Cloning of GCR6 Gene and Its Application in Regulating Appearance Quality, Starch and Protein Storage in Rice

Abstract

The present application relates to cloning of rice chalky gene GCR6 and its application in regulating appearance quality, storage starch and protein. The present application uses low chalky R644 and high chalky Shadra varieties as parents to construct a genetic segregation population, and identifies a major gene GCR6 for regulating rice chalkiness. The loss-of-function mutant of the gene shows that the rice chalkiness rate is significantly increased, and the genotype GCR6 of the low chalky parent R644 R644 is complemented to the high chalky parent to effectively reduce the rice chalkiness and amylose content and increase the total storage protein content. The key variation sites of the two alleles result in a large difference in endosperm expression during development, and can be used as molecular markers for assisted selection breeding. The present application provides important gene resources for molecular breeding of narrow grain indica rice varieties. Through molecular marker assisted selection or transgenic technology for genetic manipulation of the gene, the rice quality can be effectively improved, and the present application has important theoretical value and broad application prospect.

Description

Technical Field

[0001] This invention belongs to the field of plant functional genomics and genetic engineering technology, specifically relating to the cloning of the rice chalky gene GCR6 and its application in regulating appearance quality, storing starch and protein. Background Technology

[0002] From the mid-20th century onwards, semi-dwarf breeding, cultivation technology innovations, and the widespread application of pesticides and fertilizers propelled a leapfrog increase in rice production. With socio-economic development and rising living standards, consumer demand has shifted from simply "eating enough" to "eating well and healthily," leading to upgraded market requirements for rice quality, encompassing multiple dimensions such as cooking taste, appearance, nutrition, and processing. Among these, appearance quality is the only core indicator that consumers can directly assess, with chalkiness being a key standard for measuring appearance quality. High-chalk rice experiences a significant decline in market value, weakening product competitiveness and directly impacting rice farmers' income and enthusiasm for rice cultivation.

[0003] Chalkiness refers to the white, opaque area formed by the loose arrangement of starch granules and protein bodies in the endosperm, and is a common indicator for assessing the quality of grains. The formation of chalkiness in rice is influenced by multiple factors, including the degree of endosperm cell fullness during grain filling, the density of starch body arrangement, and environmental conditions. Highly chalky grains have a loose and porous internal structure, making them prone to broken rice during processing such as hulling and milling, leading to a significant decrease in the head rice yield and severely impairing processing quality. Furthermore, the chalky area differs from the transparent endosperm in water absorption and gelatinization characteristics, which can disrupt the uniform texture and palatability of cooked rice, reducing its flavor and taste. Therefore, reducing chalkiness is a key approach to simultaneously improving the overall quality of rice in terms of appearance, processing, and taste.

[0004] From a genetic perspective, chalkiness is a typical quantitative trait, complexly regulated by multiple quantitative trait loci (QTLs) and highly sensitive to environmental factors such as soil fertility, temperature, and moisture. Previous studies have identified a number of genes involved in endosperm development regulation through severely chalky or mealy mutants. These genes function in processes such as starch synthesis, protein accumulation, vesicle transport, and programmed cell death. However, most of these genes originate from extreme mutants, and their direct application in breeding improvement often results in undesirable agronomic traits, making it difficult to produce superior varieties that meet production needs. The chalkiness of the Indica rice subspecies, widely cultivated in southern my country, is consistently higher than that of the Japonica rice subspecies, a long-recognized but poorly understood scientific problem. This significant difference in chalkiness accumulation between subspecies, especially considering the dominant cultivation of Indica rice in my country's major rice-producing areas, urgently requires in-depth analysis of its genetic regulatory mechanisms to provide theoretical support for breeding low-chalk Indica rice. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the GCR6 gene or its encoded protein in rice in reducing chalkiness rate and amylose content, increasing total storage protein content, and improving rice quality. This invention addresses the key scientific question of why narrow-grain indica rice exhibits chalkiness. Using two narrow-grain indica rice varieties, low-chalkiness R644 and high-chalkiness Shadra, as parents, a BC1F2 genetic segregating population was constructed, identifying a low-chalkiness dominant QTL-GCR6. Using the BC1F3 genetic population and map-based cloning methods, GCR6 was finely mapped to a 3.8 kb interval containing only one ORF1, making it a reliable candidate gene for GCR6. GCR6 encodes an early rhizobium protein, and its loss-of-function mutant is characterized by a significantly increased chalkiness rate in rice. Further, by mapping the GCR6 gene from the low-chalkiness parental R644 genotype... R644 The complementary high-chalk parent Shadra was shown to effectively reduce chalkiness in rice, decrease amylose content, and increase total storage protein content without altering yield. Further research revealed that key variation sites between the two alleles led to significant differences in expression levels during endosperm development; this mechanistic discovery provides a direct basis for functional marker development. In addition, this invention performed haplotype analysis on the GCR6 gene, and the identified key haplotypes can be used as molecular markers for assisted breeding, further improving the accuracy and efficiency of selection. This invention provides important genetic resources for molecular breeding of narrow-grain indica rice; genetic manipulation of the GCR6 gene using molecular marker-assisted selection or transgenic technology can significantly improve rice appearance quality and promote the breeding of high-quality narrow-grain indica rice varieties.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: This invention analyzed the rice quality of the BC1F2 genetic populations of rice R644 and Shadra under natural field conditions and found that this gene has a significant effect on chalkiness rate. Using the BC1F3 genetic population and map-based cloning methods, GCR6 was finely mapped to a 3.8 kb region containing only one ORF1, making it a reliable candidate gene for GCR6. It has only one full-length cDNA. The full sequence of this gene in rice R644 is shown in SEQ ID NO.1, in rice Shadra in SEQ ID NO.2, and in japonica rice ZH11 in SEQ ID NO.3, including a promoter, 5' UTR, CDS, introns, and 3' UTR. Its CDS sequence is shown in SEQ ID NO.4, and the encoded protein is shown in SEQ ID NO.5.

[0007] Specifically, the present invention provides the use of rice GCR6 protein, nucleic acid molecule encoding said GCR6 protein, expression cassette containing said nucleic acid molecule, recombinant vector, transgenic cell line or recombinant bacteria in any of the following: A1) Application in regulating rice quality; A2) Application in the preparation of products that regulate the quality of rice grains; A3) Application in cultivating rice germplasm with high rice quality; A4) Application in the preparation of products using rice germplasm with high rice quality; A5) Application in identifying or assisting in the identification of rice quality; A6) Application in the preparation of products for identifying or assisting in the identification of rice quality; The amino acid sequence of the GCR6 protein is shown in SEQ ID NO.5; the rice quality includes: chalky appearance quality, amylose content, and total storage protein content.

[0008] Furthermore, the regulation includes: reducing rice quality by knocking out, inhibiting or reducing the expression, function or activity of the GCR6 gene or its encoded protein in rice; and / or improving rice quality by promoting the expression of the GCR6 gene or enhancing the function or activity of its protein; or, cultivating rice germplasm with high rice quality.

[0009] Furthermore, the nucleotide sequence encoding the GCR6 protein is shown in any one of SEQ ID NO.1-SEQ ID NO.4.

[0010] Furthermore, the improvement in rice quality is manifested in: reduced chalkiness and lower chalkiness rate; lower amylose content and higher total stored protein content.

[0011] Furthermore, molecular marker-assisted breeding can be carried out based on any molecular markers designed based on the GCR6 gene or its major alleles, including CAPS and KASP, and the expression level of the GCR6 gene can be screened to identify or assist in the identification of high-quality rice germplasm. Rice germplasm containing high expression of the GCR6 allele can be identified as high-quality rice.

[0012] The present invention also provides a method for improving rice quality and / or cultivating high-quality rice germplasm by promoting the expression of the GCR6 gene or enhancing the function or activity of its protein, thereby improving rice quality and / or cultivating high-quality rice germplasm; wherein the amino acid sequence of the GCR6 protein is shown in SEQ ID NO.5; the rice quality includes: chalky appearance quality of rice, amylose content, and total storage protein content.

[0013] Furthermore, improved rice quality or high-quality rice germplasm is characterized by: reduced chalkiness and lower chalkiness rate; lower amylose content and higher total storage protein content.

[0014] Furthermore, by using the highly expressed GCR6 allele as shown in SEQ ID NO.1, GCR6... R644 The gene can be introduced into the rice variety to be improved, or the GCR6 allele in the rice variety to be improved can be replaced with the highly expressed GCR6 allele as shown in SEQ ID NO.1. R644 This aims to improve rice quality and / or cultivate high-quality rice germplasm. The rice varieties to be improved include those carrying undesirable GCR6 alleles, such as Shadra.

[0015] Furthermore, the GCR6 allele, as shown in SEQ ID NO.1, is highly expressed. R644 By ligating the plant expression vector pCAMBIA 1301 and transforming it into rice varieties such as Shadra, positive single plants can be screened to improve rice quality and cultivate high-quality rice germplasm.

[0016] Furthermore, by introducing a recombinant expression cassette containing the GCR6 coding sequence into rice, GCR6 overexpression rice can be obtained, thereby improving rice quality and / or cultivating high-quality rice germplasm.

[0017] Furthermore, hybridization and continuous backcrossing can be used. Specifically, the rice variety to be improved is used as the donor parent, and the rice variety containing the high expression of the GCR6 allele is used as the recurrent parent. The rice is backcrossed four or more times to construct near-isogenic lines, and homozygous near-isogenic lines containing the high expression of the GCR6 allele are screened to improve the quality of rice or to cultivate high-quality rice germplasm.

[0018] The present invention also provides a method for reducing rice quality, the method comprising: knocking out, inhibiting or reducing the expression, function or activity of the GCR6 gene or its encoded protein in rice.

[0019] Furthermore, the substance that inhibits the expression or function of GCR6 protein in rice is a CRISPR / Cas9 vector targeting the polynucleotide shown in SEQ ID NO. 6. Rice with reduced quality after CRISPR / Cas9 system editing contains polynucleotides as shown in SEQ ID NO. 7-9.

[0020] This invention also provides molecular markers related to the chalkiness rate of rice, the nucleotide sequences of which are shown in SEQ ID NO.1, involving 18 variant sites, including: SNP1-SNP8, InDel1, InDel2, SNP9-SNP11, InDel3, InDel4, SNP12, and SNP13-SNP14; wherein, SNP1-SNP8 are polymorphisms at positions 48, 1025, 1082, 1087, 1206, 1239, 1269, and 1326 of the sequence shown in SEQ ID NO.1, respectively, namely A / G, T / C, C / T, A / G, C / A, G / A, C / T, and A / G. InDel1 indicates the presence or absence of an 11bp (CATTATTTTAC) deletion at positions 1361-1371 of the sequence shown in SEQ ID NO.1; InDel2 indicates the presence or absence of a 2bp deletion at positions 1415-1416 of the sequence shown in SEQ ID NO.1; SNP9-SNP11 are G / T, A / G, and T / A polymorphisms at positions 1527, 1605, and 1895 of the sequence shown in SEQ ID NO.1, respectively. InDel3 indicates the presence or absence of a 4bp deletion between positions 1923 and 1924 of the sequence shown in SEQ ID NO.1; InDel4 indicates the presence or absence of a 2bp deletion between positions 1946 and 1947 of the sequence shown in SEQ ID NO.1; SNP12 contains the ATATATAT / CTCTCTCT polymorphism at positions 2271-2278 of the sequence shown in SEQ ID NO.1; SNP13-SNP14 are A / T and G / A polymorphisms at positions 2288 and 2453 of the sequence shown in SEQ ID NO.1, respectively.

[0021] Furthermore, based on the results of the variant sites SNP1-SNP8, InDel1, InDel2, SNP9-SNP11, InDel3, InDel4, SNP12, and SNP13-SNP14, rice was divided into haplotypes Hap1-Hap3; where Hap1 is ATCACGCA / +11bp / +2bp / GAT / -4bp / -2bp / ATATATAT / AG; Hap2 is GCGGATG / -11bp / -2bp / TGA / +4bp / +2bp / CTCTCTCT / TA; and Hap3 is GCGGATG / -11bp / -2bp / TGA / -4bp / +2bp / CTCTCTCT / TA. (Where + indicates that there is no base deletion at the corresponding InDel site, and - indicates that there is a base deletion at the corresponding InDel site).

[0022] This invention also provides a method for identifying or assisting in the identification of chalkiness traits in rice. Specifically, the method utilizes the aforementioned molecular marker combination to detect chalkiness in rice. When the detection result is Hap1, the rice is identified as low-chalkiness rice germplasm; when the detection result is Hap2 or Hap3, it is identified as high-chalkiness rice germplasm. Compared to haplotypes Hap2 and Hap3, haplotype Hap1 exhibits higher GCR6 expression levels, lower chalkiness, lower amylose content, and higher total storage protein content.

[0023] This invention also provides a method for molecular marker-assisted breeding of rice, which involves using the above method to test the rice to be tested, and selecting rice germplasm with the test result of Hap1 as low chalky high-quality rice germplasm for subsequent breeding.

[0024] Compared with existing technologies, this invention has the following beneficial effects: This invention clones a major gene, GCR6, that regulates chalkiness in rice, clarifying its dominant effect and the molecular mechanism by which loss of function leads to a significant increase in chalkiness rate, providing a key breakthrough in revealing the genetic basis of chalkiness formation in narrow-grain indica rice. Simultaneously, haplotype analysis of the GCR6 gene screens out key haplotypes closely associated with the low-chalkiness phenotype, which can be used as efficient molecular markers for assisted selection, significantly improving the accuracy and efficiency of breeding high-quality rice varieties. This invention not only enriches the theoretical system of rice grain quality regulation, but also, through marker-assisted selection or transgenic technology, genetic manipulation of this gene can significantly reduce rice chalkiness, improve appearance quality, reduce amylose, and increase total storage protein without sacrificing yield. The GCR6 gene provided by this invention offers a specific and efficient gene resource and technical means for the targeted improvement of narrow-grain indica rice, filling a gap in related fields, powerfully promoting the breeding process of new high-quality narrow-grain indica rice varieties, and has broad application prospects. Attached Figure Description

[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a flowchart illustrating the technical process of using the RapMap method to quickly locate and clone GCR6 in Embodiment 2 of the present invention.

[0027] Figure 2This is the initial localization of GCR6 in Example 2 of the present invention, where: a) appearance quality traits and chalkiness rate of R644 and Shadra; b) chalkiness rate distribution of the BC1F2 population; c) the rice chalkiness QTL gene GCR6 was identified using a RICE 6K SNP chip, with the QTL region represented by a green rectangular marker on the chromosome; d) candidate GCR6 loci were determined using co-segregation criteria, i.e., the two homozygous genotypes of GCR6 can significantly distinguish the two extreme chalkiness phenotypes. A (red), B (blue), and H (gray) represent the high-value homozygous, low-value homozygous, and heterozygous genotypes of the GCR6 locus, respectively. The two homozygous genotypes of GCR6 can significantly separate the chalkiness rate of rice.

[0028] Figure 3 This invention relates to the fine mapping of the GCR6 locus in Example 2. GCR6 was finely mapped and cloned using the chalky phenotype and genotype of 39 recombinant single plants selected from a large population of 2940 BC1F3 individuals. Phenotypic analysis was performed on the progeny of each recombinant single plant to infer the genotype of GCR6.

[0029] Figure 4 This invention relates to the identification of GCR6 candidate genes in Example 2. Specifically: a) RT-PCR and RT-qPCR analysis of ORF1 expression in the endosperm of 5- and 10-DAP populations; b) GCR6 gene structure and natural variation between R644 / ZH11 and Shadra.

[0030] Figure 5 This is the phenotype of the GCR6 near-isogenic line in Example 3 of the present invention. Wherein: a, chalky phenotype of rice in the GCR6 near-isogenic line; b, expression level of GCR6 at various stages of stem, leaf, and endosperm development in the near-isogenic line; c, NIL. Shadra With NIL R644 Total storage protein, total storage starch, and amylose content. (d, NIL) Shadra With NIL R644 Yield per plant.

[0031] Figure 6 The results show the chalky phenotype and chalky rate of the GCR6 transgenic complementary family in Example 3 of this invention.

[0032] Figure 7 The results show the chalky phenotype and chalky rate determination of the GCR6 transgenic knockout family in Example 3 of this invention.

[0033] Figure 8 This is a haplotype analysis of GCR6 in Example 4 of the present invention. Detailed Implementation

[0034] The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art. Unless specifically stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field. Unless specifically stated, the reagents and materials used in the following embodiments are commercially available.

[0035] Example 1: Identification of Rice Quality and Yield Before examining appearance quality traits such as chalkiness in rice, harvested mature seeds should be thoroughly dried by baking or sun-drying and stored at room temperature for at least three months. Rice chalkiness, including ventral white, central white, and back white, is generally detected visually. Mature, dried seeds are threshed and dehulled to obtain brown rice. One hundred whole rice grains are randomly selected, and the percentage of chalky grains is expressed as the grain chalkiness rate (GCR). Chalkiness in rice reduces its appearance, milling, cooking, and eating quality, as well as the yield of head rice; therefore, increased chalkiness is the most direct indicator of rice quality.

[0036] The total protein content of brown rice grains was measured using an XDS near-infrared rapid content analyzer (FOSS) and near-infrared reflectance spectroscopy. The milled rice was ground into flour, and the total starch and amylose content were measured using conventional chemical methods.

[0037] Example 2: Discovery of GCR6, the major gene for chalkiness in rice. The parental lines used in this invention are rice R644 and Shadra, both belonging to rice microcore germplasm resources, with consistent grain width. The RapMap method was used for rapid localization and cloning of GCR6, as follows: Figure 1 As shown, the details are as follows.

[0038] 1) Initial mapping of the GCR6 gene: Low-chalk, narrow-grained indica rice R644 was used as the female parent (recipient), and the similarly narrow-grained, high-chalk indica rice variety Shadra was used as the male parent (donor) for hybridization and backcrossing. The grain phenotypes and appearance quality traits (chalkiness rate) of the parents R644 and Shadra are as follows: Figure 2 As shown in figure a, the chalkiness rate of the maternal parent R644 was significantly lower than that of the paternal parent Shadra. After harvesting the BC1F1 generation of the true hybrid, a segregating population of BC1F2 containing 171 individual plants was constructed through self-pollination. The chalkiness phenotype of rice in this population was investigated. Figure 2 (b) Extreme high-low germination pools were constructed using the BSA method. Ten plump seeds were selected from each plant in the extreme pool, and the high- and low-level pools were mixed and germinated separately. Two weeks later, equal amounts of leaves from each plant were ground with liquid nitrogen and sent to China Seed Group (Wuhan) for RICE6K SNP chip detection. Figure 2 c).

[0039] The RiceVarMap database (http: / / ricevarmap.ncpgr.cn / ) was used to find "Variation IDs" for InDel polymorphism, and then InDel markers were designed using the "Design Primer by Variation ID" function. Priority was given to InDel variants with 3-8 bp deletions and PCR fragments of approximately 100-200 bp. Template DNA from R644 and Shadra was amplified using all designed primers or markers, and detected by 4% PAGE gel electrophoresis. Primers 6W1, 6W2, 6W3, and 6W4 (Table 1) were found to be polymorphic between the parents, and genotyping of individual plants in this population was performed using these primers.

[0040] Analysis of genotypes and individual plant phenotypes based on markers 6W2 and 6W4 ( Figure 2 d) The homozygous genotypes in this segment can separate the chalkiness rate of rice, and the difference is extremely significant, indicating that this locus belongs to single-factor Mendelian inheritance, and can be further finely mapped and cloned. This locus is named GCR6.

[0041] 2) Fine mapping of GCR6 gene: In order to further narrow down the mapping range of GCR6, the BC1F2 single plants with heterozygous initial mapping range were developed into a large population of 2940 BC1F3 plants, and recombinant single plants were screened from them.

[0042] First, InDel markers 6W2 and 6W4 (Table 1) were used for screening, resulting in 39 recombinant single plants selected from 2940 plants. These single plants underwent progeny testing to confirm the phenotype of their parent generation: segregating pedigrees indicated a heterozygous parent phenotype; non-segregating high-value phenotypes indicated a homozygous parent phenotype from Shadra; and low-value phenotypes indicated a homozygous parent phenotype from R644. Then, these 39 recombinant single plants were analyzed using seven developed InDel markers (6W5, 6W6, 6W7, 6W8, 6W9, 6W10, and 6W11, see Table 1 for details). Therefore, GCR6 was ultimately located between 6W6 and 6W7, corresponding to a physical region of approximately 3.8 kb on the Nipponbare genome sequence, containing only one open reading frame (ORF1). Figure 3 ).

[0043] RT-PCR and RT-qPCR analysis of the endosperm (5 DAP and 10 DAP) of populations A and B at 5 and 10 days post-pollination showed that the expression level of this ORF1 in R644 was significantly higher than that in Shadra. Figure 4a). Sequence amplification and alignment between parents using designed primers (GCR6-1, GCR6-2, and GCR6-3) revealed 15 variations in the promoter region, 2 variations in the intron region, and 1 synonymous mutation in the exon region. Figure 4 (b) These data indicate that ORF1 is a reliable candidate gene for GCR6.

[0044] In the rice R644 and Shadra genomes, the full sequences of the GCR6 gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. In japonica rice ZH11, the full sequence of this gene is shown in SEQ ID NO.3, including the promoter, 5' UTR, CDS, intron, and 3' UTR. The CDS sequence of the GCR6 gene is shown in SEQ ID NO.4, and the encoded protein is shown in SEQ ID NO.5.

[0045] The primers used in this embodiment are shown in Table 1 below.

[0046] Table 1 Primers used for GCR6 gene localization and cloning

[0047] Example 3: Application of the rice GCR6 gene in regulating the appearance quality (chalkiness rate) of rice. 1. Construction of Shadra background near-isogenic lines (NILs) Near-isogenic lines (NILs) with a Shadra background were constructed to verify the effects of two GCR6 alleles on rice appearance quality, specifically chalkiness rate. Using R644 as the donor parent and Shadra as the recurrent parent, backcrossing was performed at least four times (each backcross was supplemented with MAS, and single plants with heterozygous 6W6 and 6W7 markers and consistent plant type with Shadra were selected as the male parent). Self-pollination followed, and homozygous NILs were selected from these lines. Shadra With NIL R644 With NIL Shadra In comparison, NIL R644 This reduced the chalkiness rate of rice by 55%. Figure 5 a), GCR6 expression levels in the endosperm remained consistently high at all developmental stages (a), Figure 5 (b) Total storage protein content increased, amylose content decreased, while total storage starch content showed no significant change. Figure 5 c). Meanwhile, there was no difference in yield per plant among near-isogenic lines ( Figure 5 d). This study demonstrates that GCR6 is a key regulatory gene for the appearance quality of rice, and its R644 allele is a favorable allele. It can be used in narrow-grain indica rice through MAS or transgenic technology to achieve precise improvement of "high quality without changing yield", which has important breeding application value.

[0048] 2. Low chalky parental R644 genotype GCR6 R644 Complementary to the high chalky parent Shadra The GCR6 allele of the low-chalk parent R644 was used to select the GCR6 gene. R644 The GCR6 gene was complemented into the highly chalky parent Shadra, and the changes in chalkiness rate in the transgenic plants were observed to further verify the function of the GCR6 gene. Using the genomic DNA of R644 as a template, PCR-specific primers GCR6-H (Table 2) with restriction endonucleases EcoRI and KpnI adapters were designed to amplify the GCR6 allele fragment of R644. An EcoRI adapter was added to the 5' end, and a KpnI adapter was added to the 3' end. The PCR product was ligated into the plant expression vector pCAMBIA 1301, which had been double-digested with EcoRI / KpnI, using the Gibson ligation method (Gibson et al., 2009, Nat. Methods 6:343-345), obtaining the recombinant vector pCAMBIA 1301-GCR6. R644 .

[0049] Using a transgenic approach, the correctly cloned plasmid was introduced into Shadra rice via an Agrobacterium-mediated genetic transformation system. After induction, subculture, infection, co-culture, screening for hygromycin-resistant callus, differentiation, rooting, hardening, and transplanting, transgenic rice plantlets were obtained. GCR6-HJ (Table 2) was used to detect transgenic complementary positive plants.

[0050] The study examined the chalkiness of rice in the transgenic complementary positive families GCR6-Com (#1 and #2) and the wild-type family Shadra. The results showed that the transgenic complementary positive family GCR6-Com exhibited a significantly lower chalkiness rate compared to the wild-type Shadra. Figure 6 These results demonstrate the function of the GCR6 gene in regulating the chalkiness rate of rice. By introducing the GCR6 allele from the low-chalkiness parent R644, as shown in SEQ ID NO.1, into rice varieties that require improved rice quality (especially varieties carrying undesirable GCR6 alleles, such as Shadra), the appearance quality of rice can be effectively improved without significantly altering the original agronomic background, resulting in a significant reduction in chalkiness rate.

[0051] 3. Functional validation of CRISPR knockout of the GCR6 gene in superior parent ZH11 Using the U6 plasmid as a template, amplification was performed using the forward primer of GCR6-U6 and the reverse primer of U6 (Table 2); using the U6 plasmid as a template, amplification was performed using the reverse primer of GCR6-U6 and the forward primer of U6 (Table 2); the two amplification products were recovered separately and mixed in equal amounts. Using the mixture as a template, amplification was performed using the U6 primer. After product recovery, the product was introduced into the pCXUN-CAS9 plasmid (pre-digested with KpnI) using the Gibson ligation method (refer to patent CN201610639854.3) to obtain the pCXUN-CAS9-GCR6-U6 knockout vector. The target site of the knockout vector is shown in SEQ ID NO. 6.

[0052] Using a transgenic approach, the correctly cloned pCXUN-CAS9-GCR6-U6 knockout vector was introduced into ZH11 rice via an Agrobacterium-mediated transformation system. After induction, subculture, infection, co-culture, screening for hygromycin-resistant calluses, differentiation, rooting, hardening, and transplanting, transgenic rice plantlets were obtained. The transgenic plants were detected using the GCR6-CR primer set (Table 2), and the successful knockout positive plants were confirmed by sequencing using GCR6-CX (Table 2). In rice edited using the CRISPR / Cas9 system, GCR6 function is lost, and it possesses polynucleotides as shown in SEQ ID NO. 7-9, specifically: TCGTCTTCTGCAGTTCCCACC (SEQ ID NO.7); TCGGCTTCTGCAGTTCCCACC (SEQ ID NO.8); TCG - - TTCTGCAGTTCCCACC (SEQ ID NO. 9).

[0053] The study examined the chalkiness of rice in CRISPR-positive GCR6-CR (#1, #2, and #3) transgenic plants and wild-type ZH11. The results showed that the GCR6-CR knockout family exhibited a significantly higher chalkiness rate compared to wild-type ZH11, indicating that mutations or low expression of GCR6 increase chalkiness in rice. Figure 7 This result confirms, from a reverse genetics perspective, the crucial role of the GCR6 gene in regulating chalkiness in rice. The normal function of this gene is key to maintaining the inhibition of chalkiness and improving appearance quality.

[0054] The primers used in this embodiment are shown in Table 2 below.

[0055] Table 2 Primers used for GCR6 gene function verification

[0056] Example 4: GCR6 haplotype analysis in 533 core germplasm resources To investigate the effects of different GCR6 alleles in rice microcore germplasm on its expression and grain chalkiness rate, all variants (SNPs and InDels) of the GCR6 gene in the core germplasm were searched on RiceVarMap within the CDS of the GCR6 parents and within 2 kb upstream and 0.5 kb downstream, including the promoter region, 5'UTR, 3'UTR, and coding region. A total of 18 representative variants were analyzed for haplotype.

[0057] like Figure 8 As shown, of the 18 representative variants on the GCR6 gene, the first 15 variants are located in the promoter region of the GCR6 gene, and the last 3 variants are located in the coding region of the GCR6 gene. In order of their physical location, they include: 8 SNPs (SNP1-SNP8), 2 InDel (InDel1, InDel2), 3 SNPs (SNP9-SNP11), 2 InDel (InDel3, InDel4), and 3 SNPs (SNP12-SNP14).

[0058] The first A in the start codon ATG is defined as 1, and the first base before ATG is defined as -1. SNP1-SNP8 are the -1953, -976, -919, -914, -795, -762, -732, and -675 positions of the GCR6 gene, respectively, which contain A / G, T / C, C / T, A / G, C / A, G / A, C / T, and A / G polymorphisms. These correspond to positions 48, 1025, 1082, 1087, 1206, 1239, 1269, and 1326 of the sequence shown in SEQ ID NO.1. The physical positions are positions 2202255, 2201278, 2201221, 2201216, 2201097, 2201064, 2201034, and 2200977 of chromosome 6 of rice.

[0059] InDel1 indicates the presence or absence of an 11bp (CATTATTTTAC) deletion at position -630 of the GCR6 gene, corresponding to the presence or absence of an 11bp (CATTATTTTAC) deletion at positions 1361-1371 of the sequence shown in SEQ ID NO.1, with the physical location being positions 2200942-2200932 of chromosome 6 of rice.

[0060] InDel2 indicates the presence or absence of a 2bp (TC) deletion at position -585 of the GCR6 gene, corresponding to the presence or absence of a 2bp (TC) deletion at positions 1415-1416 of the sequence shown in SEQ ID NO.1, with the physical location being positions 2200888-2200889 on chromosome 6 of rice.

[0061] SNP9-SNP11 represent G / T, A / G, and T / A polymorphisms at positions -474, -396, and -106 of the GCR6 gene, respectively, corresponding to positions 1527, 1605, and 1895 of the sequence shown in SEQ ID NO.1, and physically located at positions 2200776, 2200698, and 2200407 of chromosome 6 of rice.

[0062] InDel3 indicates the presence or absence of a 4bp (CGCT) deletion at position -77 of the GCR6 gene, corresponding to the presence or absence of a 4bp (CGCT) deletion at positions 1923 and 1924 of the sequence shown in SEQ ID NO.1, physically located between positions 2200379 and 2200380 of chromosome 6 of rice.

[0063] InDel4 indicates the presence or absence of a 2bp (GT) deletion at position -54 of the GCR6 gene, corresponding to the presence or absence of a 2bp (GT) deletion at positions 1946 and 1947 of the sequence shown in SEQ ID NO.1, physically located between positions 2200356 and 2200357 of chromosome 6 of rice.

[0064] SNP12 is an ATATATAT / CTCTCTCT polymorphism at positions 271-278 of the GCR6 gene, corresponding to positions 2271-2278 of the sequence shown in SEQ ID NO.1, with a physical location at positions 2200025-2200032 on chromosome 6 of rice.

[0065] SNP13-SNP14 represent A / T and G / A polymorphisms at positions 288 and 453 of the GCR6 gene, respectively, corresponding to positions 2288 and 2453 of the sequence shown in SEQ ID NO.1, with physical locations at positions 2200015 and 2199850 of chromosome 6 of rice.

[0066] The reference genome version mentioned above is MSU version 7.0.

[0067] Haplotype analysis revealed that 18 representative variants on GCR6 (SNP1-SNP8, InDel1, InDel2, SNP9-SNP11, InDel3, InDel4, SNP12, SNP13-SNP14) were classified into three haplotypes (Hap1-Hap3). Hap1 is ATCACGCA / +11bp / +2bp / GAT / -4bp / -2bp / ATATATAT / AG; Hap2 is GCGGATG / -11bp / -2bp / TGA / +4bp / +2bp / CTCTCTCT / TA; and Hap3 is GCGGATG / -11bp / -2bp / TGA / -4bp / +2bp / CTCTCTCT / TA (where + indicates that there is no base deletion at the corresponding InDel site, and - indicates that there is a base deletion at the corresponding InDel site).

[0068] R644 belongs to Hap1, and Shadra belongs to Hap2. Further analysis showed that the expression of the GCR6 gene in Hap1 was significantly higher than that in other haplotypes, with expression levels 37% and 141% higher than those in Hap2 and Hap3, respectively; correspondingly, the chalkiness rate of Hap1 grains was significantly lower than that in other haplotypes, with chalkiness rates 17% and 33% lower than those in Hap2 and Hap3, respectively. Figure 8 The above results indicate that the GCR6 high-expression allele derived from R644 has significant breeding application value in reducing chalkiness in rice grains and improving the appearance quality of rice. Furthermore, these representative variation sites can be directly applied as molecular markers for assisted breeding. By identifying haplotypes in breeding populations, superior individual plants carrying Hap1 (i.e., the GCR6 high-expression allele) can be quickly and accurately screened, significantly improving the selection efficiency for low chalkiness traits and accelerating the breeding process of high-quality narrow-grain indica rice varieties.

[0069] In summary, this invention addresses the scientific problem of chalkiness formation in narrow-grained indica rice and successfully cloned a major gene, GCR6, that regulates chalkiness in rice. By constructing a BC1F2 genetic segregating population, the low-chalkiness dominant QTL-GCR6 was identified. Using a large BC1F3 genetic population and map-based cloning, GCR6 was finely mapped to a 3.8 kb region containing only one ORF1, which was considered a reliable candidate gene for GCR6. Analysis showed that GCR6 encodes an early root nodule protein. Near-isogenic lines and complementation experiments confirmed that the R644 allele of GCR6 is GCR6. R644This invention can reduce chalkiness and amylose content while increasing total storage protein content without affecting yield per plant, achieving synergistic improvement in quality and yield. CRISPR / Cas9 gene knockout experiments further validated the function of GCR6, with the loss-of-function mutant showing a significant increase in chalkiness. Furthermore, haplotype analysis of the GCR6 gene revealed that the Hap1 type GCR6 gene derived from R644 had the highest expression level and the lowest chalkiness rate. Key variation sites between the two alleles directly led to significant differences in expression levels during endosperm development, which can be used as molecular markers for assisted selection breeding, improving the accuracy and efficiency of selection. This invention provides important gene resources and efficient molecular marker tools for high-quality breeding of narrow-grain indica rice, possessing significant theoretical value and broad application prospects.

[0070] The above detailed embodiments describe the implementation of the present invention; however, the present invention is not limited to the specific details described in the above embodiments. Within the scope of the claims and technical concept of the present invention, various simple modifications and changes can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

Claims

1. The use of rice GCR6 protein, nucleic acid molecule encoding said GCR6 protein, expression cassette containing said nucleic acid molecule, recombinant vector, transgenic cell line or recombinant bacteria in any of the following: A1) Application in regulating rice quality; A2) Application in the preparation of products that regulate the quality of rice grains; A3) Application in cultivating rice germplasm with high rice quality; A4) Application in the preparation of products using rice germplasm with high rice quality; A5) Application in identifying or assisting in the identification of rice quality; A6) Application in the preparation of products for identifying or assisting in the identification of rice quality; The amino acid sequence of the GCR6 protein is shown in SEQ ID NO.5; the rice quality includes: chalky appearance quality, amylose content, and total storage protein content.

2. The application according to claim 1, characterized in that, The regulation includes: By knocking out, inhibiting, or reducing the expression, function, or activity of the GCR6 gene or its encoded protein in rice, rice quality can be reduced; and / or, By promoting the expression of the GCR6 gene or enhancing the function or activity of its protein, the quality of rice can be improved, or high-quality rice germplasm can be cultivated.

3. The application according to claim 1, characterized in that, The nucleotide sequence encoding the GCR6 protein is shown in any one of SEQ ID NO.1-SEQ ID NO.

4.

4. A method for improving rice quality and / or cultivating high-quality rice germplasm, characterized in that, By promoting the expression of the GCR6 gene or enhancing the function or activity of its protein, the quality of rice can be improved and / or high-quality rice germplasm can be cultivated. The amino acid sequence of the GCR6 protein is shown in SEQ ID NO.5; the rice quality includes: chalky appearance quality, amylose content, and total storage protein content.

5. The method according to claim 4, characterized in that, By overexpressing the GCR6 allele as shown in SEQ ID NO.1 R644 The gene can be introduced into the rice variety to be improved, or the GCR6 allele in the rice variety to be improved can be replaced with the highly expressed GCR6 allele as shown in SEQ ID NO.

1. R644 This will improve the quality of rice and / or cultivate high-quality rice germplasm.

6. The method according to claim 4, characterized in that, By introducing recombinant expression cassettes containing the GCR6 coding sequence into rice, GCR6 overexpression rice can be obtained, thereby improving rice quality and / or cultivating high-quality rice germplasm.

7. Molecular markers associated with chalkiness rate in rice, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, involving 18 variant sites, including: SNP1-SNP8, InDel1, InDel2, SNP9-SNP11, InDel3, InDel4, SNP12, and SNP13-SNP14; wherein, SNP1-SNP8 are polymorphisms at positions 48, 1025, 1082, 1087, 1206, 1239, 1269, and 1326 of the sequence shown in SEQ ID NO.1, respectively, namely A / G, T / C, C / T, A / G, C / A, G / A, C / T, and A / G. InDel1 indicates the presence or absence of an 11bp deletion at positions 1361-1371 of the sequence shown in SEQ ID NO.1; InDel2 indicates the presence or absence of a 2bp deletion at positions 1415-1416 of the sequence shown in SEQ ID NO.1; SNP9-SNP11 are G / T, A / G, and T / A polymorphisms at positions 1527, 1605, and 1895 of the sequence shown in SEQ ID NO.1, respectively. InDel3 indicates the presence or absence of a 4bp deletion between positions 1923 and 1924 of the sequence shown in SEQ ID NO.1; InDel4 indicates the presence or absence of a 2bp deletion between positions 1946 and 1947 of the sequence shown in SEQ ID NO.1; SNP12 contains the ATATATAT / CTCTCTCT polymorphism at positions 2271-2278 of the sequence shown in SEQ ID NO.1; SNP13-SNP14 are A / T and G / A polymorphisms at positions 2288 and 2453 of the sequence shown in SEQ ID NO.1, respectively.

8. The molecular marker combination according to claim 7, characterized in that, Rice was classified into haplotypes Hap1-Hap3 based on the results of the variant sites SNP1-SNP8, InDel1, InDel2, SNP9-SNP11, InDel3, InDel4, SNP12, and SNP13-SNP14, respectively. Among them, Hap1 is ATCACGCA / +11bp / +2bp / GAT / -4bp / -2bp / ATATATAT / AG; Hap2 is GCGGATG / -11bp / -2bp / TGA / +4bp / +2bp / CTCTCTCT / TA; and Hap3 is GCGGATG / -11bp / -2bp / TGA / -4bp / +2bp / CTCTCTCT / TA.

9. A method for identifying or assisting in the identification of chalky traits in rice, characterized in that, Rice is tested using any of the molecular marker combinations described in claims 7-8. When the test result is Hap1, it is identified as low-chalk rice germplasm, and when the test result is Hap2 or Hap3, it is identified as high-chalk rice germplasm.

10. A method for molecular marker-assisted breeding of rice, characterized in that, Rice was tested using the method described in claim 9, and rice germplasm with the test result of Hap1 was selected for subsequent breeding.

Images