A method for transferring a foreign nucleic acid fragment into a plant using a plant virus

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a method for transferring an exogenous nucleic acid fragment into a plant by using a plant virus. The application aims to provide a new method which can be applied to transferring an exogenous fragment into a plant. The technical scheme of the application is a method for transferring an exogenous nucleic acid fragment into a plant by using a plant virus, comprising the following steps: fusing the exogenous nucleic acid fragment to an infectious clone vector pLX-TVMV of a wild type TVMV virus to obtain an expression vector, and transforming a plant; the insertion site of the exogenous nucleic acid fragment is a 3' non-coding RNA region of the TVMV virus; the pLX-TVMV is shown in SEQ ID NO. 16. The application discloses that an exogenous coding sequence is inserted into a 3' non-coding RNA region of a TVMVwt to construct an infectious clone vector, the infectious clone vector is transferred into a plant, and expression of the exogenous coding sequence is realized.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a method for transferring exogenous nucleic acid fragments into plants using plant viruses. Background Technology

[0002] As absolute intracellular parasites that strictly rely on host cells for replication, traditional genetic research on viruses has long been limited by the inability to culture them in vitro and directly manipulate their genes. Breakthroughs in infectious cloning technology, especially the efficient construction systems for RNA viruses, have completely changed this situation. By reconstructing the viral genome in vitro and achieving the regeneration of infectious particles, reverse genetics technology has been able to systematically analyze viral gene function and its pathogenic network. Infectious cloning vectors have been widely used in many fields, such as viral gene function, pathogenic mechanisms, the use of expression vectors, virus-induced gene silencing (VIGS) for gene function verification, and cross-protection of attenuated strains.

[0003] Infectious cDNA clones (icDNA) refer to the infectious cDNA or in vitro transcripts of RNA viruses that carry complete viral genetic information. The first successfully constructed infectious clone was Brore mosaic virus (BMV), a plant RNA virus. Currently, thanks to the continuous efforts of plant virologists, the efficient construction of infectious clones of various plant RNA viruses has been achieved, laying a technological foundation for research on viral pathogenic mechanisms and disease resistance.

[0004] Early plant virus infectious cloning strategies were based on in vitro transcription systems using prokaryotic promoters. The core process involved inserting the full-length viral genome sequence into a vector containing prokaryotic promoters such as T3 / T7 / SP6, linearizing the vector with restriction endonucleases, and then synthesizing biologically active viral RNA in vitro using RNA polymerase. This technique has significant limitations: (1) stringent technical requirements: it requires high-purity RNA products and is complex to operate, with high dependence on the skills of the experimenters; (2) stability: in vitro transcribed RNA is easily degraded by RNase, requiring strict temperature control and an enzyme-free environment; (3) cost limitations: it relies on expensive in vitro transcription kits and capping modification reagents.

[0005] Currently, the infectious cloning strategy for plant viruses involves constructing the full-length cDNA of a plant virus downstream of the 35S promoter. The viral genome cDNA is inserted into a plant expression vector regulated by eukaryotic promoters such as 35S, and then transferred into host cells via methods such as mechanical friction, Agrobacterium-mediated transformation injection, or gene gun bombardment, expressing complete viral particles with infectious activity. Compared to in vitro transcription systems, this technology has significant advantages: (1) Economy and ease of operation: No in vitro transcription kits or RNA purification steps are required, reducing experimental costs; (2) Improved transcriptional stability: Transcription is completed by endogenous RNA polymerase in the host cell, avoiding the risk of in vitro RNA degradation; (3) Structural optimization and innovation: The dual 35S promoter system enhances transcription efficiency and improves the success rate of virus rescue; (4) Ribozyme sequences with self-cleaving function: Precise generation of the 3' end of the viral genome is key to efficient virus rescue.

[0006] Currently, the construction of infectious viral clones mainly relies on two strategies: seamless cloning (infusion) and double enzyme digestion. Double enzyme digestion first requires homology analysis of the target gene and vector sequences to identify matching restriction enzyme sites for cutting, producing complementary sticky ends or blunt ends. Then, DNA ligase is used to assemble the recombinant plasmid. The limitation of this method is that when the viral genome lacks naturally matching restriction enzyme sites, artificial modifications to the vector or viral sequence are required (such as introducing multiple cloning sites or segmented insertion), significantly increasing the complexity of the operation. In contrast, seamless cloning technology overcomes the restriction of restriction enzyme sites through homologous recombination. Its core process involves designing 15-25 bp homologous arms (perfectly matching the ends of the linearized vector) at both ends of the target fragment. The 3'→5' exonuclease activity of Infusion recombinase is used to digest the ends of the linear vector and the inserted fragment, forming complementary single-stranded DNA. Then, the enzyme's inherent ligation activity achieves precise recombination. This technology eliminates the need for additional restriction enzyme sites and allows for the construction of recombinant plasmids in a single step, significantly simplifying the experimental process. It is particularly suitable for the efficient cloning of large viral genome fragments (such as multi-component viruses).

[0007] With the continuous advancement of molecular virology techniques, especially the increasingly diversified methods and strategies for constructing infectious clones of RNA viruses, researchers still face specific technical challenges when developing cloning systems for different viral systems due to the significant specificities in the genome structure, replication mechanism, and host interaction patterns of RNA viruses. For example, in the case of Potato Virus Y (PVY), unexpected recombination events often occur during the transformation of its full-length genome cDNA clone or in vitro transcript into *E. coli*. Studies have shown that such recombination may originate from the activation of the host repair system by toxic proteins produced by viral genome expression in *E. coli*, leading to abnormal recombination (such as spontaneous deletion or inversion of inserted sequences). This phenomenon not only reduces clonal fidelity but may also interfere with subsequent viral infectivity, highlighting the inherent limitations of prokaryotic expression systems in the construction of complex RNA virus clones. In related research, Zhao Guangyuan et al. cleverly utilized a yeast homologous recombination system to successfully obtain an infectious clone of Papaya ringspot virus (PRSV), opening up new avenues for research in this field.

[0008] There are no reports in the existing technology of using the infectious cloning vector of Tobacco vein mottling virus (TVMV) to carry exogenous fragments into plants. Summary of the Invention

[0009] The technical problem to be solved by the present invention is to provide a new method that can be applied to the transfer of exogenous fragments into plants.

[0010] The technical solution of this invention is a method for transferring exogenous nucleic acid fragments into plants using plant viruses. The method is characterized by: fusing the exogenous nucleic acid fragment into the infectious cloning vector pLX-TVMV of wild-type TVMV virus to obtain an expression vector, which is then transformed into plants; the insertion site of the exogenous nucleic acid fragment is the 3' non-coding RNA region of the TVMV virus; the pLX-TVMV is shown in SEQ ID NO. 16. Further, the backbone vector pLX of pLX-TVMV is provided by Pasin F, and can be found in this article: Pasin F, Tseng XA, Bedoya LC, Heydarnejad J, Deng TC, García JA, et al. Streamlined generation of plant virus infectious clones using the pLX minibinary vectors. J Virol Methods. 2018;262:48-55. [PubMed: 30236898].

[0011] Specifically, the insertion site of the exogenous nucleic acid fragment is position 10440 or 10441 of SEQ ID NO.16.

[0012] Specifically, the exogenous nucleic acid fragment is amiR-Su, PDS50, PDS100, CHLI100, or FR2.

[0013] Furthermore, the nucleotide sequence of amiR-Su is shown in positions 161-249 of SEQ ID NO.1.

[0014] The nucleotide sequence of the PDS50 is shown in positions 336-385 of SEQ ID NO.2.

[0015] Specifically, the nucleotide sequence of the PDS100 is shown in positions 336-435 of SEQ ID NO.3.

[0016] The nucleotide sequence of CHLI100 is shown in positions 336-435 of SEQ ID NO.4.

[0017] Furthermore, the nucleotide sequence of FR2 is shown in positions 337-385 of SEQ ID NO.5.

[0018] Preferably, the plant is tobacco.

[0019] Specifically, the procedure is converted to injection.

[0020] SEQ ID NO.1, T-NbSu; 1~125 nt is TVMV CP, 126~160 nt is TVMV3'UTR, 161~249 nt is amiR-Su, 250~466 nt is TVMV3'UTR, 467~565 nt is pLX vector; Gcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactagtagagaagaatctgtataaccgtggtggacttcccgccgaaatcaaactgcgggaagtcaaccacggttacattggctcttcttactagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcccatttttatcatttctgatggtaaacattcaagtaagtttgcgcaataaatatatgtacttcctactattctatgattagattttcaacaaagcgaggagtacctccgttgtgatctagtcatcttatactgtcggagaaaaaaaaaaaaaaaaaaaaaaaaaatgcatgcctgcagatcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtcttgcga.

[0021] SEQ ID NO. 2, T-NbPDS50; nucleotides 1 to 300 are TVMV CP, nucleotides 301 to 335 are TVMV 3'UTR, nucleotides 336 to 385 are PDS50, and nucleotides 386 to 464 are TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaatggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactgggtgcaaataccaattccaacatagactgattggggttgtaatattcctagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc。

[0022] SEQ ID NO. 3, T-NbPDS100; nucleotides 1-300 are TVMV CP, nucleotides 301-335 are TVMV 3'UTR, nucleotides 336-435 are PDS100, nucleotides 436-514 are TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaatggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactattgtagcatcaataatttctgagtcactacgatttatccactcttctgcgggtgcaaataccaattccaacatagactgattggggttgtaatattcctagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc。

[0023] SEQ ID NO. 4, T-NbCHLI100; 1~300 nt is TVMV CP, 301~335 nt is TVMV 3'UTR, 336~435 nt is CHLI100, 436~514 nt is TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaatggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaacacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatatactctctcagctctgcatctctcacggtccccacttgggcatgcattccaaatcgatcaagaagttgtggcctaagttctccttcttcaggattacccgaaccagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc。

[0024] SEQ ID NO. 5, T-FR2; nt 1 to 300 is TVMV CP, nt 301 to 336 is TVMV 3'UTR, nt 337 to 385 is FR2, nt 386 to 465 is TVMV 3'UTR; gaggcttacataaggatgaggaattcagaacaggtctacatacccaggtatggcctgcagcgcggattagtagacagaaacctggcaccgtttgcctttgacttctttgaggttaa tggggcaacaccagtccgggcaagagaagcgcatgcacaaatgaaggcggccgcactccgcaattcgcagcagcgcatgttttgtctggatggcagcgtgtcagggcaagaagagaa cacagaacgccatactgttgacgatgttaatgctcaaatgcaccaccttctgggtgttaagggggtgtaagtatggattatatatataattatatatactggagacggtcgggt ccagatattcgtatctgtcgagtagagtgtgggctccagtaatgttttctacttgttaaaactcttttagttacatatagcgtatctactcgcatttgtccaaacttctacttgcc.

[0025] The beneficial effects of this invention are as follows: This invention discloses the construction of an infectious cloning vector by inserting a foreign coding sequence into the 3' non-coding RNA region of TVMVwt (positions 10440 or 10441 on pLX-TVMV). Transforming this vector into plants did not inactivate the TVMV virus, and the foreign nucleic acid fragment could be successfully expressed. This infectious cloning vector can utilize the TVMV virus to express the foreign nucleic acid fragment in plants, and expression can be performed throughout the entire plant. The expression level of the foreign nucleic acid fragment is increased, the expression cycle is short, and no transgenic treatment is required. This invention demonstrates that foreign nucleic acid fragments can be integrated into plants and expressed using a viral vector. This invention provides a new method applicable to the transformation of foreign fragments into plants. In particular, this invention uses the TVMV virus infectious clone pLX-TVMV carrying FR2 for expression in plants. Using a LUYOP-3104 Hand-Held UV Lamp instrument, when irradiated with a light source of 472-507 nm, a significant green fluorescence of the TVMVFR2 virus particles can be observed, thus enabling the detection of plant viruses through fluorescence. Attached Figure Description

[0026] Figure 1 illustrates a one-step assembly cloning strategy for constructing an infectious clone from a tobacco vein mottle virus using nucleic acid sequences. Using the pLX-TVMV (TVMVwt) infectious clone as a template, two cDNA fragments spanning the TVMV genome and the pLX backbone were assembled, including the insert fragment. (Orange and green arrows indicate the PCR primers used.)

[0027] Figure 2 A. Amplification and verification diagram of the insertion sequence of the 3' non-coding RNA of TVMVwt; B. TVMV viral genome structure; C. Inserted sequences: TVMVSu, TVMVPDS50, TVMVPDS100, TVMVCHLI100, and TVMVFR2.

[0028] Figure 3 A. Amplification and verification diagrams during the construction of an infectious TVMVSu clone; B. Amplification of the target fragment of T-NbSu-1; C. Amplification of the background fragment of the TVMVSu vector; D. TVMVSu bacterial culture PCR;

[0029] Figure 4 Amplification and validation diagrams of the invasive clones TVMVPDS50, TVMVPDS100, and TVMVCHLI100 are constructed. A. Amplification of the target fragments of TVMVPDS50, TVMVPDS100, and TVMVCHLI100; B. Amplification of the background fragments of the vectors of TVMVPDS50, TVMVPDS100, and TVMVCHLI100; C. TVMVPDS50 bacterial culture PCR; D. TVMVPDS100 bacterial culture PCR; E. TVMVCHLI100 bacterial culture PCR.

[0030] Figure 5 Sequencing diagrams of invasive clones of TVMVPDS50, TVMVPDS100, and TVMVCHLI100; A. Sequencing results of TVMVPDS50; B. Sequencing results of TVMVPDS100; C. Sequencing results of TVMVCHLI100.

[0031] Figure 6The following graphs show the detection of invasive clone symptoms and viral accumulation of the mutant virus: A. Infection symptoms 9 days after inoculation with TVMVwt, TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100; B. Viral accumulation 9 days after inoculation with Western blotting; C. Infection symptoms 30 days after inoculation with TVMVwt, TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100; D. Viral accumulation 30 days after inoculation with Western blotting. The antibody used was anti-TVMV CP, and the internal control was the Rubisco protein band. The numbers represent the quantitative analysis of the band signals.

[0032] Figure 7 Figure 1 shows the RT-PCR and sequencing identification of the infectious clones TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100 9 days after inoculation into plants; A. RT-PCR amplification fragment of TVMVSu; B. RT-PCR amplification fragment of TVMVPDS50, TVMVPDS100, and TVMVCHLI100.

[0033] Figure 8 A. Amplification and validation diagram of the TVMVFR2 infectious clone; B. Amplification of the TVMVFR2 insert fragment; C. TVMVFR2 bacterial culture PCR; D. TVMVFR2 sequencing peak diagram.

[0034] Figure 9 The following graphs show the symptoms and viral accumulation of the TVMVFR2 invasive clone: ​​A. Infection symptoms 9 days after TVMVwt and TVMVFR2 inoculation; B. Viral accumulation detected by Western blotting; C. Infection symptoms 30 days after TVMVwt and TVMVFR2 inoculation; D. Viral accumulation detected by Western blotting at 30 days. The antibody used was anti-CP, and the internal control was the Rubisco protein band.

[0035] Figure 10 A. Detection of TVMVFR2 binding to fluorescent dye DFHBI-1T; B. TVMVwt and TVMVFR2 virus particles binding to fluorescent dye DFHBI-1T and imaging under a fluorescent stereomicroscope; C. Quantification of fluorescence signal intensity.

[0036] Figure 11 Sequencing results of the RT-PCR amplified fragment of TVMVSu.

[0037] Figure 12 Sequencing results of the RT-PCR amplified fragment of TVMVPDS50.

[0038] Figure 13 Sequencing results of the RT-PCR amplified fragment of TVMVPDS100.

[0039] Figure 14 Sequencing results of the RT-PCR amplified fragment of TVMVCHLI100. Detailed Implementation

[0040] Generally, inserting foreign nucleic acid fragments into the 3' untranslated region presents numerous challenges. For example, the insertion may inactivate the virus, and the size of the inserted fragment can drastically affect the virus, such as interfering with the structural integrity, functional elements, and critical life cycle steps (e.g., replication, packaging, and assembly) of the viral genome. However, while this invention does affect viral infection to some extent, it does not render the virus inactive, and the foreign nucleic acid fragment can still be successfully expressed. The applicant has also attempted to construct an expression vector by inserting a foreign nucleic acid fragment into the 3' untranslated region of the TVMV virus.

[0041] This invention uses the wild-type TVMV virus infectious cloning vector pLX-TVMV as a basis and selects amiR-Su, PDS50, PDS100, CHLI, and FR2 as exogenous fragments to construct expression vectors. Exogenous nucleic acid fragments are inserted at position 10440 or 10441 of the 3' untranslated region of the pLX-TVMV virus to construct plant infectious cloning vectors. After transformation into plants, TVMV virus inactivation was not induced, and the exogenous nucleic acid fragments were successfully expressed. This invention successfully verifies that TVMV virus infectious cloning vectors can be used to carry exogenous nucleic acid fragments (amiR-Su, PDS50, PDS100, CHLI, and FR2) into plants and achieve successful expression.

[0042] The amiR-Su sequence is derived from Appendix S3 of the supplementary figure data in the article doi: 10.1093 / nar / gkad747. This sequence is from *Nicotiana benthamiana* and is a partial sequence. The reason for selecting this sequence is that microRNAs are widely used in plants, but their production is limited by the in vivo generation of amiRNAs from the primary miRNA (pri-miRNA) precursor expressed by transgenes. To overcome this limitation, Cisneros et al. analyzed AtMIR390a-pri-miRNA in *Arabidopsis thaliana* and screened a large number of endogenous amiRNAs in *Nicotiana benthamiana*. They found that only an 89 nt chimeric precursor could produce an efficiently and precisely processed amiR-Su (89 bp), and silencing amiR-Su could induce albinism in *Nicotiana benthamiana*.

[0043] The sequence of PDS (full name: phytopene dehydrogenase gene) is from GenBank: AY484445.1, and the species is potato; PDS50 and PDS100 are partial sequences of the phytopene dehydrogenase gene. The reason for selecting this sequence is that the silencing of the PDS gene will produce a photobleaching phenotype, so it is often used as a reference gene in virus-induced gene silencing systems.

[0044] The sequence of CHLI (full name: magnesium ion chelate enzyme) is derived from NCBI Reference Sequence: XM_016604918.1, and the species is common tobacco. CHLI100 is a partial sequence of magnesium ion chelate enzyme. The reason for selecting this sequence is that silencing the CHLI gene can lead to the inhibition of chlorophyll synthesis in plants, thus exhibiting an albinism phenotype.

[0045] The FR2 sequence, sourced from GenBank: PV759412.1, is a synthetically produced broccoli fluorescent aptamer for cloning. This sequence was chosen because it is a small, structurally stable RNA fluorescent aptamer with a high fluorescence signal-to-noise ratio, capable of stable expression in cells. The DFHBI dye emits green fluorescence when it binds to the FR2 aptamer.

[0046] The nucleotide sequences of SEQ ID NO. 1-5 in this invention were synthesized by Platinum Biotech (Shanghai) Co., Ltd.

[0047] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0048] The main reagents used in the following examples are as follows: Potassium chloride, calcium chloride (CaCl2·2H2O), glycerol, methanol, sodium chloride, isopropanol, n-butanol, chloroform, and hydrochloric acid were all domestically produced analytical grade. The 2×Phanta Flash Master Mix (Dye Plus) (part number P520) and Loading Buffer (part number P022-01-AA) were purchased from Novizan. The DNA agarose gel recovery kit (catalog number PEG00-01) and Trizol (catalog number NG303M) were purchased from Huiling. The manufacturer of TaKaRa LA Taq® (catalog number RR002A) and DH5α competent cells (catalog number 9057) is TaKaRa; The manufacturer of DFHBI-1T (product number 1539318-36-9) is Andy Biotechnology; The supplier of agarose (item number AG0100) and nucleic acid dye (item number GD001) is Aivilebo Biotechnology. The following products were purchased from Coollabo: Tris(t) (Catalog No. CT11411), Dithiothreitol(DTT) (Catalog No. CD4941), Sodium Dodecyl Sulfate(SDS) (Catalog No. CS9701), Kanamycin(Kan) (Catalog No. CK6731), PEG6000(Catalog No. CP311234100), Dimethyl Sulfoxide(DMSO) (Catalog No. 4731), Tetramethylethylenediamine(TEMED) (Catalog No. CT10881), Tryptone(Catalog No. CT34152510), Tween-20(Catalog No. C111551), and Yeast Extract Powder(Catalog No. CY321217100). The protein marker (item number 180-6006) was purchased from Tianneng. The manufacturer of the bromophenol blue (item number 115-39-9) was Thermo Fisher Scientific. The skim milk powder (item number 17757), disodium hydrogen phosphate (Na2HPO4) (item number S818118) and sodium dihydrogen phosphate (NaH2PO4) (item number S817780) were purchased from Maclean's. The purchaser of TAE (item number T1060) and Rif (item number R8011) is Solarbio. The 1kb plus DNA Ladder (item number L1000P) was purchased from Lab. The colorimetric solution (catalog number 10026384), PVDF membrane (catalog number 1620177), and 12% stain-free gel preparation kit (catalog number 1610185) were purchased from Bio-Rad Laboratories. The manufacturer that purchased B610003 (item number G218KA4639) is Sangon. The plasmid miniprep kit (catalog number A0229A) was purchased from Tiangen. The manufacturer of β-mercaptoethanol (product number MB0338) was BIO BASIC INC. The ammonium persulfate (APS) (item number 248614) was purchased from Sigma. The manufacturer of Goat Anti Rabbit IgG H&L (HRP) (product number AB205718) is Abcam; The Evo M-MLV RT Mix Kit with gDNA Clean for qPCR Ver.2 (catalog number AG11615) was purchased from Akerui. The Anti-TVMV CP antibody and C58C1 competent cells (catalog number SpainJuan Antonio Garcia's lab) were purchased from the National Center for Biotechnology, Spain.

[0049] Example 1: Construction of an infectious cloning vector According to cloning requirements, the inserted gene sequence fragment is synthesized and inserted into a T vector to obtain a plasmid vector. Using the plasmid DNA sequence as a template, the inserted fragment is amplified. Using the wild-type TVMV virus infectious clone pLX-TVMV as a template, the vector background fragment is amplified. Homologous recombination is performed using a one-step Gibson assembler to ligate the two fragments, obtaining a mutant infectious clone. Figure 1 The pLX-TVMV (SEQ ID NO.16) viral infectious clone uses pLX as a backbone vector and carries wild-type TVMV virus. The infectious cloning vector of this invention carrying exogenous nucleic acid fragments still uses pLX as a backbone vector, but the exogenous nucleic acid fragments are fused only to the 3' uncoding region of the wild-type TVMV virus.

[0050] SEQ ID NO.16, pLX-TVMV:

[0051] Based on the TVMVwt genome structure ( Figure 2 A), and based on previously reported molecules or genes associated with plant leaf bleaching, the sequences amiR-Su (89 bp), PDS (50 bp, 100 bp), CHLI (100 bp), and FR2 (49 bp) were inserted into the 3' non-coding region of TVMVwt. Figure 2 B), construct and obtain the viral infectious clones, namely TVMVSu, TVMVPDS50, TVMVPDS100, TVMVCHLI100 and TVMV FR2.

[0052] (1) Obtaining the target fragment of the TVMVSu infectious clonal mutant Primers Nbsu-F / Nbsu-R (synthesized by Shanghai Sangon Biotech Co., Ltd., see Table 1) were designed based on the T-NbSu plasmid DNA sequence to amplify the 565 bp insert fragment, named T-NbSu-1. PCR amplification was performed using TaKaRa LATaq®. PCR reaction system: template (T-NbSu plasmid, SEQ ID NO.1) 0.5 μL, 5 U / μL TaKaRa LA Taq 0.5 μL, 10×LA Taq Buffer II Mg 2+ Add 5 μL of Plus, 8 μL of 2.5 mM dNTP Mixture, 2 μL of Nbsu-F, 2 μL of Nbsu-R, and ddH2O to a final volume of 50 μL. The reaction program was: pre-denaturation at 94 °C for 30 s; denaturation at 98 °C for 10 s; annealing at 60 °C for 65 s, for 30 cycles; extension at 72 °C for 10 min; the PCR product (565 bp T-NbSu-1, SEQ ID NO.1) was stored at 12 °C.

[0053] Primers TVMV-Su-F / TVMV-Su-R (see Table 1) were designed based on the wild-type pLX-TVMV viral infectious clone (Zhao M, García B, Gallo A, et al. Home-made enzymatic premix and Illumina sequencing allow for one-step Gibsonassembly and verification of virus infectious clones[J]. Phytopathol Res,2020, 2:36.) to amplify the vector background fragment (13184 bp), which was named TVMVSu-1. A PCR reaction system was designed using Novizan 2×Phanta Flash Master Mix (DyePlus): template (pLX-TVMV plasmid) 0.5 μL, 2×Phanta Flash Master Mix 25 μL, TVMV-Su-F 2 μL, TVMV-Su-R 2 μL, and ddH2O added to a final volume of 50 μL. The PCR amplification program was as follows: pre-denaturation 98℃, 30 s; denaturation 98℃, 10 s; annealing 60℃, 10 s; extension 72℃, 2 min 10 s, 30 cycles; final extension 72℃, 1 min. The PCR product TVMVSu-1 was stored at 12℃.

[0054] A specific fragment of 565 bp was obtained after separation by 1% agarose gel electrophoresis. Figure 3 A) and a specific fragment of size 13184 bp ( Figure 3 B). The insert fragment T-NbSu-1 and the vector background fragment TVMVSu-1 were ligated in a 15 μL mixture: 5 μL of homemade enzymatic compound, 8 μL of vector background fragment, and 2 μL of insert fragment. The reaction conditions were 50 °C for 1 h. The ligation product was transformed into E. coli DH5α competent cells, and colony PCR was performed using primers Nbsu-F / Nbsu-R to identify a specific fragment of 565 bp. Figure 3 C), after correct sequencing, plasmid was extracted to obtain the correct TVMVSu infectious clone ( Figure 3 D).

[0055] (2) Obtaining the target fragment from the TVMVPDS50, TVMVPDS100 and TVMVCHLI100 infectious clonal mutants Primers PDS / CHLI-F / PDS / CHLI-R (see Table 1) were designed based on the DNA sequences of plasmids T-NbPDS50, T-NbPDS100, and T-NbCHLI100 (i.e., SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4) to amplify the insert fragments 464 bp (T-NbPDS50) and 514 bp (T-NbPDS100 and T-NbCHLI100). Figure 4 A), named PDS50, PDS100, and CHLI100. PCR amplification was performed using TaKaRa LA Taq®. PCR reaction system: template (T-NbPDS50, T-NbPDS100, and T-NbCHLI100 plasmids) 0.5 μL, TaKaRa LA Taq 5 U / μL 0.5 μL, 10×LA Taq Buffer II Mg 2+ Add 5 μL of Plus, 8 μL of 2.5 mM dNTP Mixture, 2 μL of PDS / CHLI-F, 2 μL of PDS / CHLI-R, and bring the ddH2O to 50 μL. The PCR amplification program was as follows: pre-denaturation 98℃, 30 s; denaturation 98℃, 10 s; annealing 50℃, 10 s; extension 72℃, 2 min 10 s, 30 cycles; final extension 72℃, 1 min. PCR products were stored at 12℃.

[0056] Primers TVMV-CHLI PDS-F / TVMV-CHLIPDS-R were designed based on the infectious cloning of wild-type pLX-TVMV virus to amplify the vector background fragment (13247 bp). Figure 4 B), named TVMV-. PCR was performed using Novizan 2×Phanta FlashMaster Mix (DyePlus). The reaction mixture consisted of: template (pLXB-TVMVwt plasmid) 0.5 μL, 2×PhantaFlashMaster Mix 25 μL, TVMV-CHLI PDS-F 2 μL, TVMV-CHLI PDS-R 2 μL, and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: pre-denaturation 98℃, 30 s; denaturation 98℃, 10 s; annealing 55℃, 10 s; extension 72℃, 2 min 10 s, 30 cycles; final extension 72℃, 1 min. The PCR product TVMV- was stored at 12℃.

[0057] PDS50, PDS100, and CHLI100 were ligated to TVMV- using a one-step Gibson assembly enzyme. The ligation products were transformed into E. coli DH5α competent cells, and bacterial colony PCR was performed using primers 2F / 2R. Specific bands of 960 bp and 1010 bp were obtained for TVMV- and TVMV-DS100, respectively. Figure 4 C, Figure 4 D), using PDS / CHLI-F / PDS / CHLI-R primers to amplify TVMVCHLI100 bacterial culture, a band of 514 bp was obtained ( Figure 4 E). Sequencing verification results after plasmid extraction showed that TVMVPDS50, TVMVPDS100, and TVMVCHLI100 were successfully ligated, obtaining correct infectious clones of TVMVPDS50, TVMVPDS100, and TVMVCHLI100. Figure 5 A, Figure 5 B, Figure 5 C).

[0058] (3) Obtaining the target fragment of TVMVFR2 infectious clonal mutant Using PDS / CHLI-F / PDS / CHLI-R as primers and T-FR2 plasmid (SEQ ID NO.5) as a template, a specific fragment of FR2 (465 bp) was amplified. Figure 8 A). PCR amplification was performed using TaKaRa LA Taq®. PCR reaction system: template (T-FR2 plasmid) 0.5 μL, TaKaRa LA Taq 5 U / μL 0.5 μL, 10×LA Taq Buffer II Mg 2+ Add 5 μL of Plus 5 μL, 8 μL of 2.5 mM dNTP Mixture, 2 μL of PDS / CHLI-F, 2 μL of PDS / CHLI-R, and bring the ddH2O to 50 μL. The PCR amplification program was as follows: pre-denaturation 98℃, 30 s; denaturation 98℃, 10 s; annealing 50℃, 10 s; extension 72℃, 2 min 10 s, 30 cycles; final extension 72℃, 1 min. PCR products were stored at 12℃.

[0059] Using TVMV-CHLI PDS-F / TVMV-CHLI PDS-R as primers and pLX-TVMV plasmid as template, a vector fragment of 13253 bp was obtained by PCR amplification. Figure 8B) PCR was performed using Novizan 2×Phanta Flash Master Mix (DyePlus). The reaction mixture consisted of: template (pLX-TVMV plasmid) 0.5 μL, 2×Phanta Flash Master Mix 25 μL, TVMV-CHLI PDS-F 2 μL, TVMV-CHLI PDS-R 2 μL, and ddH2O to a final volume of 50 μL. The PCR amplification program was as follows: pre-denaturation 98℃, 30 s; denaturation 98℃, 10 s; annealing 55℃, 10 s; extension 72℃, 2 min 10 s, 30 cycles; final extension 72℃, 1 min. PCR products were stored at 12℃.

[0060] The FR2 gene was ligated to the vector fragment using a one-step Gibson assembler. The ligation product was transformed into *E. coli* DH5α competent cells. Colony PCR was performed using primers PDS / CHLI-F / PDS / CHLI-R, and a specific band of 465 bp was obtained for TVMVFR2. Figure 8 C), sequencing verification results after plasmid extraction showed that TVMVFR2 ligation was successful, and the correct TVMVFR2 infectious clone was obtained. Figure 8 D).

[0061] Table 1 Primer Sequences .

[0062] SEQ ID NO.17, pLX-TVMV-amiR-Su, the insertion position of amiR-Su on pLX-TVMV is the 10440th position, that is, the 10440th to 10528th positions shown in uppercase letters are the inserted amiR-Su;

[0063] SEQ ID NO.18, pLX-TVMV-PDS50, the insertion position of PDS50 on pLX-TVMV is position 10440, that is, positions 10440 to 10489 as shown in uppercase letters are where PDS50 is inserted:

[0064] SEQ ID NO.19, pLX-TVMV-PDS100, PDS100 is inserted at position 10440 on pLX-TVMV, that is, positions 10440 to 10539 as shown in uppercase letters are where PDS100 is inserted:

[0065] SEQ ID NO.20, pLX-TVMV-CHLI100, CHLI100 is inserted at position 10440 on pLX-TVMV, that is, positions 10440 to 10539 as shown in uppercase letters are where CHLI100 is inserted:

[0066] SEQ ID NO.21, pLX-TVMV-FR2, FR2 is inserted at position 10441 in pLX-TVMV, that is, positions 10441 to 10489 as shown in uppercase letters are where FR2 is inserted:

[0067] Example 2: Transformation of Infectious Clones Infectious clonal plasmids TVMVwt (i.e., pLX-TVMVwt in Example 1), TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100 were transformed into Agrobacterium C58C1 competent cells. The cells were then injected with *N. benthamiana*, with healthy *N. benthamiana* as a control. Viral infection symptoms were observed after 9 days.

[0068] (1) Observation of infection symptoms After injecting the infectious clone into the leaves of *Nicotiana benthamiana*, the symptoms and disease status were observed 9 days after injection. Systemically infected leaves of *Nicotiana benthamiana* were collected and stored at -80℃ for later use.

[0069] (2) Extraction of crude viral protein Approximately 0.2 g of diseased leaf tissue was frozen in liquid nitrogen, ground into powder, and mixed with twice the volume of 5% SDS solution by vortexing until a homogenate was formed. The mixture was then incubated in a boiling water bath at 95°C for 5 min, followed by centrifugation at 4°C and 12,000 rpm for 10 min. 2× protein lysis buffer was mixed with the supernatant at a 1:1 ratio. The mixture was reheated in a boiling water bath at 95°C for 5 min, followed by centrifugation at 4°C and 12,000 rpm for 10 min. The mixture was then stored at -20°C for later use.

[0070] (3) Western blot detection a. Gel preparation: First, prepare the lower separating gel by adding 500 μL of isopropanol or water. After 20 minutes, once the separating gel has solidified, tilt the gel to pour out the isopropanol or water and let it stand at room temperature for 3 minutes. Then, prepare the upper stacking gel by inserting a comb and letting it stand for 1 hour. Remove the comb and set it aside for later use. b. Electrophoresis: Place the prepared gel into the electrophoresis apparatus, add 1×SDS-PAGE electrophoresis buffer, and load 5 μL of protein sample and 2 μL of protein marker. The stacking gel voltage is 90 V, and the separating gel voltage is 120 V. Stop electrophoresis when the bromophenol blue electrophoresis band moves to the bottom of the gel plate. c. Imaging: Observe the protein electrophoresis results in a gel imaging system and take pictures for storage; d. Transfer (wet transfer): Mark the polyvinylidene fluoride (PVDF) membrane. Activate the PVDF membrane with methanol for 20 seconds and then transfer it to the transfer buffer for later use. Soak the filter paper and sponge in the transfer buffer. After removing the protein gel by prying the glass plate, cut off the upper layer of stacking gel. Clamp the membrane in the order of "membrane positive, gel negative" (negative electrode - sponge - filter paper - protein gel - PVDF membrane - filter paper - sponge - positive electrode), insert it into the transfer core, place it in the transfer apparatus, pour in 1×SDS-PAGE transfer buffer, add ice packs to the outer tank for cooling, set the voltage to 60 V, and stop the transfer after 1 h. e. Blocking: Place the membrane in a 5% blocking solution and place it on a decolorizing shaker at 70 rpm for 2-3 hours at room temperature. After blocking, wash the membrane 2-3 times in 1×TBST solution to remove excess skim milk powder; f. Primary antibody incubation: Place the membrane in primary antibody diluted in 1×TBST solution (TVMV CP primary antibody dilution ratio is 1:100000, PVY CP primary antibody dilution ratio is 1:5000), and incubate overnight at 4℃ or at room temperature for 1 h; remove the membrane, place it in 1×TBST solution on a decolorizing shaker at 70 rpm, and wash 3 times for 10 min each time; g. Secondary antibody incubation: Place the membrane in goat anti-rabbit secondary antibody (1:2000), place it on a decolorizing shaker, and incubate at room temperature for 1 hour. After the secondary antibody incubation is complete, remove the membrane and wash it 3 times in 1×TBST solution for 10 minutes each time. h. ECL development: According to the instructions, mix developer solution A and developer solution B in a 1:1 ratio, and then use a pipette to evenly drop the mixed developer solution onto the PVDF membrane, so that the developer solution is evenly spread on the PVDF membrane. Place the membrane in the imaging system to acquire images for quantitative analysis.

[0071] (4) Total RNA extraction from Nicotiana benthamiana a. Take fresh tobacco leaves and grind them thoroughly in liquid nitrogen. Add 0.1 g of powder to a pre-cooled centrifuge tube and quickly add 1 mL of TRNzol reagent. b. After thoroughly vortexing and mixing, place the homogenate sample at room temperature for 5 min, centrifuge at 12000 rpm for 10 min at 4℃, and collect the supernatant; c. Add 0.2 mL of chloroform to the top, shake vigorously for 20 s, let stand at room temperature for 5 min, and centrifuge at 12000 rpm for 15 min at 4℃; d. Transfer the upper aqueous phase (approximately 400 μL) to a new centrifuge tube, add an equal volume of isopropanol, invert to mix, and incubate at room temperature for 10 min; e. Centrifuge at 4℃, 12000 rpm for 10 min, carefully and completely discard the supernatant, and add 1 mL of 75% ethanol prepared with RNase-free ddH2O to wash the precipitate; f. Centrifuge at 7500 rpm for 5 min at 4℃, and discard the supernatant; g. Allow to stand at room temperature for 5 min, add 50–100 μL of RNase-free water, gently agitate the centrifuge tube to fully dissolve the RNA, use NanoDrop to detect the concentration and purity of the RNA, and store in an ultra-low temperature freezer at -80°C.

[0072] (5) Use RNA as a template to reverse transcribe and synthesize cDNA.

[0073] To remove gDNA, the reaction system was 20 μL (Table 2, Table 3). First, mix1 (Table 2) was prepared with reaction conditions of 42℃ for 2 min; then mix2 (Table 3) was prepared with reaction conditions of 37℃ for 15 min; 85℃ for 5 s; and stored at 4℃.

[0074] Table 2. Components of Mix1 cDNA Synthesis System Required for PCR .

[0075] Table 3. Components of Mix2 cDNA Synthesis System Required for PCR .

[0076] (6) Virus particle purification method a. Collect leaves with obvious disease, remove the veins, weigh 100 g, quick-freeze with liquid nitrogen, and grind thoroughly into powder; b. Add 0.2 M pH 7.2 phosphate buffer containing 1% β-mercaptoethanol, pre-cooled at 4 °C, at a weight:volume ratio of 1:2; c. Filter with sterile 4-layer gauze, leaving the supernatant to obtain the initial extract. While stirring, add a 10% chloroform: n-butanol mixture of 1:1 to the supernatant, continue stirring at 4 ℃ for 15 min, and centrifuge at 4 ℃, 10000 rpm for 20 min. d. Take the supernatant, add 4% NaCl and 4% polyethylene glycol (PEG 6000) to the supernatant while stirring at 4 ℃, continue stirring at 4 ℃ for 1.5 h, and centrifuge at 10000 rpm for 15 min at 4 ℃. e. Retain the precipitate, and use 0.01 M pH 7.2 phosphate buffer. Continue stirring in an ice bath for 1 h, and centrifuge at 4 ℃, 10000 rpm for 20 min. f. Repeat operation d; g. Retain the precipitate, resuspend it in 0.01 M pH 7.2 phosphate buffer, and centrifuge at 4 °C, 8000 rpm for 5 min; h. Take the supernatant to obtain the desired virus particles.

[0077] (7) DFHBI-1T dye binding method DFHBI-1T was prepared into a 20 mM stock solution using DMSO, and then a 200 μM dye stock solution was prepared using the following formula: 400 μL 5× fluorescence buffer, 20 μL dye stock solution (20 mM), and 1580 μL ultrapure water. For the preparation of the RNA aptamer-virus particle binding mixture, the following formula was used: 2 μL 5× fluorescence buffer, 5 μL virus particles (1 μg / μL), 10 μL dye stock solution (200 μM), and 3 μL ultrapure water. The 5× fluorescence buffer formula was: 4 mL 0.5 M HEPES (pH 7.4), 1.25 mL 4 M KCl, 0.05 mL 1 M MgCl2, 1.25 mL 12.5% ​​DMSO, and water to a final volume of 10 mL.

[0078] The results showed that, 9 days after injection, compared with TVMVwt-infected plants, the degree of leaf wrinkling was reduced in plants inoculated with mutant viruses TVMVSu, TVMVPDS100, and TVMVCHLI100. The degree of disease in plants inoculated with mutant virus TVMVPDS50 was the same as that in TVMVwt-infected plants. Figure 6 A). Leaves from the upper system were collected for Western blot analysis to detect virus accumulation. Results showed that the virus accumulation in plants inoculated with TVMVwt and TVMVPDS50 was consistent; compared to TVMVwt-infected plants, the virus accumulation in TVMVSu-infected plants was slightly lower, the virus accumulation in TVMVPDS100-infected plants was significantly reduced, while no virus accumulation was detected in TVMVCHLI100. Figure 6 B). After the plants continued to grow for 30 days, the symptoms of virus infection were observed. It was found that plants infected with TVMVPDS100 and TVMVCHLI100 showed obvious stunting. Figure 6 C). Similarly, Western blot analysis revealed that compared to the virus accumulation in plants infected with TVMVwt, the virus accumulation in plants infected with TVMVSu, TVMVPDS50, TVMVPDS100, and TVMVCHLI100 all decreased. A small amount of virus accumulation was also detected in TVMVCHLI100. Figure 6D). RT-PCR analysis of plants that had grown for 30 days after injection revealed fragments of the exogenous gene in all samples. Figure 7 Fragments obtained by RT-PCR (A and 7B) were further sequenced and verified using Sanger sequencing. Figure 11 , Figure 12 , 13 Figures and Figure 14 All of these findings confirm the presence of the fragment. After transient expression in *Nicotiana benthamiana*, it was found that all of the aforementioned viral infectious clones could infect *Nicotiana benthamiana*, indicating that the 3' non-coding RNA of TVMVwt can insert into exogenous genes and transfer exogenous nucleic acid fragments into plants.

[0079] The infectious clones of TVMVwt and TVMVFR2 were transformed into Agrobacterium C58C1 competent cells. Using an Agrobacterium-mediated transient expression system, the concentration of the Agrobacterium culture containing the TVMVwt and TVMVFR2 infectious clones was adjusted to OD600 = 0.6 and injected into Nicotiana benthamiana. Plants injected with TVMVwt and healthy Nicotiana benthamiana served as controls. Plant symptoms were observed 9 days after injection. The results showed that, compared with plants infected with TVMVwt, plants inoculated with the mutant virus TVMVFR2 exhibited less leaf wrinkling. Figure 9 A). Leaves from the upper system were collected for Western blot analysis to detect virus accumulation. Results showed that compared to plants inoculated with TVMVwt, plants inoculated with TVMVFR2 had reduced protein accumulation. Figure 9 B). After the plants continued to grow for 30 days, the symptoms of virus infection were observed. It was found that compared with the plants inoculated with TVMVwt, the number of plants infected with TVMVFR2 was higher, but there was no difference in symptoms. Figure 9 C). Similarly, Western blot analysis revealed similar viral accumulation levels in plants infected with TVMVwt and TVMVFR2. Figure 9 D).

[0080] Furthermore, fluorescence observation was performed on TVMVFR2-infected plants. After 30 days of growth, virus particles were extracted from upper leaves of plants injected with TVMVFR2. When bound to FR2 small RNA using the DFHBI-1T dye, the results showed that the TVMVFR2 virus particles emitted distinct green fluorescence after being irradiated with 472nm excitation light. Figure 10 A). The fluorescence quantification results are consistent with the fluorescence results ( Figure 10 B).

[0081] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A method for transferring exogenous nucleic acid fragments into plants using plant viruses, characterized in that: The procedure includes the following steps: fusing a foreign nucleic acid fragment into the infectious cloning vector pLX-TVMV of wild-type TVMV virus to obtain an expression vector, which is then transformed into plants; the foreign nucleic acid fragment is inserted into the 3' non-coding RNA region of the TVMV virus; the pLX-TVMV is shown in SEQ ID NO.

16.

2. The method according to claim 1, characterized in that: The insertion site of the exogenous nucleic acid fragment is position 10440 or 10441 of SEQ ID NO.

16.

3. The method according to claim 1, characterized in that: The exogenous nucleic acid fragment is amiR-Su, PDS50, PDS100, CHLI100, or FR2.

4. The method according to claim 1, characterized in that: The nucleotide sequence of amiR-Su is shown in positions 161-249 of SEQ ID NO.

1.

5. The method according to claim 1, characterized in that: The nucleotide sequence of the PDS50 is shown in positions 336-385 of SEQ ID NO.

2.

6. The method according to claim 1, characterized in that: The nucleotide sequence of the PDS100 is shown in positions 336-435 of SEQ ID NO.

3.

7. The method according to claim 1, characterized in that: The nucleotide sequence of CHLI100 is shown in positions 336-435 of SEQ ID NO.

4.

8. The method according to claim 1, characterized in that: The nucleotide sequence of FR2 is shown in positions 337-385 of SEQ ID NO.

5.

9. The method according to claim 1, characterized in that: The plant in question is tobacco.

10. The method according to claim 1, characterized in that: The process is converted to injection.

Images