Method for improving salt tolerance of soybean based on GmARFA1a gene

Abstract

The application discloses a method for improving salt tolerance of soybean based on GmARFA1a gene, and the salt tolerance of soybean is improved by reducing the expression amount of GmARFA1a gene in the soybean, so that the soybean plant with improved salt tolerance is obtained. The application improves the salt tolerance of soybean by interfering with the expression of GmARFA1a gene or knocking out the GmARFA1a gene, so that the soybean plant with improved salt tolerance is obtained, and a new way is provided for cultivating salt-tolerant high-yield soybean.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a method for improving the salt tolerance of soybeans based on the GmARFA1a gene. Background Technology

[0002] In recent years, numerous studies have focused on elucidating the molecular mechanisms of salt tolerance in soybean. For example, genome-wide association studies (GWAS) have comprehensively identified phenotypic characteristics of 261 soybean germplasm resources, uncovering 46 genetic loci significantly associated with salt tolerance and 15 candidate genes (such as Glyma.18g238700), providing important resources for salt-tolerant breeding. Furthermore, GmNFYA has been shown to activate salt-responsive genes by regulating histone H3K9 acetylation levels, and its promoter haplotype I exhibits high self-activation activity, making it a potential target for salt-tolerant breeding. Meanwhile, the GmSOS2L-GmbZIP131-GmICHG signaling pathway enhances soybean salt tolerance by promoting flavonoid accumulation and regulating reactive oxygen species homeostasis. These advances highlight the crucial importance of in-depth exploration of key regulatory factors for promoting the genetic improvement of salt tolerance in soybean and other crops.

[0003] ADP-ribosylation factors (ARFs) are a class of small GTP-binding proteins belonging to the Ras superfamily. Widely distributed in eukaryotes, they play crucial roles in vesicle transport, cytoskeleton remodeling, and signal transduction. ARF family proteins possess highly conserved GTP / GDP-binding domains, and their activity is regulated by GTP binding state: the GTP-bound form is activated and recruits downstream effector proteins; the GDP-bound form is inactive. In plants, ARF family members not only participate in basal cellular processes but have also been shown to be closely related to responses to abiotic stresses.

[0004] ARFA1 is an important member of the ARF family. ARFA1 proteins are located in subcellular structures such as the cytoplasm, cell membrane, and Golgi apparatus, and are known to play a central role in vesicle encapsulation and decapsulation, GTP binding, and intracellular protein transport. Current research indicates that ARFA1 genes play a crucial role in plant growth, development, and fertility regulation. In Arabidopsis, the ARFA1 gene family (including ARFA1a, ARFA1b, and ARFA1e) is expressed during anther development and collectively participates in floral structural development and fertility regulation. Arabidopsis ARFA1 genes also participate in the establishment of cotyledon vein patterns. The arfa1a, arfa1b, and arfa1e mutants all exhibit similar defects such as increased vein number and increased vein intersections, while double mutants show increased phenotypic severity, indicating functional redundancy in cotyledon vein formation. Furthermore, Arabidopsis ARFA1 genes are also involved in cell division, cell expansion, and cellulose synthesis. In rice, OsARFA1a is predominantly expressed in young roots and early-developing caryopsis, with its expression specifically localized to the aleurone layer and immature embryo of the developing caryopsis, suggesting a possible important function in root development and early seed development. In rapeseed, BnaC07.ARFA1A is highly expressed in all tissues, and its overexpression significantly increases the number of siliques and yield. In soybean, GmARFA1a is regulated by the male fertility control genes MS1 and MS2, and is predominantly expressed in the stamens before pollination; the Gmarfa1a mutant created using CRISPR / Cas9 technology exhibits decreased pollen viability and significantly inhibited seed setting. However, the function of ARFA1a in soybean salt tolerance has not yet been reported. Summary of the Invention

[0005] The purpose of this invention is to provide a method for improving the salt tolerance of soybeans based on the GmARFA1a gene. By interfering with or knocking out the expression of the GmARFA1a gene, the salt tolerance of soybeans can be improved, resulting in soybean plants with enhanced salt tolerance. This provides a new approach for cultivating salt-tolerant and high-yielding soybeans.

[0006] The technical solution adopted by this invention to solve its technical problem is: A method for improving salt tolerance in soybeans based on the GmARFA1a gene is proposed. This method improves the salt tolerance of soybeans by downregulating the expression level of the GmARFA1a gene in soybeans, thereby obtaining soybean plants with enhanced salt tolerance.

[0007] The expression level of the GmARFA1a gene in soybean was downregulated by interfering with or knocking out the GmARFA1a gene.

[0008] The sequence of the GmARFA1a gene is shown in SEQ ID No. 1.

[0009] Application of the GmARFA1a gene as a target for regulating soybean salt tolerance.

[0010] The GmARFA1a gene negatively regulates soybean salt tolerance.

[0011] The beneficial effects of this invention are: the GmARFA1a gene negatively regulates the salt tolerance of soybeans, which has breeding potential and lays the foundation for breeding salt-tolerant and high-yielding soybeans and for in-depth research on the mechanism by which the GmARFA1a gene regulates the salt tolerance of soybeans. It can also improve the salt tolerance of soybeans through genetic engineering and breed new salt-tolerant soybean varieties, which is of great significance for effectively utilizing the large area of ​​saline-alkali land in my country and increasing soybean yield. Attached Figure Description

[0012] Figure 1 Here are the GmARFA1a expression pattern analysis diagrams; (A) GmARFA1a response to salt stress, (B) Tissue-specific analysis of GmARFA1a expression; Figure 2 The results show the salt tolerance of Arabidopsis seedlings negatively regulated by GmARFA1a; (A) Detection of GmARFA1a expression level in transgenic Arabidopsis, (B) Salt-treated phenotype of Arabidopsis overexpression. Figure 3 The image shows the results of severe salt inhibition of Arabidopsis seedling growth caused by GmARFA1a overexpression; (A) taproot length, (B) number of lateral roots, (C) aboveground fresh weight, (D) underground fresh weight, (E) chlorophyll content. Figure 4 The determination of stress indicators in Arabidopsis thaliana overexpression: (A) MDA content, (B) POD activity and (C) SOD activity; Figure 5 This is a graph showing the phenotypic results of soil-cultured Arabidopsis thaliana after salt treatment; Figure 6 The results include: (A) Detection of GmARFA1a expression level in transgenic roots; (B) Salt treatment phenotype of soybean hairy root chimera plants; (C) Determination of stress indicators of salt tolerance in soybean roots negatively regulated by GmARFA1a. Figure 7 This is the image of the 1390-GFP-UBQ10-rnai plasmid. Detailed Implementation

[0013] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0014] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. The methods described in the following embodiments are conventional methods in the field, unless otherwise specified.

[0015] Example 1: Cloning and Expression Pattern Analysis of the Soybean Salt Tolerance Negative Regulatory Gene GmARFA1a 1.1 Analysis of GmARFA1a gene expression patterns under salt stress Six days after germination, Tianlong No. 1 (the soybean variety used in this invention, 'Tianlong No. 1' (Approval No.: National Approval Soybean 2008023), provided by Zhejiang Agriculture and Forestry University, is a publicly available variety bred by the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences, and can be obtained by the public through the institute or seed markets, etc.) seedlings were transferred to 1 / 2 modified Hoagland nutrient solution (Coollab, product number NS1011) and continued to be cultured until the first compound leaf unfolded. The hydroponically grown seedlings were treated with 200 mM NaCl, and samples were taken from the upper part of the plant and the roots at 0, 6, 12, 24, and 48 hours after treatment for subsequent RNA extraction and expression analysis.

[0016] The results showed that the aboveground parts began to respond 6 hours after treatment. GmARFA1a expression decreased slightly at 12 hours, but then increased significantly again at 24 hours and remained elevated until 48 hours. The root response showed a significant increase starting at 12 hours, followed by a decline. By 48 hours, the expression level of GmARFA1a in the roots was no different from that before treatment. Figure 1 (A)). The combined results showed that although the response rates and intensities of the aboveground parts and roots were different, GmARFA1a expression was induced by salt in both.

[0017] 1.2 Tissue-specific expression analysis of soybean GmARFA1a gene Flowers, leaves, root nodules, stems, petioles, seeds, pods, and roots of Tianlong No. 1 soybean were sampled, ground in liquid nitrogen, and total RNA was extracted from different tissues using an RNA extraction kit (Aikerui, catalog number: AG21017). First-strand cDNA was synthesized using the Evo M-MLVPluscDNA Synthesis Kit (Aikerui, catalog number: AG11615), and the cDNA was diluted 5-fold for quantitative analysis. Using GmCons4 (NCBI accession number: BU578186.1) as an internal control [primers: qRT-GmCons4-F: TATCCAGCAACACCCGAACA (SEQ ID No. 3), qRT-GmCons4-R: CGGTGGTTCTATCTTGGCATC (SEQ ID No. 4)], the expression level of GmARFA1a in different tissues was quantitatively detected [primers: RT-ARFA-6-F: GGGATGAGCTGCACAGAATG (SEQ ID No. 5), RT-ARFA-6-R: AGACCCTCTCCAGAAGTTGC (SEQ ID No. 6)]. The RT-qPCR reaction system is shown in Table 1, and the RT-qPCR reaction procedure is shown in Table 2.

[0018] Table 1 RT-qPCR reaction system

[0019] Table 2 RT-qPCR reaction procedure

[0020] RT-qPCR analysis showed that GmARFA1a was mainly expressed in petioles, followed by stems, and expressed at the lowest level in pods. Figure 1 (B) in the middle.

[0021] Example 2: Obtaining Arabidopsis thaliana overexpression and its salt tolerance study Obtaining transgenic Arabidopsis thaliana through overexpression To further investigate the role of GmARFA1a in plant salt tolerance, we constructed an Arabidopsis thaliana line overexpressing GmARFA1a, initiated by the 35S promoter (NCBI accession number: NC_001497). The wild-type and background Arabidopsis thaliana plants used in this study were of the Columbia-0 ecotype, and the transformation method was inflorescence infection. After antibiotic screening and DNA level identification, RT-qPCR was used to further clarify the expression level of GmARFA1a in Arabidopsis thaliana, and three homozygous transgenic lines were selected for further research.

[0022] 2.2 Construction of overexpression vectors The soybean GmARFA1a genome sequence is shown in SEQ ID No. 1, and the CDS sequence is shown in SEQ ID No. 2. Using cDNA from Tianlong No. 1 soybean as a template, gene amplification was performed using ARFA1a-GFP-F: GACAGCCCAGATCAACTAGTATGGGGTTGTCGTTCACG (SEQ ID No. 7) and ARFA1a-GFP-R: GCTCCGGACTTAAGACTAGTTGCTTTGCTGGCAATGTT (SEQ ID No. 8). Amplification was performed using KOD high-fidelity DNA polymerase. All components in the system, except for primers, template, and water, were supplied by a kit (KOD One™ PCR Master Mix, TOYOBO, catalog number: KMM-101). The gene amplification reaction system is shown in Table 3, and the PCR amplification program is shown in Table 4. The 1305-35S-GFP vector (Yobo Biotechnology, catalog number: VT1380) was digested with enzymes at the SpeⅠ restriction site. The correct fragment was ligated to the enzyme digestion vector. The ligation reaction conditions were 50℃ for 15 min. The ligation system is shown in Table 5.

[0023] Table 3 Amplification Mixture

[0024] Table 4 Amplification Procedure

[0025] Table 5 Connection Reaction System

[0026] The ligation product was mixed with 50 μL of competent E. coli DH5α cells in a pre-chilled 1.5 ml centrifuge tube and incubated on ice for 30 min; then incubated in a 42℃ water bath for 90 seconds and incubated on ice for 2 min; 700 μL of antibiotic-free LB liquid medium was added to a clean bench; the culture was carried out at 37℃ and 220 rpm for 1.5 h; the cultured bacterial solution was centrifuged at 5000 rpm for 3 min, the 700 μL medium was discarded in a clean bench and the culture was resuspended, and the bacterial solution was plated on solid LB medium containing 50 mg / L kanamycin sulfate (Kan) resistance; the culture was inverted at 37℃ for 24 h, and single colonies were selected and sequenced by Qingke Company to verify the correctness of the inserted sequence, yielding the overexpression vector 1305-35S-GmARFA1a-GFP.

[0027] 2.3 Steps for obtaining transgenic Arabidopsis thaliana through overexpression Add 1 μL of successfully sequenced plasmid to 100 μL of Agrobacterium competent cells (GV3101) (Coollab, catalog number: CC405). After gently tapping, place the mixture on ice for 5 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min. Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C and 220 rpm for 2 hours. After centrifugation, discard the excess medium and reselect. Spread the bacterial culture on YEP solid medium containing 50 mg / L kanamycin sulfate (Kan) and 50 mg / L rifampin (Rif). Invert the medium and incubate at 28°C for 48 hours. Single colonies were picked up with a pipette tip and colony PCR was performed according to the amplification system in Table 6 [PCR primers were ARF-JC-6F: GTCACCACTATCCCCACCAT (SEQ ID No. 9), ARF-JC-6R: TAGAAAGCCAGTCCAAACCC (SEQ ID No. 10)]. A bacterial culture with a product fragment size of approximately 397 bp was selected, and an equal volume of 50% glycerol was added and stored to obtain recombinant Agrobacterium rhizogenes containing the recombinant expression vector 1305-35S-GmARFA1a-GFP.

[0028] Table 6 Amplification Mixture

[0029] After identification, Agrobacterium tumefaciens with the correct band size was inoculated into 1 ml of LB broth containing 50 mg / L kanamycin sulfate (Kan) and 50 mg / L rifampin (Rif). After incubation overnight at 28°C and 220 rpm, the inoculated bacteria were transferred to 100 ml of LB broth containing 50 mg / L kanamycin sulfate (Kan) and 50 mg / L rifampin (Rif) and cultured until OD (Organic Depth). 600 Values ​​are between 0.6 and 1.2; select healthy Arabidopsis thaliana plants aged 4-6 weeks, and cut off the open flowers and pods for later use.

[0030] The cultured Agrobacterium tumefaciens was centrifuged at 4000 rpm for 10 min, the culture medium was discarded, and the culture was resuspended in the infection solution (the preparation of the infection solution can be found in the literature: Xu Hongmei, Zhang Lijun, Liu Chun. Study on Agrobacterium tumefaciens infection of Arabidopsis thaliana by flower dipping method [J]. Northern Horticulture, 2010(14):4.DOI:CNKI:SUN:BFYY.0.2010-14-059.) so that the OD600 of the resuspended infection solution is between 0.8 and 1.0.

[0031] Immerse the inflorescences of Arabidopsis thaliana plants in Agrobacterium resuspension for 30-60 seconds. After immersion, gently wipe away excess bacterial solution, cover the plants with a plastic cover to maintain humidity, and incubate in the dark for 24 hours. Harvest the seeds after they mature and dry.

[0032] The harvested T1 generation seeds were planted on 1 / 2 MS medium (Regen Biosciences, catalog number: CM0511) containing 20 mg / L termetidine (Tim) and 15 mg / L glyphosate and grown for one week. Seedlings that could normally extend two leaves were transplanted into soil for further cultivation. Leaves were collected after three weeks, and DNA was extracted using the CTAB method for identification. Seedlings that identified positive results were retained for further cultivation and individual seed harvesting until the T3 generation to obtain homozygous transgenic lines. RNA was extracted from leaves, reverse-engineered, and its expression level was measured.

[0033] 2.4 Study on the regulation of salt tolerance in Arabidopsis thaliana by GmARFA1a The expression level of GmARFA1a in the leaves of three homozygous lines was detected and treated with different NaCl concentrations. The growth status (main root length, number of lateral roots, fresh weight of aboveground parts, fresh weight of underground parts, chlorophyll content) and stress indicators (MDA content, POD activity, SOD activity) of Arabidopsis were measured.

[0034] (1) Determination of growth indicators of Arabidopsis thaliana The transcriptional level of GmARFA1a was detected in the T3 homozygous Arabidopsis thaliana lines OE5, OE6, and OE15 overexpressing GmARFA1a, as well as the wild-type line WT of the Columbia ecotype Arabidopsis thaliana, with the wild-type line serving as a negative control. The results showed that all three T3 homozygous Arabidopsis thaliana lines were overexpressing GmARFA1a. Figure 2 (A)). The GmARFA1a overexpressing T3 generation homozygous Arabidopsis thaliana line (experimental group) and the wild-type Arabidopsis thaliana line WT (control group) were transferred together to 1 / 2 MS solid medium and cultured for 4 days, then transferred to solid medium containing different concentrations of NaCl and cultured for another 7 days. Phenotypic observations were performed on the three selected transgenic lines and WT. It was found that in the NaCl-free medium, there was no significant difference in growth between the overexpressing lines and the wild type. However, when the medium contained 50 mM NaCl, the growth of OE6 and OE15 was worse than that of WT. When the NaCl concentration in the medium increased to 75 mM, OE6 showed the worst growth, followed by OE15 and OE5, while WT showed the best growth. Figure 2 (B)). Before sowing, Arabidopsis seeds were vernalized for two days at 4°C in 1.5 ml centrifuge tubes containing 1 mL of sterile ddH2O. After sowing in 1 / 2 MS medium for 4 days, they were transferred to 1 / 2 MS medium containing 0 / 50 / 75 mM NaCl for 7 days. The length of the taproot was then measured. Figure 3 (A) in the middle), number of lateral roots ( Figure 3 (B) of the aboveground parts, fresh weight of the aboveground parts ( Figure 3 (C) of the middle part, fresh weight of the underground part ( Figure 3 (D) and chlorophyll content ( Figure 3 (E)). Root length and lateral root number were measured in Arabidopsis thaliana after 7 days of salt treatment. When the NaCl concentration in the culture medium was 0 mM, the taproot length of OE5 was not significantly different from that of the wild type, but the taproot lengths of OE6 and OE15 were significantly shorter than those of WT. The number of lateral roots of OE5 was not significantly different from that of WT, but the number of lateral roots of OE6 and OE15 was significantly greater than that of WT and OE5. When the NaCl concentration increased to 50 mM, the taproot lengths of OE5, OE6, and OE15 were all significantly shorter than those of the wild type, and the number of lateral roots of the three homozygous lines was significantly less than that of WT. When the NaCl concentration increased to 75 mM, only OE15 showed a significant difference in taproot length compared to the wild type; however, the number of lateral roots of the three homozygous lines was still significantly less than that of the wild type. In addition, the fresh weight of the aboveground and belowground parts of the overexpression lines and the wild type were measured. The results showed that when the culture medium did not contain NaCl, there was no difference in the fresh weight of the aboveground or underground parts between the overexpression lines and the wild type. However, when the NaCl concentration in the culture medium was 50 mM, the fresh weight of both the aboveground and underground parts of the three overexpression lines was lower than that of the wild type. 75 mM NaCl also inhibited the fresh weight of both the aboveground and underground parts of the three overexpression lines.

[0035] (2) Determination of salt stress response index The MDA content, POD activity, and SOD activity of wild-type (control) and overexpression lines were determined using a malondialdehyde (MDA) kit (Adison, catalog number: ADS-F-YH002), a peroxidase (POD) kit (Adison, catalog number: ADS-F-KY003), and a superoxide dismutase (SOD) kit-NBT method (Adison, catalog number: ADS-F-KY001).

[0036] MDA is a product of membrane lipid peroxidation in plant tissues or organs under senescence or damage conditions, and is positively correlated with the degree of plant senescence or damage. Without additional NaCl in the culture medium, there was no significant difference in MDA content between wild-type and overexpression lines. When 50 mM NaCl was added, the MDA content in all three overexpression lines was higher than that in the wild type, with the MDA content of OE5, OE6, and OE15 increasing sequentially, among which OE5 and OE15 showed a significant difference. When the culture medium contained 75 mM NaCl, the changes in the four lines were similar to those with 50 mM NaCl, with WT having the lowest MDA content, followed by OE5, OE6, and OE15, and significant differences were observed among the four lines. Figure 4(A)). The analysis of MDA content showed that salt stress significantly damaged all four lines, and the overexpression lines were more severely damaged than the wild type; and OE15 was the most severely stressed of the three lines. POD is an important oxidoreductase in plant bodies, and its activity is closely related to plant resistance. At 0 mM NaCl, there was no significant difference in POD activity between the wild type and the overexpression lines; at 50 mM NaCl, the POD activity of WT was significantly higher than that of OE6, and at 75 mM, the POD activity of WT plants was significantly higher than that of the overexpression lines, but there was no significant difference among the three overexpression lines. Figure 4 (B)). SOD activity is positively correlated with plant anti-aging and stress resistance. At 0 mM NaCl, there was no significant difference in SOD activity between wild-type and overexpression lines. When the salt concentration increased to 50 mM, the SOD activity of wild-type was significantly higher than that of the three overexpression lines. At 75 mM NaCl, the results were similar. Figure 4 (C)). Soil culture with salt treatment showed that under 300 mM salt treatment, wild-type leaves turned purple, and overexpressing plants exhibited severe bleaching. Figure 5 The combined results indicate that Arabidopsis thaliana heterologously overexpressing GmARFA1a was more severely stressed than the wild type under the same NaCl treatment.

[0037] Example 3: Obtaining Transgenic Roots and Studying Their Salt Tolerance To clarify the role of GmARFA1a in soybean, we constructed an interference vector and 1305-35S-GmARFA1a-GFP (overexpression), and transformed them with Agrobacterium rhizogenes K599 for transgenic root construction and salt stress phenotype observation.

[0038] 3.1 Construction of GmARFA1a interference vector Using the 1305-35S-GmARFA1-GFP plasmid as a template, amplification was performed using the following primers: UBQ10-RNAI-ARF1a / b-KPNI-F1: CTACCGTGATCAAGGGTACCATGGGGTTGTCGTTCACGAA (SEQ ID No. 11), UBQ10-RNAI-ARF1a / b-KPNI-R1: GAGCTCAGGCCTGGTACCCTATCATTGCTATCAACCAC (SEQ ID No. 12); UBQ10-RNAI-ARF1a / b-MLUI-F2: GGTGCAGGTGGAAGACGCGTCTATCATTGCTATCAACCAC (SEQ ID No. 13), UBQ10-RNAI-ARF1a / b-MLUI-R2: GTCGACTACGTAACGCGTATGGGGTTGTCGTTCACGAA (SEQ ID No. 14).

[0039] The fragment amplification process was identical to 2.2, except for the primers and template. Products of the expected size were purified and recovered. The pCAMBIA1390 vector was digested with Asc I, and the synthesized sequence (SEQ ID No. 15) was inserted to complete the 1390-GFP-UBQ10-rnai vector (plasmid map shown). Figure 7 Construction. The recovered product was ligated into the Kpn I linearized 1390-GFP-UBQ10-rnai vector, using the same ligation system as in 2.2. Fragment 1, amplified from UBQ10-RNAI-ARF1a / b-KPNI-F1 / R1, was ligated into the linearized vector, using the same ligation system as in 2.2. The ligation product was transformed into E. coli and sequenced by a company. The correctly sequenced plasmid was digested with MluI, and then ligated into the product amplified and purified from UBQ10-RNAI-ARF1a / b-MLUI-F2 / R2, using the same ligation system as in 2.2. Transformation and sequencing of the ligation product were performed as above. The successfully sequenced plasmid was transformed into Agrobacterium rhizogenes K599 using the same transformation method as in 2.3.

[0040] 3.2 Obtaining and Identifying Transgenic Roots Select healthy and plump Tianlong No. 1 seeds and sow them in nutrient soil (nutrient soil: vermiculite: perlite ratio of 3:1:1). Incubate at 24℃ for 6 days with 16 hours of light followed by 6 hours of darkness. Inoculate the verified Agrobacterium onto LB solid medium containing 50 mg / L kanamycin sulfate (Kan) and 50 mg / L streptomycin (Str), and incubate at 28℃ for 2 days. Resuspend the single colony in 1 mL of LB liquid medium containing 15% (v / v) glycerol, and then spread 200 μL of the bacterial suspension onto the surface of a fresh LB solid medium containing 50 mg / L kanamycin sulfate (Kan) and 50 mg / L streptomycin (Str), and continue incubating at 28℃ for 2 days. After 2 days, collect the Agrobacterium colonies and use a 1 mL syringe to pick up a small amount of bacteria, inserting it 1 cm below the soybean cotyledon, ensuring the needle penetrates the center of the hypocotyl. After infection, the seedlings were placed in a long-day culture room for approximately 15 days, during which time they were covered with disposable cups to maintain humidity. When the aerial roots grew to 3-5 cm, the taproot was removed 1 cm below the infected site, and the plants were transferred to 1 / 2 modified Hoagland nutrient solution (same as 1.1) for further culture. Positive roots were detected under an excitation light source, and only roots exhibiting green fluorescence were retained. Root samples were taken from the transgenic soybean roots, RNA was extracted, reversed into cDNA, and the expression level of GmARFA1a was detected using the same method as in 1.2.

[0041] The results of GmARFA1a expression level measurement showed that, compared with GFP roots (control), the expression level of GmARFA1a in the interference root system (RNAi-GmARFA1a) was significantly downregulated, while the expression level in the overexpression root system (OE-GmARFA1a) was significantly increased. Figure 6 (A) in the middle.

[0042] 3.3 Salt treatment and stress index determination of soybean hairy root transformed chimeric plants (i.e., GFP root plants + interference root plants + overexpression root plants) (1) After the soybean root chimera plants recovered growth, plants with uniform growth were selected and transferred to a 1 / 2 modified Hogland nutrient solution containing 100 mM NaCl (same as 1.1) for salt treatment. The control group was a 1 / 2 modified Hogland nutrient solution without NaCl (same as 1.1). (2) Four days after treatment, samples were taken from the same location of each composite plant. After sampling, the samples were quick-frozen in liquid nitrogen and stored in a -80℃ freezer for subsequent physiological and biochemical index determination.

[0043] At 0 mM NaCl, the aboveground parts of the interfering root plants and overexpressing root plants were not significantly different from those of the GFP root plants. In the chimeric plants treated with 100 mM NaCl, the aboveground parts of the overexpressing root plants were significantly wilted compared to the GFP root plants, while the interfering root plants showed good growth. Figure 6 (B)). Root samples were taken four days after treatment to measure stress-related indicators (MDA, POD, SOD), using the same method as in 2.4.

[0044] The results of MDA content and POD activity showed that when NaCl concentration was 0 mM, there was no significant difference between the overexpressing and interfering root systems and the GFP root system, but the SOD activity of the interfering root system was significantly lower than that of the GFP root system. When the NaCl concentration was 100 mM, the MDA content of the interfering root system was significantly higher than that of the GFP and overexpressing root systems, while the POD and SOD activities were significantly lower than those of the GFP and overexpressing root systems. Figure 6 (C)). The overall results showed that interfering with GmARFA1a significantly reduced its expression in soybean roots, which significantly improved the plant's salt tolerance; while overexpression of GmARFA1a in roots significantly reduced its salt tolerance.

[0045] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications are possible without departing from the technical solutions described in the claims.

[0046] Genome sequence: CDS sequence: ATGGGGTTGTCGTTCACGAAGCTGTTCAGCAGGTTGTTTGCGAAGAAGGAAATGAGGATTCTGATGGTAGGTCTCGATGCTGCTGGTAAGACAACCATCTTGTACAAGCTCAAGCTTGGAGAAATCGTCACCACTATCCCCACCATCGGATTTAATGTTGAGACTGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGATGTTGGTGGTCAGGACAAGATCCGTCCACTGTGGAGGCATTATTTCCAGAACACTCAGGGTCTCATTTTTGTGGTTGATAGCAATGATAGAGATCGAGTGGTTGAGGCAAGGGATGAGCTGCACAGAATGTTGAATGAGGATGAACTTAGAGATGCTGTTTTGCTTGTTTTTGCCAACAAGCAAGATCTTCCTAATGCAATGAATGCTGCAGAAATAACTGACAAGCTTGGACTTCATTCACTCCGTCAACGCCACTGGTATATCCAGAGCACTTGTGCAACTTCTGGAGAGGGTCTCTATGAGGGTTTGGACTGGCTTTCTAACAACATTGCCAGCAAAGCATGA (SEQ ID No. 2); Inserted synthetic sequence:

Claims

1. A method for improving soybean salt tolerance based on the GmARFA1a gene, characterized in that, By downregulating the expression level of the GmARFA1a gene in soybeans, the salt tolerance of soybeans can be improved, and soybean plants with improved salt tolerance can be obtained; the sequence of the GmARFA1a gene is shown in SEQ ID No.

1.

2. The method according to claim 1, characterized in that, The expression level of the GmARFA1a gene in soybean was downregulated by interfering with or knocking out the GmARFA1a gene.

3. The application of the GmARFA1a gene as a target for regulating soybean salt tolerance is characterized by, The sequence of the GmARFA1a gene is shown in SEQ ID No.

1.

4. The application according to claim 3, characterized in that, The GmARFA1a gene negatively regulates soybean salt tolerance.

Images