076] In some embodiments, the cytosine deaminase contained in the base editor is selected from APOBEC3A, minisdd7, and minisdd9, or a cytosine deaminase having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the same amino acid sequence as the aforementioned proteins. Furthermore, the above method can achieve C-to-T substitution in the sugarcane genome and reduce the proportion of byproducts.

[0077] In some embodiments, the polynucleotide-programmable DNA-binding domain is Cas9. In some embodiments, the polynucleotide-programmable DNA-binding domain is Staphylococcus aureus Cas9 (SaCas9), Streptococcus pyogenes Cas9 (SpCas9), or a variant thereof. In some embodiments, the polynucleotide-programmable DNA-binding domain includes nuclease-inactivated Cas9 (dCas9), Cas9 cleavage enzyme (nCas9), or nuclease-active Cas9. In some embodiments, the polynucleotide-programmable DNA-binding domain includes a catalytic domain of an inverse complementary strand capable of cleaving a nucleic acid sequence. In some embodiments, the polynucleotide-programmable DNA-binding domain does not include a catalytic domain capable of cleaving a nucleic acid sequence. In some embodiments, the Cas9 is dCas9. In some embodiments, the Cas9 is Cas9 cleavage enzyme (nCas9). In some embodiments, the nCas9 includes the amino acid substitution D10A or a corresponding amino acid substitution, such as nCas9(10A).

[0078] In some embodiments, the base editor of any of the above aspects further includes one or more uracil DNA glycosylation inhibitor (UGI) domains. In some embodiments, the one or more UGIs are derived from Bacillus subtilis phage PBS1 and inhibit human UDG activity. In some embodiments, the cytosine base editor includes two uracil DNA glycosylation inhibitors (UGIs). In some embodiments, the cytosine base editor of any of the above aspects further includes one or more linkers.

[0079] In some embodiments, the base editor of any of the above aspects further includes one or more nuclear localization signals (NLS). In some embodiments, the base editor includes an N-terminal NLS, a C-terminal NLS, an N-terminal NLS of the UGI domain, and a C-terminal NLS of the UGI domain.

[0080] In some implementations, the base editor of any of the above aspects further includes one or more XTEN spacer peptides.

[0081] In some implementations, the components described above, such as the polynucleotide programmable DNA binding domain, specific deaminase, uracil glycosylation inhibitor (UGI) domain, nuclear localization signal (NLS), and XTEN spacer peptide, can be expressed in individual constructs or fused into one or more constructs using appropriate linkers.

[0082] In some exemplary embodiments, the base editor is A3A, minisdd7, and QBEmax.

[0083] In some exemplary embodiments, for the base editor A3A-PBE, the bases are arranged in a linear order starting from the amino terminus of the protein and include: cytosine deaminase APOBEC3A, XTEN spacer peptide, nCas9(10A), nuclear localization signal (NLS), uracil glycosylation inhibitor (UGI) domain, and nuclear localization signal (NLS).

[0084] In some exemplary embodiments, for the base editor minisdd7-PBE, the bases are arranged in a linear order starting from the amino terminus of the protein and include: nuclear localization signal (NLS), cytosine deaminase minisdd7, XTEN spacer peptide, nCas9(10A), nuclear localization signal (NLS), uracil glycosylase inhibitor (UGI) domain, and nuclear localization signal (NLS).

[0085] In some exemplary embodiments, for the base editor QBEmax, the following components are arranged in a linear order starting from the amino terminus of the protein: nuclear localization signal (NLS), amino acid sequence of nCas9(10A) from position 1031 to 1244, linker (32 amino acids), cytosine deaminase minisdd9, linker (32 amino acids), amino acid sequence of nCas9(10A) from position 1245 to 1368, linker (20 amino acids), amino acid sequence of nCas9(10A) from position 1 to 1030, linker (10 amino acids), uracil glycosylase inhibitor (UGI) domain, linker (10 amino acids), uracil glycosylase inhibitor (UGI) domain, and nuclear localization signal (NLS).

[0086] The guide RNA (sgRNA) described in this invention refers to an sgRNA compatible with a CRISPR nuclease having target strand cleavage activity (i.e., Cas9 nickase or its variants, such as nCas9(D10A)). The sgRNA typically comprises a scaffold sequence and a guide sequence (also called a seed sequence or spacer sequence). The guide sequence is configured to have sufficient sequence identity (preferably 100%) with the target sequence, thereby enabling sequence-specific targeting by binding to the complementary strand of the target sequence through base pairing. The scaffold sequence typically depends on the CRISPR nuclease used. In some alternative embodiments of this invention, the sgRNA may also target a non-target strand (i.e., the non-edited strand), referred to herein as nicking sgRNA. Nicking sgRNA is a specially designed single-guide RNA used to guide the Cas9 protein in the CRISPR-Cas9 system to generate a single strand break (SSB) on the target DNA strand, rather than a double strand break (DSB). Specifically, the nicking sgRNA targets a position in the non-target strand approximately 50 base pairs from the PAM sequence.

[0087] In some exemplary embodiments, the backbone sequence of the corresponding sgRNA for the Cas9 nickase or a variant thereof of the present invention comprises the sequence shown in SEQ ID NO:1:

[0088] GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0089] In some embodiments, the plant cells can be any cells of sugarcane, especially cells with differentiation potential, such as protoplasts, callus, etc.

[0090] Example

[0091] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0092] Materials and Methods

[0093] 1. A3A-PBE, minisdd7-PBE, and QBEmax only display the open reading frame area.

[0094] A3A-PBE (SEQ ID NO:2, the single underlined portion is the nucleotide sequence encoding NLS, the bold portion is the nucleotide sequence encoding Linker, the italicized portion is the nucleotide sequence encoding APOBEC3A, the double underlined portion is the nucleotide sequence encoding UGI, and the unlabeled portions are the start codon and the nucleotide sequence encoding nCas9(D10A), respectively):

[0095] minisdd7-PBE (SEQ ID NO:3, the single underlined portion is the nucleotide sequence encoding NLS, the bold portion is the nucleotide sequence encoding Linker, the italicized portion is the nucleotide sequence encoding minisdd7, the double underlined portion is the nucleotide sequence encoding UGI, and the unlabeled portions are the start codon and the nucleotide sequence encoding nCas9(D10A), respectively):

[0096] QBEmax: (SEQ ID NO:4, the single underlined portion is the nucleotide sequence encoding NLS, the bold portion is the nucleotide sequence encoding Linker, the italicized portion is the minisdd9 sequence, the double underlined portion is the nucleotide sequence encoding UGI, and the unlabeled portions are the start codon, the nucleotide sequence encoding amino acids 1031-1244 of nCas9(D10A), the nucleotide sequence encoding amino acids 1245-1368 of nCas9(D10A), and the nucleotide sequence encoding amino acids 1-1030 of nCas9(D10A), respectively).

[0097] 2. Target and target sequence

[0098]

[0099] 3. Extraction of sugarcane protoplasts

[0100] (1) Select sugarcane seedlings with 6-8 leaves, pull them out, peel off the shell from the base of the tender stem, and about 50 reactions can be made from one seedling.

[0101] (2) Cut into slices with a single-sided safety blade from a Flying Eagle brand. The finer the slices, the higher the separation efficiency.

[0102] (3) Immediately after cutting, transfer to 0.6 M Mannitol solution and place in the dark for 10 minutes.

[0103] (4) Filter the Mannitol solution, transfer the sugarcane slices to the prepared enzymatic hydrolysate, protect from light, and vacuum for 30 minutes.

[0104] (5) Continue enzymatic hydrolysis in the dark for 5-6 hours, while placing it on a horizontal shaker and shaking it slowly at 50 rpm.

[0105] (6) After the enzymatic hydrolysis is completed, filter the hydrolysate with a magic filter cloth and discard the hydrolysate.

[0106] (7) Add W5 to the remaining sugarcane slices and gently shake horizontally by hand for about 10 seconds to release the protoplasts. Filter the protoplasts into a 50mL round-bottom tube using a magic filter cloth. This step can be repeated several times to obtain more protoplasts.

[0107] (8) Centrifuge at 250 rcf, 3 up, 3 down, 5 min, horizontal centrifuge, settle protoplasts, and discard supernatant.

[0108] (9) Add an appropriate amount of W5 to resuspend the protoplasts, combine them into a round-bottomed tube, let them settle on ice for 30 minutes, and discard the supernatant.

[0109] (10) Add an appropriate amount of MMG to resuspend the protoplasts and wait for transformation.

[0110] 4. Convert the editor to protoplasts.

[0111] (1) Mix the plasmids in a 2mL round-bottom tube, 5ug of each plasmid, add 200uL of protoplasts, and gently tumble to mix.

[0112] (2) Add 200 μL of PEG, gently invert and mix, and place at room temperature in the dark for 15 min to induce transformation.

[0113] (3) Add 880 uL of W5 solution to terminate the reaction, and gently invert to mix.

[0114] (4) Centrifuge at 250 rcf, 3 up and 3 down for 5 min horizontally, settle the protoplasts and discard the supernatant.

[0115] 5. Culture of transformed protoplasts

[0116] Add 1 mL of W5 solution and incubate at room temperature or 26°C in the dark. Fluorescent protein expression will be visible after 12 h, and DNA can be extracted to detect editing efficiency after 48-72 h.

[0117] 6. Induction of sugarcane callus, transformation of sugarcane callus into callus by editor, and culture of transformed callus.

[0118] The specific implementation method is referenced in Shiwu G, Yingying Y, Liping X, et al. Particle Bombardment of the cry2A Gene Cassette Induces Stem Borer Resistance in Sugarcane[J]. International Journal of Molecular Sciences, 2018, 19(6):1692-.DOI:10.3390 / ijms19061692., which is incorporated herein by reference.

[0119] The difference lies in the following: In this invention, the 25°C treatment refers to the entire process after gunning being carried out at 25°C. The 37°C treatment refers to placing the callus tissue on the culture medium in a 37°C incubator for 48 hours after 72 hours of gunning. Subsequent steps are then carried out at 25°C.

[0120] Example 1: Evaluation of Three Highly Efficient Cytosine Base Editors in Sugarcane

[0121] To establish an efficient sugarcane cytosine base editing system, three deaminases and cytosine base editors with different vector conformations were tested: A3A-PBE, minisdd7-PBE, and QBEmax (e.g., ...). Figure 1 (As shown).

[0122] The following genes are associated with the ROC22 genome: SoHPPD (rice homolog: LOC4328425, location in the ROC22 genome: Chr4H:11428297-11426584), SoMgch (rice homolog: LOC4333259, location in the sugarcane ROC22 genome: Chr8F:14401578-14400097), SoALS (rice homolog: LOC4329450, location in the sugarcane ROC22 genome: Chr2H: 68757799-68760278), and SoACC (rice homolog: LOC4348450, location in the sugarcane ROC22 genome: Chr8E: ). Three editors were tested in sugarcane protoplasts at eight target sites of five sugarcane endogenous genes (SoHPPD G414, SoMgch T4, SoALS P174, SoALS G628, SoMgch T7, SoACC T2, SoMgch T2, and SoGFR mi396). The results showed that all three editors could induce efficient C-to-T mutations, with varying performance at different target sites or windows, but overall exhibiting comparable efficiency. Figure 2 ).

[0123] A summary analysis of the efficiency of the eight targets was conducted: The A3A-PBE had the widest editing window, ranging from 1 to 18 bits, with the most efficient editing window ranging from 2 to 15 bits; the minisdd7-PBE window was furthest from the PAM end, with its editing window ranging from 1 to 15 bits, and the most efficient editing window ranging from 3 to 8 bits; the QBEmax window was closest to the PAM end, with its editing window ranging from 1 to 16 bits, and the most efficient editing window ranging from 5 to 13 bits. Figure 3 In summary, all three cytosine base editors are highly efficient at inducing C-to-T mutations and have complementary editing windows.

[0124] Example 2: Effect of 37°C treatment on the results of cytosine base editing in sugarcane

[0125] In order to optimize the sugarcane cytosine base editing system, the incubation temperature was tested in this invention.

[0126] In this embodiment, the protoplast culture temperature was increased from 25 degrees Celsius to 37 degrees Celsius, and the performance of three cytosine base editors was analyzed. At nine sugarcane endogenous target sites, it was found that the three cytosine base editors, which had comparable editing efficiency at 25 degrees Celsius, showed significant efficiency differences after culture at 37 degrees Celsius. Figure 4Among them, A3A-PBE and minisdd7-PBE showed improved editing efficiency and a wider editing window with increased temperature, while QBEmax's efficiency decreased with increased temperature. It is worth noting that at 37 degrees Celsius, the proportion of editing byproducts also increased due to the improved editing efficiency. Figure 4 ).

[0127] The A3A-PBE expression plasmid was mixed with the SoMgch-T4 target sgRNA expression plasmid and used for gene gun-mediated genetic transformation of sugarcane. The plants were continuously cultured at 25°C, or treated at 37°C for 48 hours after transformation. Next-generation sequencing was used to identify mutants in the treated transgenic plants. Since sugarcane is polyploid, its offspring mutant types are complex. Therefore, mutants were first defined and classified. Plants with a mutation rate greater than 2% but less than 10% were defined as Mild mutants; plants with a mutation rate greater than 10% but less than 50% were defined as Moderate mutants; plants with a mutation rate greater than 50% but less than 80% were defined as Major mutants; and plants with a mutation rate greater than 80% were defined as Strong mutants.

[0128] Culture at 37 degrees Celsius is not the optimal temperature for sugarcane tissue culture, as it is unfavorable for callus redifferentiation and growth processes such as root and shoot development. Therefore, despite using the same initial callus tissue, a greater number of transgenic plants were obtained at the normal culture temperature of 25 degrees Celsius. A total of 279 transgenic plants were obtained at 25 degrees Celsius, while 135 transgenic plants were obtained at 37 degrees Celsius. Figure 5The proportion of C to T mutations in all transgenic plants was statistically analyzed. Under 37°C treatment, the mutant proportion was 42.3%, while under 25°C treatment, it was 43.7% (mutant proportion = number of sugarcane plants with a CT read ratio >2% in next-generation sequencing / total number of regenerated sugarcane plants). 37°C treatment did not significantly increase the mutant proportion. However, further analysis of the mutant proportions revealed that under 25°C treatment, most mutants had a mutation rate of less than 50%, with the Strong mutant accounting for only 4.3%. Under 37°C treatment, the Strong mutant proportion was 18.5% (mutant proportion = proportion of C to T reads at the target site in next-generation sequencing for a single plant / proportion of all reads measured at the target site for a single plant). Therefore, although 37°C treatment reduced the total number of transgenic seedlings, the number of Major and Strong mutants obtained was still greater than under 25°C cultivation. Furthermore, the C-to-T mutation efficiency of the mutants was summarized. At 25°C, the average C-to-T efficiency was 27.4% (average C-to-T efficiency = sum of the proportions of C-to-T reads generated by next-generation sequencing in individual mutant plants with a C-to-T ratio >2% / number of sugarcane mutant plants with a C-to-T ratio >2%), while at 37°C, this value was 60.3%. In conclusion, treatment at 37°C significantly increased the mutation rate per plant in the edited mutants.

[0129] Furthermore, analysis of the byproduct types of the mutant plants revealed a large number of deletion mutations under 25°C culture conditions. In some mutants, the proportion of deletion mutations (Only Del) was even greater than the proportion of C-to-T mutations (Only CT). Figure 5 and Figure 6 Surprisingly, unlike the results in protoplasts, the proportion of deletion byproducts in transgenic plants treated at 37°C was significantly reduced, from an average of 5.8% to an average of 2.8%. Analysis of individual mutant plants showed that at 25°C, only 22.3% of mutants were free of deletion byproducts; while at 37°C, 74.6% of mutants were free of deletion byproducts. In summary, 37°C treatment in transgenic plants not only improved the C-to-T mutation efficiency but also reduced the proportion of deletion byproducts.

[0130] Example 3: Creation of SoALS amino acid substitution mutants using cytosine base editing

[0131] Based on the above results, it can be seen that cytosine base editors can be used for precise amino acid substitution. Therefore, in this embodiment, precise editing of herbicide-resistant target genes is used, such as editing the acetolactate synthase gene SoALS, thereby conferring resistance to nicosulfuron in sugarcane plants. Therefore, editing was performed on the SoALS-P174 target. First, the editing efficiency of A3A-PBE and minisdd7-PBE at this target was tested in protoplasts. Both cytosine base editors showed high efficiency at this target. Figure 7 The A3A-PBE or minisdd7-PBE expression vector was co-transformed with the SoALS-P174 target expression vector using a gene gun bombardment method. The progeny transgenic plants were then analyzed using next-generation high-throughput sequencing, successfully obtaining mutant plants with all copies completely edited. Figure 7 However, due to the wide editing window of A3A-PBE, a large number of plants with the first base of the editing window edited in the offspring will have their arginine encoded by the CAG codon changed to a stop codon encoded by UAG.

[0132] It should be noted that although the technical solution of the present invention has been described with specific examples, those skilled in the art will understand that the present invention should not be limited thereto.

[0133] The various embodiments of the present invention have been described above. These descriptions are exemplary and not exhaustive, nor are they limited to the disclosed embodiments. Many modifications and variations will be apparent to those skilled in the art without departing from the scope and spirit of the described embodiments. The terminology used herein is chosen to best explain the principles, practical application, or technical improvements to the embodiments in the market, or to enable others skilled in the art to understand the embodiments disclosed herein.

Claims

1. A method for precise gene editing in sugarcane, among which, The method includes introducing (a) a base editor and (b) an expression construct containing a nucleotide sequence encoding a guide RNA (sgRNA) targeting a target site into plant cells, and culturing the plant cells at 25°C to 37°C, thereby resulting in the editing of the genome sequence of at least one of the plant cells; Preferably, the plant cells are cultured at 30-37°C, thereby resulting in the editing of the genome sequence of at least one of the plant cells; The method can replace bases in the sugarcane genome and reduce the proportion of byproducts.

2. The method according to claim 1, wherein, The base editor comprises (i) a polynucleotide programmable DNA binding domain and (ii) a base-specific deaminase; Preferably, the base-specific deaminase includes cytosine deaminase.

3. The method according to claim 2, wherein, The cytosine deaminase is selected from APOBEC3A, minisdd7 and minisdd9, or a cytosine deaminase having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the same amino acid sequence as the aforementioned proteins.

4. The method according to claim 2 or 3, wherein, The method can achieve the substitution of C to T in the sugarcane genome and reduce the proportion of by-products.

5. The method according to any one of claims 2 to 4, wherein, The polynucleotide programmable DNA binding domain includes Cas9 nickase or a variant thereof.

6. The method according to claim 5, wherein, The Cas9 nickase variant includes nCas9(D10A).

7. The method according to any one of claims 1 to 6, wherein, The base editor also includes a uracil glycosylation inhibitor (UGI) domain.

8. The method according to any one of claims 1 to 7, wherein, The base editor also includes a nuclear localization signal (NLS) and / or an XTEN spacer peptide.

9. The method according to any one of claims 1 to 8, wherein, The base editors include A3A-PBE, minisdd7-PBE, and / or QBEmax.

10. The method according to any one of claims 1 to 9, wherein, The guide RNA contains a backbone sequence as shown in SEQ ID NO:

1.

11. The method according to any one of claims 1 to 10, wherein, The plant cells include sugarcane protoplasts and / or callus tissue.

Images