Method for genetic transformation of sorghum and application thereof

Abstract

The present application belongs to the technical field of plant genetic engineering, and relates to a sorghum genetic transformation method and application thereof. The genetic transformation method comprises the following steps: inoculating agrobacterium carrying a recombinant vector into inoculation medium for dilution and incubation to obtain agrobacterium infection liquid, the recombinant vector carrying an NPTII selection marker gene, a GFP reporter gene and a BBM-2A-WUS-mCherry callus fusion gene; taking a sorghum immature embryo as an explant, soaking the explant in the agrobacterium infection liquid, and sequentially performing dark co-culture, dark resting culture and dark callus induction screening to obtain a resistant positive callus; and after the positive callus is subjected to illumination culture, germination differentiation and rooting, seedling raising and transplanting are performed. NPTII gene expression realizes directional screening of positive transformants, and reduces the proportion of false positives; the BBM-2A-WUS-mCherry fusion gene improves the callus formation capacity of cells, and cooperatively solves the problems of difficult callus induction, low transformation efficiency and serious browning of high tannin varieties of sorghum.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and relates to a method for genetic transformation of sorghum and its application. Background Technology

[0002] Sorghum, a major cereal crop worldwide, is characterized by high photosynthetic efficiency and drought and salt tolerance, making it of significant planting value in arid and saline-alkali regions of my country. Furthermore, sorghum is a core raw material for the brewing industry, with approximately 80% of my country's sorghum used for brewing. Traditional brewing varieties such as red tassel sorghum are widely cultivated due to their unique brewing characteristics, with an annual demand reaching millions of tons.

[0003] However, the genetic improvement of such varieties has long been hampered by technical bottlenecks such as difficulty in inducing callus in immature embryos, weak regeneration capacity, and low transformation efficiency, which seriously restricts the precise improvement of their traits and the breeding of new varieties. In recent years, although sorghum genetic transformation technology has made some progress overall, high-tannin varieties such as Hongyingzi still lack efficient and stable genetic manipulation systems due to problems such as callus browning and necrosis. Summary of the Invention

[0004] The purpose of this invention is to provide a genetic transformation method for sorghum and its application. The sorghum genetic transformation method uses a recombinant vector to simultaneously carry three types of functional genes. The NPTII gene expression product can confer kanamycin resistance to cells, enabling targeted screening of positive transformants and significantly reducing the false positive rate. The BBM-2A-WUS-mCherry fusion gene can significantly enhance the cell callus formation ability, constructing a stable genetic transformation system adapted to sorghum. This invention specifically addresses the problems of difficult callus induction, low transformation efficiency, and severe browning in sorghum, especially high-tannin varieties. Through the combination of gene tools and culture systems, the transformation success rate of these difficult-to-transform varieties is effectively improved.

[0005] In a first aspect, the present invention provides a method for genetic transformation of sorghum, comprising the following steps: Preparation of infection solution: Agrobacterium carrying the recombinant vector was inoculated into the inoculation medium, diluted and incubated to obtain Agrobacterium infection solution. The recombinant vector carries the NPTII selection marker gene and the BBM-2A-WUS-mCherry callus fusion gene. Infection and Culture: Immature sorghum embryos were used as explants. The explants were soaked in the Agrobacterium infection solution and then subjected to dark co-culture, dark static culture, and dark callus induction screening to obtain resistant positive callus tissue. Induction and Transplanting: The positive callus tissue was cultured under light to germinate, differentiate, and root, and then hardened off before transplanting.

[0006] In some embodiments, the nucleotide sequence of the BBM-2A-WUS-mCherry callus fusion gene is shown in SEQ ID NO.1.

[0007] In some embodiments, the explants are pretreated before being placed in Agrobacterium infection solution for infection. The pretreatment is as follows: first, a water bath at 40-45°C for 1-5 minutes, followed by cooling at 20-30°C for 1-5 minutes.

[0008] In some embodiments, the sorghum is red glutinous sorghum for brewing; the immature sorghum embryos are taken from sorghum plants 11-14 days after pollination.

[0009] In some embodiments, during the infection solution preparation step, the Agrobacterium is diluted with inoculation medium to OD0.05. 600 The nm value is 0.35~0.4, and it is used after incubation at 25~30℃ for 2~4 hours; The Agrobacterium is strain AGL1; the recombinant vector is constructed using the pCAMBIA2300 binary vector as its backbone.

[0010] In some implementations, the infection and culture steps involve soaking the explants in the Agrobacterium infection solution for 5-15 minutes; the co-culture temperature is 20-30°C, and the time is 1-5 days. The static culture temperature is 20~30℃, the time is 5~15 days, and the fresh static culture medium is replaced every 4~6 days during the culture process. When replacing the static culture medium for the second time, the embryonic bud growing below the immature embryo is removed. The induction screening temperature is 20~30℃, and the time is 5~15 days.

[0011] In some implementations, during the induction and transplanting steps, the resistant positive callus is induced to germinate and root. The conditions for germination and rooting induction are: temperature 20-30℃, 16h light / 8h darkness; the germination induction culture is subcultured every 10-14 days until regenerated seedlings differentiate and grow strong roots.

[0012] In some embodiments, the co-culture medium contains polyvinylpyrrolidone and ascorbic acid.

[0013] In some embodiments, the culture medium for static culture is supplemented with RC stock solution; the RC stock solution contains vitamin B5, asparagine, potassium dihydrogen phosphate, and copper sulfate.

[0014] Secondly, this invention provides an application of the above-mentioned sorghum genetic transformation method in sorghum molecular breeding, gene function verification, or germplasm resource creation.

[0015] In summary, this application includes at least one of the following beneficial technical effects: The recombinant vector carries three types of functional genes simultaneously. The NPTII gene expression product can confer kanamycin resistance to cells, enabling targeted screening of positive transformants and significantly reducing the false positive rate. The BBM-2A-WUS-mCherry fusion gene can significantly enhance cell callus formation ability. The entire Agrobacterium infection combined with multi-stage culture process is adapted to the physiological characteristics of high-tannin sorghum such as Red Tassel sorghum, effectively improving the overall transformation efficiency. Attached Figure Description

[0016] Figure 1 This is the structural diagram of the recombinant vector 2300-gfp-BWM of this application; Figure 2 This is the spectrum of the empty p501 plasmid in this application; Figure 3 The images show the physical specimens of the red sorghum seed undergoing genetic transformation at different growth stages, where A represents the co-culture stage, B represents the static culture stage, C represents the callus induction and screening stage, D and E represent the germination induction stage, and F represents the rooting culture stage. Figure 4 This is a gel pattern obtained by PCR electrophoresis identification of the NPTII gene in the T0 generation transgenic plants of this application. Detailed Implementation

[0017] The following specific embodiments further illustrate the technical solution of the present invention. These specific embodiments do not represent a limitation on the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the scope of protection of the present invention.

[0018] Unless otherwise specified, all reagents and materials used in this application are commercially available.

[0019] This application provides a method for genetic transformation of sorghum, including the following steps: Preparation of infection solution: Agrobacterium carrying the recombinant vector was inoculated into the inoculation medium, diluted and incubated to obtain Agrobacterium infection solution. The recombinant vector carries the NPTII selection marker gene and the BBM-2A-WUS-mCherry callus fusion gene. Infection and Culture: Immature sorghum embryos were used as explants. The explants were soaked in Agrobacterium infection solution and then subjected to dark co-culture, dark static culture, and dark callus induction screening to obtain resistant positive callus tissue. Induction and Transplanting: Positive callus tissues are cultured under light to germinate, differentiate, and root, and then hardened off before transplanting.

[0020] The NPTII selection marker gene provides a kanamycin resistance selection tag, which can accurately eliminate non-positive transformed cells and reduce the false positive rate in subsequent screening. The BBM-2A-WUS-mCherry callus fusion gene, through the synergistic action of BBM and WUS transcription factors, significantly enhances the induction and proliferation capacity of sorghum callus tissue, breaking through the genotype-dependent transformation bottleneck of sorghum and improving transformation efficiency at the gene level. The co-culture stage ensures T-DNA transfer, the quiescent stage alleviates infection stress and promotes cell recovery, the selection stage gradually enriches positive callus, and the differentiation and rooting stage completes plant regeneration. The entire process matches the growth status of sorghum explants, reducing browning and necrosis rates. A stable genetic transformation system adapted to sorghum has been constructed, specifically addressing the problems of difficult callus induction, low transformation efficiency, and severe browning in sorghum, especially high-tannin varieties. Through the combination of gene tools and culture systems, the transformation success rate of these difficult-to-transform varieties can be effectively improved.

[0021] Furthermore, the nucleotide sequence of the BBM-2A-WUS-mCherry callus fusion gene is shown in SEQ ID NO.1.

[0022] This specific sequence is a fusion sequence optimized for sorghum codon preferences, and it has higher expression efficiency in sorghum cells compared to the native sequence.

[0023] Furthermore, the explants were pretreated before being placed in Agrobacterium infection solution for infection. The pretreatment consisted of first being bathed in a water bath at 40-45°C for 1-5 minutes, and then cooled at 20-30°C for 1-5 minutes.

[0024] For example, the water bath temperature can be within the range of 40℃, 41℃, 42℃, 43℃, 44℃, 45℃, or any combination thereof; the water bath time can be within the range of 1min, 2min, 3min, 4min, 5min, or any combination thereof; and the cooling temperature can be within the range of 20℃, 22℃, 25℃, 27℃, 28℃, 30℃, or any combination thereof; the water bath time can be within the range of 1min, 2min, 3min, 4min, 5min, or any combination thereof. This pretreatment is a core optimization targeting the browning problem in high-tannin sorghum. Moderate heat shock can temporarily inhibit the activity of polyphenol oxidase in explants, reducing oxidative browning of tannins and other phenolic substances, and lowering the explant necrosis rate. Simultaneously, heat shock can increase the expression level of the Agrobacterium Vir gene and enhance T-DNA transfer efficiency. The subsequent cooling step can quickly terminate the heat shock reaction, avoiding continuous damage to embryonic cell activity from high temperatures, achieving the dual effects of improving infection efficiency and inhibiting browning without reducing cell viability. If the temperature is higher than 45℃ and the heat shock time exceeds 5 minutes, it will cause thermal damage to the explant cells, which will lead to a decrease in callus induction rate. If the temperature is lower than 40℃ and the time is less than 1 minute, it will not be able to effectively inhibit browning and improve infection efficiency, and the technical effect cannot be stably achieved.

[0025] Furthermore, the sorghum is glutinous sorghum for brewing, and the glutinous sorghum for brewing is red-tasseled sorghum; the immature sorghum embryos are taken from sorghum plants 11-14 days after pollination.

[0026] Glutinous sorghum for brewing, such as Hongyingzi, generally has high tannin content and severe browning, making it the most difficult type of sorghum to genetically transform. Existing mature transformation systems are basically unusable directly. This program is specifically tailored to address the transformation challenges of this type of variety. Immature embryos 11-14 days after pollination are in the most vigorous stage of embryogenic cell division, exhibiting the strongest callus induction and regeneration capabilities. Different sorghum genotypes show significant differences in embryogenic callus induction rates; selecting explants during this window period can significantly increase the induction rate of embryogenic callus, ensuring subsequent plant regeneration efficiency.

[0027] Furthermore, in the infection solution preparation step, Agrobacterium is diluted with inoculation medium to OD0.05. 600 The nm value is 0.35~0.4, and it is used after incubation at 25~30℃ for 2~4h; Agrobacterium is strain AGL1; the recombinant vector is constructed using pCAMBIA2300 binary vector as the backbone.

[0028] OD 600A nm value of 0.35–0.4 corresponds to the mid-logarithmic growth phase of Agrobacterium, exhibiting the most stable infectivity and suited to the fragile cell state of high-tannin varieties. Incubation at 25–30°C for 2–4 hours ensures the recovery of Agrobacterium activity after resuspension and maintains uniform infection status. For example, incubation temperatures can be 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, or any combination thereof, and incubation times can be 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, or any combination thereof.

[0029] The AGL1 strain has high activation efficiency in the vir region and strong infection ability in gramineous crops, making it suitable for sorghum conversion scenarios; pCAMBIA2300 is a universal binary vector for Agrobacterium, which replicates stably in Agrobacterium and has high T-DNA integration efficiency.

[0030] Furthermore, the explants were soaked in Agrobacterium infection solution for 5-15 minutes; the co-culture temperature was 20-30℃ for 1-5 days; the static culture temperature was 20-30℃ for 5-15 days, and the fresh static culture medium was replaced every 4-6 days during the culture process. When replacing the static culture medium for the second time, the plumule growing below the immature embryo was removed; the induction and selection temperature was 20-30℃ for 5-15 days.

[0031] An infection duration of 5–15 minutes balances infection efficiency and cell damage, avoiding prolonged immersion that leads to explant hypoxia and browning. 20–30°C is the optimal temperature range for Agrobacterium activity and plant cell tolerance, ensuring efficient T-DNA transfer while maintaining cell viability. The static culture stage, free from selection pressure, allows infected cells to fully repair stress damage, increasing the survival rate of positive cells. Regular medium changes remove browning metabolites released from explants, and removing the embryonic bud prevents it from competing for nutrients and inhibiting embryogenic callus proliferation, further improving callus quality and induction rate. During the callus induction and selection stage, resistance pressure gradually enriches positively transformed cells, ensuring that the final callus obtained is a positive transformant and reducing false positives in subsequent differentiation.

[0032] Furthermore, germination and rooting were induced in resistant positive callus tissue. The conditions for germination and rooting induction were: temperature 20-30℃, 16h light / 8h darkness; the germination induction culture was subcultured every 10-14 days until regenerated seedlings differentiated and strong roots grew.

[0033] A photoperiod of 16 hours of light and 8 hours of darkness matches the photosynthetic growth rhythm of sorghum seedlings, promoting the differentiation of callus tissue into stem and leaf structures and inducing root development. A subculture cycle of 10 to 14 days can promptly update the nutrients in the culture medium, remove metabolic waste, prevent callus aging, ensure the normal growth of seedlings during differentiation, improve the robustness and rooting rate of regenerated seedlings, and reduce the mortality rate of subsequent hardening-off seedlings and transplanting.

[0034] Furthermore, the co-culture medium contains polyvinylpyrrolidone and ascorbic acid.

[0035] During the co-culture stage, polyvinylpyrrolidone and ascorbic acid were added. At this stage, the explants had the strongest stress response to Agrobacterium infection and the largest release of phenolic substances. Polyvinylpyrrolidone can adsorb tannins and other phenolic substances, while ascorbic acid plays an antioxidant role. The two work together to inhibit oxidative browning and protect the active cells that have just completed T-DNA transfer.

[0036] Furthermore, the static culture medium was supplemented with RC stock solution; the RC stock solution contained vitamin B5, asparagine, potassium dihydrogen phosphate and copper sulfate.

[0037] During the static culture phase, RC stock solution was added, in which vitamin B5 maintains the basic metabolic function of cells, asparagine and potassium dihydrogen phosphate supplement nutrients and stabilize the osmotic pressure of the culture medium, and copper sulfate, as a trace element, regulates the cell differentiation state. Overall, this enhances the repair capacity and callus proliferation rate of infected and damaged cells and reduces the proportion of apoptosis.

[0038] Furthermore, this application also provides an application of a sorghum genetic transformation method in sorghum molecular breeding, gene function verification, or germplasm resource creation.

[0039] Applying this sorghum genetic transformation method to the above scenarios can overcome the technical bottlenecks of difficult-to-transform varieties such as brewing glutinous sorghum, provide reliable technical support for sorghum gene function research, targeted molecular breeding, and innovation of superior germplasm, shorten the breeding cycle, and improve the accuracy and efficiency of germplasm improvement.

[0040] Example 1 A method for genetic transformation of sorghum includes the following steps: 1. Construction of gene transformation vectors A BWM expression vector was constructed using the pCAMBIA2300 Agrobacterium binary expression vector as a backbone. The NPTII (kan) selection marker gene and the BBM-2A-WUS-mCherry (BWM) callus-promoting fusion gene were inserted into its multiple cloning site to obtain the 2300-gfp-BWM recombinant vector. The structural map of the recombinant vector 2300-gfp-BWM is shown in Figure 1. The NPTII gene is the expression cassette of the neomycin phosphotransferase II gene, serving as a selection marker for transgenic lines, specifically a kanamycin resistance selection marker, used for the detection and screening of positive clones in genetic transformation of sorghum such as *Sorghum spp.* The BBM-2A-WUS-mCherry (BWM) gene promotes callus formation and improves the transformation efficiency of sorghum; its nucleotide sequence is shown in SEQ ID NO. 1.

[0041] Simultaneously construct the control vector p501 empty plasmid, which does not contain the BBM-2A-WUS-mCherry fusion gene and retains only the Kan resistance element. The vector map is shown in Figure 2.

[0042] 2. Preparation of Agrobacterium infection solution 2.1 Agrobacterium transformation and PCR identification of positive clones (1) Identification of Agrobacterium tumefaciens using the 2300-gfp-BWM recombinant vector The recombinant vector was transferred into Agrobacterium AGL1 competent cells by electroporation and plated on LB agar plates containing antibiotic solutions of 50 mg / L kanamycin (Kan), 50 mg / L rifampin (Rif), and 50 mg / L spectinomycin (Spe). Positive clones were screened to obtain positive Agrobacterium clones. Single clones were selected for colony PCR verification. The sequences of the primer pairs for Agrobacterium identification using the BWM vector are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0043] SEQ ID NO.2: Forward BWM detection -f: ctgtcaataactggctggc; SEQ ID NO.3: Reverse BWM detection -r: gatgcgctggatctgctc; (2) Identification of p501 empty Agrobacterium p501 empty-load electrotransfers were transferred into AGL1 competent cells and screened accordingly; the sequences of the p501 empty-load Agrobacterium-specific identification primer pairs are shown in SEQ ID NO.4 and SEQ ID NO.5: SEQ ID NO.4: Forward 35S-F: GACGCCAATCCCACTATCC; SEQ ID NO.5: Reverse DsRed2-R: CTACAGGAACAGGTGGTGGCGG; 2.2 Shaking culture Correctly identified positive Agrobacterium clones were inoculated into LB liquid medium containing 50 mg / L kanamycin, 50 mg / L rifampin and 50 mg / L spectinomycin at a volume ratio of 1:100. The culture was then shaken overnight at 28°C and 220 rpm to obtain Agrobacterium bacterial suspension.

[0044] 2.3 Dilution and Activation of Bacterial Solution Take out the cultured Agrobacterium tumefaciens suspension and centrifuge at 3400 rpm for 10 min. Discard the supernatant in a clean bench. Resuspend the Agrobacterium tumefaciens precipitate in 1 mL of inoculation medium (IM), then take 200 μL of the resuspension and dilute it to 6 mL of IM. Use IM as a blank control and measure its OD using a spectrophotometer. 600 The nm value is adjusted by replenishing the original bacterial culture or IM to control OD. 600 The nm value is between 0.35 and 0.4, and then it is incubated in a shaker at 28°C and 140 rpm for 2 to 4 hours for later use.

[0045] The inoculation medium (IM) formulation was as follows: 4.3 g / L MS salt, 68.5 g / L sucrose, 36 g / L glucose, 0.5 g / L 2-morpholinoethanesulfonic acid (MES), 1.5 mL / L (1 mg / mL) 2,4-D solution, and 10 mL / L (11.2 g / L) vitamin B5 stock solution. The pH was adjusted to 5.2, filtered and sterilized, and 1 mL / L (100 mM) acetylsuccinone stock solution was added before use.

[0046] 3. Obtaining the embryonic embryo of red-tasseled sorghum seeds 3.1 Explant selection: Select red tassel sorghum seeds 11-14 days after field pollination, peel the seeds off the ears, and transfer them into 50 mL centrifuge tubes.

[0047] 3.2 Sterilization: Add 30 mL of 50% sodium hypochlorite (10% effective sodium hypochlorite) to the 50 mL centrifuge tube containing sorghum seeds, and sterilize by shaking at 28℃ and 220 rpm for 30 min.

[0048] 3.3 Cleaning: Transfer the sterilized seeds to a laminar flow hood, discard the sodium hypochlorite solution, and rinse with sterile water 3-4 times, retaining a small amount of sterile water.

[0049] 3.4 Extraction of immature embryos: In a clean bench, pour the above sorghum seeds into a sterile petri dish lined with filter paper, absorb excess water, peel the seeds with sterile tweezers, remove the immature embryos, and place them into a 2ml centrifuge tube containing 1M. Strict aseptic operation is required throughout the process to prevent contamination.

[0050] 4. Agrobacterium infection In a clean bench, wash the peeled embryos 2-3 times with IM, then add just enough IM to cover the embryos, heat-shock them in a 43°C water bath for 3 minutes, and then transfer them to a 25°C metal bath to cool for 2 minutes. In the clean bench, use a pipette to remove the IM, add 2 mL of Agrobacterium infection solution, gently invert the centrifuge tube to ensure full contact between the embryos and the bacterial solution, and infect horizontally for 10 minutes.

[0051] 5. Co-cultivation The infected embryos were poured into co-culture medium (CO-M) and excess bacterial solution was aspirated. The embryos were then positioned with the shield side up and the concave side down using a yellow pipette tip. The culture dish was sealed with sealing film and placed in a 25°C incubator for 3 days in the dark.

[0052] The growth status of explants during the co-culture stage is as follows: Figure 3 As shown in A.

[0053] The co-culture medium (CO-M) formulation was as follows: 4.3 g / L MS salt, 20 g / L sucrose, 10 g / L glucose, 0.7 g / L L-proline, 0.5 g / L MES, and 5 mL / L (1 mg / mL) 2,4-D solution. The pH was adjusted to 5.8, and then 8 g / L agar powder, 10 mg / L ascorbic acid, and 10 g / L polyvinylpyrrolidone (PVPP) were added. The mixture was then autoclaved at 121°C for 20 min. After autoclaving, the mixture was cooled to 50°C to 55°C, and then 10 mL / L (11.2 g / L) vitamin B5 stock solution and 1 mL / L (100 mM) acetylsuccinone stock solution were added.

[0054] 6. Static culture In a clean bench, the co-cultured embryos were transferred to static medium (R) using sterile forceps and cultured in the dark at 25°C for 10 days. During the culture period, the static medium was changed every 5 days for subculture. When changing the medium for the second time, the embryonic buds growing from the bottom of the embryos were removed.

[0055] The growth status of explants during the static culture stage is shown in Figure 3B.

[0056] The static culture medium (R) formulation was as follows: 4.3 g / L MS salt, 30 g / L sucrose, 1.0 g / L L-proline, 0.5 g / L MES, and 5 mL / L 2,4-D solution at a concentration of 1 mg / mL. The pH was adjusted to 5.8, and 8 g / L agar powder and 10 g / L PVPP were added. The mixture was then autoclaved at 121°C for 20 min. After sterilization, the mixture was cooled to 50°C to 55°C, and 100 mL / L LRC stock solution, 1.6 mL / L thiazomycin solution at a concentration of 250 mg / mL, and 2 mL / L plant tissue culture antibacterial agent (PPM) were added.

[0057] The RC stock solution formula is as follows: 1.12 g / L vitamin B5 stock solution, 10 g / L asparagine, 10 g / L potassium dihydrogen phosphate, and 16 mL / L copper sulfate solution with a concentration of 1 mg / mL, filtered and sterilized.

[0058] 7. Callus induction screening In a clean bench, the immature embryos after static culture were transferred to callus induction and selection medium (CIM) and induced and selected for 10 days in the dark at 25°C to obtain positive callus with kanamycin resistance.

[0059] The growth status of callus tissue during the callus induction and screening stage is shown in Figure 3C.

[0060] The callus induction selection medium (CIM) formulation is as follows: 4.3 g / L MS salt, 30 g / L sucrose, 1.0 g / L L-proline, 0.5 g / L MES, and 5 mL / L 2,4-D solution at a concentration of 1 mg / mL. The pH is adjusted to 5.8, and 8 g / L agar powder and 10 g / L PVPP are added. The mixture is then autoclaved at 121°C for 20 min. After sterilization, the mixture is cooled to 50°C to 55°C, and 100 mL / L RC stock solution, 1.2 mL / L thiazolyl succinate solution at a concentration of 250 mg / mL, 1 mL / L kanamycin solution at a concentration of 50 mg / mL, and 2 mL / L plant tissue culture antimicrobial agent (PPM) are added.

[0061] 8. Sprouting induction culture In a clean bench, the selected positive callus tissues were transferred to germination induction medium (SM) and cultured at 25°C under 16h light / 8h dark conditions. The germination induction medium was replaced with fresh medium every 14 days for subculture until the callus tissues differentiated and grew into regenerated seedlings.

[0062] The state of callus differentiation and seedling emergence during the germination induction stage is shown in Figures D and E.

[0063] The germination induction medium (SM) formulation is as follows: 4.3 g / L MS salt, 30 g / L sucrose, and 0.5 g / L MES. The pH is adjusted to 5.8, and 8 g / L agar powder and 10 g / L PVPP are added. The mixture is then autoclaved at 121°C for 20 min. After sterilization, the mixture is cooled to 50°C to 55°C, and the following solutions are added: 10 mL / L of 11.2 g / L vitamin B5 stock solution, 2.5 mL / L of 1 mg / mL 6-BAP solution, 2.5 mL / L of 1 mg / mL IAA solution, 1.2 mL / L of 250 mg / mL thiazomycin, 1.6 mL / L of 1 mg / mL copper sulfate solution, 1 mL / L of 50 mg / mL kanamycin solution, and 2 mL / L plant tissue culture antibacterial agent (PPM).

[0064] 9. Rooting induction culture The regenerated seedlings with good growth were transferred to glass bottles containing rooting medium (RM) and cultured at 25°C under 16h light / 8h darkness conditions until the seedlings developed strong roots.

[0065] The growth status of regenerated seedlings during the rooting culture stage is as follows: Figure 3 As shown in F.

[0066] The rooting medium (RM) formulation is as follows: 4.3 g / L MS salt, 30 g / L sucrose, and 0.5 g / L MES. The pH is adjusted to 5.8, and 8 g / L agar powder and 10 g / L PVPP are added. The mixture is then autoclaved at 121°C for 20 min. After sterilization, the mixture is cooled to 50°C to 55°C, and 10 mL / L of 11.2 g / L vitamin B5 stock solution, 1.2 mL / L of 250 mg / mL thiazolyl succinate solution, 1.6 mL / L of 1 mg / mL copper sulfate solution, 2.5 mL / L of 1 mg / mL IBA solution, 1 mL / L of 50 mg / mL kanamycin solution, and 2 mL / L plant tissue culture antibacterial agent (PPM) are added.

[0067] 10. Hardening off seedlings and transplanting After the roots and above-ground parts of the regenerated seedlings have grown robustly, the sealing film of the culture bottle is removed and the seedlings are hardened off for 3 days. Then, the seedlings are removed, the culture medium adhering to the roots is washed off, and they are transferred to soil to continue growing. After transplanting, leaf DNA is extracted, and PCR identification of the T0 generation transgenic plants is performed. I. The transformation effect of the method described in Example 1 is measured to verify its callus induction and regeneration capabilities.

[0068] Measurement indicators and calculation formulas: Callus survival rate = Number of surviving callus tissues on callus induction medium / Total number of immature embryos used in the experiment × 100%; Callus regeneration efficiency = number of callus tissues that differentiate into shoots on the germination medium / number of surviving callus tissues on the callus induction medium × 100%; Conversion efficiency = Number of callus tissues that differentiated into shoots on germination medium / Total number of immature embryos used in the experiment × 100%.

[0069] Experimental results Two independent replicate experiments were conducted using the method described in Example 1, employing a total of 139 immature embryos of *Sorghum sibirica* as explants. Of these, 72 immature embryos induced kanamycin-resistant callus, and 24 of these resistant callus eventually differentiated into regenerated seedlings. Specific results are as follows: Table 1 Results of genetic transformation efficiency determination of Red Tassel Sorghum

[0070] Experimental results show that, using the method described in this application, the callus survival rate of *Sorghum sibirica* can reach over 50%, the transformation efficiency can reach 15.87%~18.42%, and the regeneration efficiency can reach 31.25%~35.00%. This method can stably and efficiently obtain transgenic regenerated plants of *Sorghum sibirica*, filling the technological gap in a high-efficiency genetic transformation system for brewing-specific sorghum. II. p501 empty vector control experiment In this embodiment, a parallel control group with p501 empty vector was set up simultaneously for the transformation experiment. The explants, strains, and culture environment were completely identical to those in the 2300-gfp-BWM experimental group, except that the vector was changed, and two sets of hormone gradients were used: 1) Old low-hormone system The concentration of 2,4-D in CO-M medium is 2 mL / L; The concentration of 2,4-D in R medium was 1.5 mL / L; The concentration of 2,4-D in CIM medium was 1.5 mL / L; The concentration of IAA in SM medium was 1 mg / L, and the concentration of 6-BAP was 1 mg / L. The concentration of IBA in RM medium is 1 mg / L.

[0071] The p501 empty vector transformation experiment was carried out using the old low-hormone culture medium system, and the transformation statistics are shown in Table 2.

[0072] Table 2 Genetic transformation efficiency of Red Tassel Sorghum 501

[0073] 2) Optimize the high-hormone system The concentration of 2,4-D in CO-M medium was changed to 5 mL / L; The concentration of 2,4-D in R medium was changed to 5 mL / L; The concentration of 2,4-D in CIM medium is 5 mL / L; The concentration of IAA in SM medium was 2.5 mg / L, and the concentration of 6-BAP was 2.5 mg / L. The IBA concentration in RM was 2.5 mg / L; the other components of the culture medium remained unchanged.

[0074] The p501 empty vector transformation experiment was carried out using an optimized high-hormone new culture medium system. The transformation statistics are shown in Table 3.

[0075] Table 3 Genetic transformation efficiency of Red Tassel Sorghum 501

[0076] As shown in Tables 2 and 3, regardless of whether the old low-hormone medium or the new medium with increased hormone concentration is used, transformation using only the p501 empty vector without the BBM-2A-WUS-mCherry fusion gene only yields a small amount of surviving callus tissue, with no budding callus tissue. The regeneration efficiency and transformation efficiency are both 0. This proves that the BBM-2A-WUS-mCherry fusion gene is the core necessary element for achieving complete regeneration of red tassel sorghum and obtaining transgenic plants. Stable genetic transformation of sorghum cannot be achieved by simply increasing the hormone concentration in the medium.

[0077] III. Molecular Identification of T0 Generation Transgenic Plants by NPTII Genomic DNA was extracted from kanamycin-resistant regenerated seedlings after transplanting, and plant identification-specific NPTII primer pairs were used as shown in SEQ ID NO.6 and SEQ ID NO.7: SEQ ID NO.6: Forward 35S-F: ATCCTTCGCAAGACCTTC; SEQ ID NO.7: Reverse NPTII-R: CCAACGCTATGTCCTGATA; The PCR electrophoresis results are shown in Figure 4: N is the template-free blank control, WT is the wild-type sorghum negative control, P is the plasmid positive control, and numbers 1-21 represent independent T0 transformed lines. All resistant seedlings could amplify the NPTII-specific target band, and there were no negative hybrids. The positive rate of transgenic plants using this method was 100%.

[0078] It is understood that the present invention has been described through some embodiments, and those skilled in the art will recognize that various changes or equivalent substitutions can be made to these features and embodiments without departing from the spirit and scope of the invention. Furthermore, under the teachings of the present invention, these features and embodiments can be modified to adapt to specific situations and materials without departing from the spirit and scope of the invention. Therefore, the present invention is not limited to the specific embodiments disclosed herein, and all embodiments falling within the scope of the claims of this application are within the protection scope of the present invention.

Claims

1. A method for genetic transformation of sorghum, characterized in that, Includes the following steps: Preparation of infection solution: Agrobacterium carrying the recombinant vector was inoculated into the inoculation medium, diluted and incubated to obtain Agrobacterium infection solution. The recombinant vector carries the NPTII selection marker gene and the BBM-2A-WUS-mCherry callus fusion gene. Infection and Culture: Immature sorghum embryos were used as explants. The explants were soaked in the Agrobacterium infection solution and then subjected to dark co-culture, dark static culture, and dark callus induction screening to obtain resistant positive callus tissue. Induction and Transplanting: The positive callus tissue was cultured under light to germinate, differentiate, and root, and then hardened off before being transplanted.

2. The sorghum genetic transformation method according to claim 1, characterized in that, The nucleotide sequence of the BBM-2A-WUS-mCherry callus fusion gene is shown in SEQ ID NO.

1.

3. The sorghum genetic transformation method according to claim 1, characterized in that, The explants were pretreated before being placed in Agrobacterium infection solution for infection. The pretreatment consisted of first being placed in a water bath at 40-45°C for 1-5 minutes, and then being cooled at 20-30°C for 1-5 minutes.

4. The sorghum genetic transformation method according to claim 1, characterized in that, The sorghum is red glutinous sorghum for brewing; the immature embryos of the sorghum are taken from sorghum plants 11-14 days after pollination.

5. The sorghum genetic transformation method according to claim 1, characterized in that, In the infection solution preparation step, the Agrobacterium is diluted with inoculation medium to OD0.

05. 600 The nm value is 0.35~0.4, and it is used after incubation at 25~30℃ for 2~4 hours; The Agrobacterium is strain AGL1; the recombinant vector is constructed using the pCAMBIA2300 binary vector as its backbone.

6. The sorghum genetic transformation method according to claim 1, characterized in that, The infection and culture steps involve soaking the explants in the Agrobacterium infection solution for 5-15 minutes; the co-culture temperature is 20-30℃, and the time is 1-5 days. The static culture temperature is 20~30℃, the time is 5~15 days, and the fresh static culture medium is replaced every 4~6 days during the culture process. When replacing the static culture medium for the second time, the embryonic bud that grows from the bottom of the immature embryo is removed. The induction screening temperature is 20~30℃, and the time is 5~15 days.

7. The sorghum genetic transformation method according to claim 1, characterized in that, In the induction and transplanting steps, the resistant positive callus tissue is induced to germinate and root. The conditions for germination and rooting induction are: temperature 20~30℃, 16h light / 8h darkness; the germination induction culture is subcultured every 10~14 days until regenerated seedlings differentiate and grow strong roots.

8. The sorghum genetic transformation method according to claim 1, characterized in that, The culture medium used for the co-culture contains polyvinylpyrrolidone and ascorbic acid.

9. The sorghum genetic transformation method according to claim 1, characterized in that, The culture medium used for the static culture contains RC stock solution; the RC stock solution contains vitamin B5, asparagine, potassium dihydrogen phosphate and copper sulfate.

10. The application of the sorghum genetic transformation method as described in any one of claims 1 to 9 in sorghum molecular breeding, gene function verification, or germplasm resource creation.

Images