A method for constructing a lentivirus recombinant vector stably overexpressing KCNJ3 gene in chicken primary myoblasts and application thereof

CN122811286APending Publication Date: 2026-09-25JIANGSU INST OF POULTRY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610941574.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-28
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

家禽上,KCNJ3基因的研究尚未见报道,且现有技术中并未有利用KCNJ3慢病毒表达载体外源过表达KCNJ3基因的相关研究

Benefits of technology

[0020]本发明具备如下有益效果:通过构建KCNJ3基因过表达慢病毒载体,不仅显著提升原代成肌细胞的转染效率,大幅提高KCNJ3基因整合至成肌细胞基因组的成功率,还可快速构建出KCNJ3基因体外高效表达模型,进而有效筛选获得与肌肉发育调控相关的功能基因分子标记。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811286A_ABST
    Figure CN122811286A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology and relates to a construction method and application of a KCNJ3 gene lentivirus recombinant vector for stable overexpression in chicken primary myoblasts. The construction method comprises the following steps: obtaining a KCNJ3 gene full-length CDS through PCR amplification; performing enzyme cutting on the KCNJ3 gene and an LV5 vector by using NotI and BamHI respectively; performing directional connection after purification; transforming a connection product into TOP10 competent cells; screening positive clones and performing sequencing verification to construct a KCNJ3 expression vector plasmid; performing super-pure plasmid extraction; co-transfecting 293T cells with a packaging plasmid to perform lentivirus packaging, collection and titer detection. The vector can be used for stable overexpression of the KCNJ3 gene in chicken primary myoblasts, and provides an effective tool for studying the regulation function of the KCNJ3 gene on chicken muscle development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a method for constructing and applying a lentiviral recombinant vector that stably overexpresses the KCNJ3 gene in chicken primary myoblasts. Background Technology

[0002] Primary myoblasts in chickens are the core functional cells regulating muscle development and meat quality in broilers. The differentiation direction and rate of myoblasts determine the type, number, and diameter of muscle fibers; and the type and density of muscle fibers are key factors affecting muscle yield and palatability. Therefore, breeding new broiler breeds or specialized strains with a high proportion of slow-twitch muscle fibers, moderate fiber diameter, and uniform distribution has become an important goal of modern broiler breeding. Furthermore, identifying and analyzing key functional genes regulating muscle development can effectively shorten the generation interval of high-quality broiler breeds (strains) and accelerate the process of breeding premium broilers.

[0003] The KCNJ3 gene encodes Kir3 / GIRK family proteins, which can maintain transmembrane K+ in the cell membrane via tetramerization. + KCNJ3 plays a crucial role in maintaining normal cardiomyocyte function and is essential for heart muscle development and the maintenance of normal rhythm. However, research on the KCNJ3 gene in poultry is currently lacking, and there are no existing studies utilizing KCNJ3 lentiviral expression vectors for exogenous overexpression of the KCNJ3 gene. Therefore, using KCNJ3 lentiviral expression vectors for exogenous overexpression of the KCNJ3 gene to confirm its role in chicken myoblast differentiation could serve as a molecular marker for molecular genetic selection of high-quality broiler pectoral muscle development, shortening generation intervals and accelerating breeding progress. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a KCNJ3 gene lentiviral vector, its construction method, and its application.

[0005] First, based on the KCNJ3 gene CDS sequence published in GenBank, the full-length CDS sequence of the KCNJ3 gene was obtained by PCR amplification. Then, the KCNJ3 gene and the LV5 vector were digested separately with enzymes. The digestion products were purified and then ligated. The ligation products were transformed into TOP10 competent cells. Positive clones were sequenced and sequence alignment analyzed. Those with completely matching sequences were considered successfully constructed KCNJ3 gene expression plasmid vectors. All constructed KCNJ3 recombinant plasmids were ultrapurely extracted and then lentiviral packaging was performed: packaging plasmids (pGag / Pol, pRev, pVSV-G) and the successfully constructed KCNJ3 gene expression vector plasmids were co-transfected into 293T cells. After lentiviral packaging and collection, titer detection was performed. Finally, the constructed KCNJ3 overexpression lentiviral vector was transfected into myoblasts, and the expression level of the KCNJ3 gene was detected to explore its regulatory effect on muscle.

[0006] To achieve the above objectives, the present invention is implemented through the following solution: In a first aspect, the present invention provides a lentiviral recombinant vector for stable overexpression of the KCNJ3 gene in primary chicken myoblasts, comprising the full-length CDS sequence of the chicken KCNJ3 gene and an LV5 vector, wherein the lentiviral recombinant vector for the KCNJ3 gene is capable of stable overexpression of the KCNJ3 gene in primary chicken myoblasts.

[0007] Secondly, the present invention provides a method for constructing a lentiviral recombinant vector of the KCNJ3 gene, comprising the following steps: Step 1: Obtain the full-length CDS amplification product of the chicken KCNJ3 gene using PCR. Step 2: Digest the full-length CDS amplification product of the KCNJ3 gene obtained in Step 1 with NotI and BamHI; Step 3: Digest the LV5 vector with NotI and BamHI; Step 4: Purify the enzyme digestion products from Step 2 and Step 3, and then directionally ligate the purified enzyme digestion products to obtain the ligation products; Step 5: Transform the ligation product from Step 4 into TOP10 competent cells, screen for positive clones and perform sequencing verification to obtain the KCNJ3 gene expression vector plasmid with the correct sequence. Step 6: The KCNJ3 gene expression vector plasmid obtained in Step 5 is subjected to ultrapure extraction. The extracted plasmid and the packaging plasmid are co-transfected into 293T cells for lentivirus packaging, collection and titer detection, thus obtaining the KCNJ3 gene lentiviral recombinant vector.

[0008] Furthermore, step 1 specifically includes: Step 1.1: Design primers based on the CDS sequence of the KCNJ3 (NM_205404.2) gene published in GenBank. The CDS sequence of the KCNJ3 gene is shown in SEQ ID NO.1. Add the homologous sequences flanking NotI and BamHI on the LV5 vector to the upstream and downstream primers, respectively. Step 1.2: Perform a PCR reaction using the primers. The PCR reaction system is as follows: 1 µl template, 10× Pfu Buffer (+Mg) 2+ 5µl of dNTP, 1µl of KCNJ3-F, 1µl of KCNJ3-R, 41µl of ddH2O, and 0.3µl of Pfu DNA polymerase; PCR cycling conditions were: 95℃ for 3 min, 1 cycle; 94℃ for 30 sec, 55℃ for 30 sec, and 72℃ for 30 sec, 30 cycles; and 72℃ for 5 min, 1 cycle. Step 1.3: After the PCR reaction is completed, the KCNJ3 gene fragment is recovered by agarose gel electrophoresis and gel excision.

[0009] Further, the primer sequences described in step 1.1 are as follows: The sequence of the upstream primer KCNJ3-F is: GGTTCCAAGCTTAAGCGGCCGCGCCACCATGTCGGCGCTGCGGAGGAAGCTGGGCGATGAGTACC; The sequence of the downstream primer KCNJ3-R is: tcagtagagagtgtcggatccTTATGTGAAGCGGTCGGAATTCATTTTTCTCAGTTTTGGAGGAA.

[0010] Further, in step 2, the full-length CDS amplification product of the KCNJ3 gene is digested with enzymes as follows: The full-length CDS product of the KCNJ3 gene is digested with NotI and BamHI respectively, at 37℃ for 2 hours. The digestion system is 10 × Buffer: 5 μl, full-length CDS product of KCNJ3 gene: 15 μl, BamHI and NotI: 1 μl each, ddH2O: 18 μl.

[0011] Further, in step 3, the LV5 vector was digested with enzymes as follows: LV5 was digested with NotI and BamHI at 37℃ for 2 hours. The digestion system was as follows: 10×Buffer: 5µl, LV5: 15µl, NotI: 1µl, BamHI: 1µl, ddH2O: 28µl.

[0012] Further, in step 4, the directional ligation is performed using the ClonExpress® Entry One Step Cloning Kit. The ligation reaction system is as follows: 4µl of 5×CE Entry Buffer, 1µl of KCNJ3 gene full-length CDS digestion and purification product, 2µl of LV5 vector digestion and purification product, 2µl of Exnase Entry, and 11µl of ddH2O. After the reaction is completed, the reaction tube is immediately placed in an ice-water bath to cool for 5 minutes.

[0013] Further, in step 5, the specific operation of transforming into TOP10 competent cells is as follows: add 10µl of ligation product to the competent cells, mix well, and incubate on ice for 30 min; heat shock in a water bath at 42℃ for 90 s, and quickly transfer to an ice bath for cooling for 3 min; add 800µl of antibiotic-free LB medium, and revive and culture in a shaker at 37℃ and 250r / min for 45 min; take 200µl of the revived bacterial solution and spread it on an LB plate containing 50µg / ml ampicillin, and culture at 37℃ for 16 h.

[0014] Furthermore, the packaging plasmids mentioned in step 6 are pGag / Pol, pRev, and pVSV-G.

[0015] Further, the specific operation of co-transfection is as follows: When the 293T cells have reached 50%-60% confluence, take 3 μL each of the KCNJ3 gene expression vector plasmid and packaging plasmid and add them to 1.5 mL of serum-free DMEM and mix well; take another 1.5 mL of serum-free DMEM, add 200 μL of RNAi-Mate transfection reagent and mix well, incubate at room temperature for 5 min, then mix the two tubes and incubate at room temperature for 20-25 min to form a transfection mixture; add the transfection mixture to the cell culture medium and incubate at 37℃ and 5% CO2 for 4-6 h; then aspirate the transfection solution, add DMEM culture medium containing 10% FBS, and continue to incubate at 37℃ and 5% CO2 for 72 h; Centrifuge at 4℃ and 4000rpm for 4 min; filter the supernatant after centrifugation using a 0.45μm filter; centrifuge the filtrate at 4℃ and 20000rpm for 2 h, collect the concentrate, and store at -80℃ to obtain the KCNJ3 gene lentiviral recombinant vector.

[0016] Thirdly, the present invention provides the application of the KCNJ3 gene lentiviral recombinant vector in overexpressing the KCNJ3 gene in chicken primary myoblasts.

[0017] Furthermore, the application involves transfecting the KCNJ3 lentiviral recombinant vector into chicken primary myoblasts to achieve stable overexpression of the KCNJ3 gene in the chicken primary myoblasts, thereby studying the regulatory role of the KCNJ3 gene in chicken muscle development.

[0018] Furthermore, overexpression of the KCNJ3 gene can upregulate the expression of chicken myoblast differentiation marker genes MyoD, MyoG, and Myomaker.

[0019] Furthermore, the application of the described KCNJ3 gene lentiviral recombinant vector in the preparation of an in vitro expression model for studying the regulation of chicken muscle development is provided.

[0020] The present invention has the following beneficial effects: by constructing a lentiviral vector for KCNJ3 gene overexpression, it not only significantly improves the transfection efficiency of primary myoblasts and greatly increases the success rate of KCNJ3 gene integration into the myoblast genome, but also rapidly constructs an in vitro high-efficiency expression model of KCNJ3 gene, thereby effectively screening and obtaining functional gene molecular markers related to muscle development regulation. Attached Figure Description

[0021] Figure 1 * indicates the expression of the KCNJ3 gene in chicken breast muscle tissue. p <0.05, ** indicates p <0.01 (the same applies below); Figure 2 The expression of the KCNJ3 gene during the proliferation and differentiation phases of primary chicken myoblasts; Figure 3 This is a sequence diagram; Figure 4 Fluorescence contrast image of myoblasts transfected with the KCNJ3 gene lentiviral recombinant vector and the negative control vector, respectively. Figure 5 The expression changes after transfection with the KCNJ3 lentiviral recombinant vector; Figure 6 This is a comparison of the expression of myoblast differentiation marker genes in the KCNJ3 gene lentiviral transfection group and the NC group.

[0022] CDS sequence of the KCNJ3 gene (SEQ ID NO.1): atgtcggcgctgcg gaggaagctg ggcgatgagt accaggtggt gagcacctcggccagcggaggggggctgcc tccgccccgg gcggccccgc gggggaagcg gcagcgcttcgtggataagaacgggaggtg caacgtgcag cacgggaacc tgggcggcga gaccagccggtacctgtccgacctcttcac cacgctggtg gacctcaagt ggcgctggaa cctcttcattttcgtcctcacctacaccgt ggcctggctc ttcatggcct ccatgtggtg ggtgatcgcctacatgcggggcgacctgaa caaggctcac gacgacagct acaccccctg cgtggccaacgtctacaacttcccttccgc cttcctcttc ttcatcgaga ccgaggccac catcggctacggctaccgctacatcacgga caaatgcccc gagggcatca tcctcttcct cttccagtccatcctgggctccatcgtgga cgccttcctc attggctgca tgttcatcaa gatgtcccagcccaagaagagggctgagac gctgatgttc agcgagcacg cggccatctc catgcgggacggcaagctcaccctcatgtt ccgcgtgggg aacctccgca acagccatat ggtctcagcgcagatccgctgcaagctgct caagtcccgc cagacgcccg agggtgagtt cctgccgctggaccagctggagctggacgt gggcttcagc acaggtgccg accagctctt cctcgtctcgccgctcaccatctgccacgt catcgatgcc aagagcccct tctacgacct gtcccagcgcagcatgcagacggagcagtt cgagatcgtc gtcatcctgg agggcatcgt ggaaaccacggggatgacgtgccaggccag gacatcctac actgaggatgaggtgctctg gggccatcgcttcttccctgttatatcctt ggaagaaggg ttcttcaaag tcgactactc gcagttccacgcgacgtttgaggtccccac gccgccgtac agcgtgaagg agcaggagga gatgctgctcatgtcctcacccctgatagc gcccgctgtc agcaacagca aggagaggaa taactcggtggagtgcctggatggtctgga tgaggttggt ataaaactcc cttccaaact gcagaaaataactggaagggacgacttccc caaaaaactc ctcaggatga gctccaccac ctcggagaaggcctacagcatgggcgattt gcccatgaag ctgcagcgga tcagctcagt ccctgggaattcagaagagaaactggtgtc caaagccacc aagatgatgt cggatcccat gagccagtcggtggccgacttgcccccaa gctccagaaa ctgtcgggtg gcggccggat ggaagggaaccttcctccaaaactgagaaa aatgaattcc gaccgcttca cataa Upstream primer KCNJ3-F (SEQ ID NO.2): GGTTCCAAGCTTAAGCGGCCGCGCCACCATGTCGGCGCTGCGGAGGAAGCTGGGCGATGAGTACC Downstream primer KCNJ3-R (SEQ ID NO.3): tcagtagagagtgtcggatccTTATGTGAAGCGGTCGGAATTCATTTTTCTCAGTTTTGGAGGAA Detailed Implementation

[0023] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings.

[0024] 1. Detection of KCNJ3 gene expression in chicken breast muscle tissue by real-time quantitative PCR

[0025] 1.1 Expression of KCNJ3 in chicken breast muscle tissue The expression of the KCNJ3 gene in the pectoral muscle tissue at different developmental stages of the S3 (medium-growth yellow-feathered broiler) and F (fast-growth yellow-feathered broiler) strains was detected using qPCR. Figure 1 As shown, the expression level of the KCNJ3 gene in the pectoral muscle tissue of different breeds and at different developmental stages exhibits significant differences based on breed and development, indicating that the KCNJ3 gene is involved in the regulation of chicken pectoral muscle development.

[0026] 1.2 Expression of KCNJ3 in myoblasts of chicken breast muscle tissue The expression of the KCNJ3 gene during the proliferation and differentiation phases of primary chicken myoblasts was detected using qPCR. Figure 2 As shown, the expression level of the KCNJ3 gene in the proliferative phase of chicken primary myoblasts was significantly lower than that in the differentiation phase. P <0.05). This suggests that the KCNJ3 gene may play a role in promoting the development of chicken breast muscles.

[0027] KCNJ3 gene qPCR primers: Upstream primer (SEQ ID NO.4): 5'-ATTCCTCACACCAAACCTGCT-3' Downstream primer (SEQ ID NO.5): 5'- GGCAGGAAAAGAAAGCCCAAG-3'

[0028] 2. Construction of KCNJ3 gene expression vector plasmid (1) Based on the CDS sequence of KCNJ3 published in Genebank, primers were designed using ncbi primer. Homologous sequences flanking NotI and BamHI from the LV5 vector were added to the upstream and downstream primers of the KCNJ3 gene for subcloning of the vector. The primer sequences are as follows: Table 1 Primer sequences for the KCNJ3 gene

[0029] (2) Dissolve the primers in Table 1 in pure water to a concentration of 50 µM. Perform PCR reaction using the diluted primers. The specific system is as follows:

[0030] The loop condition is:

[0031] After the PCR reaction was completed, the chicken KCNJ3 overexpressing lentiviral gene fragment was recovered by Agarose electrophoresis and gel excision.

[0032] (3) The full-length CDS product of the KCNJ3 gene was digested with NotI and BamHI. The digestion system is as follows:

[0033] (4) The chicken KCNJ3 gene was cloned into vector LV5 (LV5 vector was provided by Suzhou Jima Biotechnology Co., Ltd.). Vector LV5 was digested with NotI and BamHI at 37℃ for 2 hours. The digestion system is as follows:

[0034] (5) Electrophoresis: The full-length CDS product of the chicken KCNJ3 gene and the LV5 vector were recovered using a DNA gel extraction kit. Using the ClonExpress® Entry One Step Cloning Kit, the amplified and recovered fragment was recombinantly cloned into the linearized LV5 vector. The reaction system is as follows:

[0035] Use a pipette to blow the mixture up and down several times to mix the components. After the reaction is complete, immediately place the reaction tube in an ice-water bath to cool for 5 minutes.

[0036] (7) Transform the ligation product into TOP10 competent cells, which were provided by Suzhou Jima Co., Ltd. Add 10 µl of recombinant ligation product to the competent cells, mix gently, and incubate on ice for 30 min; place the centrifuge tubes in a water bath preheated to 42 ℃ and let stand for 90 s, then quickly transfer to an ice bath to cool for 3 min; add 800 µl of antibiotic-free LB medium to each centrifuge tube, and transfer to a shaker at 37 ℃ and 250 r / min for 45 min to recover and culture; take 200 µl of the recovered bacterial solution and spread it evenly on an LB plate containing 50 µg / ml Ampicillin. After the liquid is completely absorbed, invert the plate and incubate at 37 ℃ for 16 h.

[0037] (8) Pick cloned colonies, extract plasmids and identify them, and select positive clones. Pick 4 single, plump colonies from the cultured plate and inoculate them into test tubes containing 5 ml of 50 µg / ml Ampicillin LB medium. Incubate at 37°C and 250 r / min on a bacterial shaker for 16 h. Take 200 µl of the cultured bacterial solution and preserve the remaining bacterial solution with glycerol. Extract plasmids using the Tiangen Biotech DP104-02 plasmid mini-extraction kit (see the kit instructions for details). Sequencing was performed by Suzhou Jima Co., Ltd. Subsequently, the extracted plasmids were identified by double enzyme digestion at 37°C. Prepare the total system:

[0038] Electrophoresis was performed 1 hour later. Clones that showed enzyme digestion bands at the corresponding positions of the target band were considered positive clones.

[0039] The sequencing results were compared with the target gene sequence, and the results were as follows: Figure 3 As shown, the sequence obtained from sequencing is completely identical to the sequence published in Genebank, indicating that the KCNJ3 gene expression vector plasmid was successfully constructed. The preserved glycerol bacterial culture was inoculated into LB medium for extensive plasmid extraction, yielding a sufficient quantity of recombinant plasmids. See the sequence comparison diagram below. Figure 3 .

[0040] 3. Virus Packaging and Collection (1) When the 293T cells have fused to about 50-60%, the constructed KCNJ3 gene expression vector plasmid and packaging plasmid (pGag / Pol, pRev, pVSV-G) are transfected into the cells together.

[0041] The transfection method is as follows: Take a sterile 5 mL centrifuge tube, add 1.5 mL of serum-free DMEM, 3 μL each of KCNJ3 gene expression vector plasmid and packaging plasmid (pGag / Pol, pRev, pVSV-G), and mix well; take another sterile 5 mL centrifuge tube, add 1.5 mL of serum-free DMEM, then add 200 μL of RNAi-Mate transfection reagent, mix well, and incubate at room temperature for 5 min. Then mix the two tubes and incubate at room temperature for 20-25 min to form a transfection mixture.

[0042] The transfection mixture formed above was then added to the cell culture medium containing 10% fetal bovine serum and incubated at 37°C in a 5% CO2 incubator for 4-6 hours. (2) Discard the transfection solution and add 10 mL of DMEM culture medium containing 10% FBS. Continue to incubate at 37℃ in a 5% CO2 incubator for 72 h.

[0043] (3) Collect the cell supernatant in the culture dish and centrifuge at 4℃, 4000 rpm for 4 min; filter the supernatant after centrifugation with a 0.45 μm filter; centrifuge the filtrate at 4℃, 20000 rpm for 2 h; collect the concentrate and aliquot it into 1.5 ml centrifuge tubes and store at -80℃.

[0044] (4) Virus titer detection: Take 10 μL of the lentivirus stock solution obtained in step (3), dilute it 10 times with DMEM culture medium of 10% FBS to make 5 gradients, add 100 μL of diluted virus solution to each well of a 96-well plate containing 293T cells, and set up a control group at the same time. Incubate at 37℃ and 5% CO2 for 24 h; discard the diluted virus solution in the 96-well plate, add 100 μL of DMEM culture medium of 10% FBS to each well, and continue to incubate at 37℃ and 5% CO2 for 72 h; calculate the virus titer by fluorescence microscopy in combination with the dilution factor, and find that the titer of the KCNJ3 lentivirus vector is 4*10^8.

[0045] 4. Expression of the lentiviral recombinant vector overexpressing the KCNJ3 gene in chicken primary myoblasts Using pectoral muscle tissue from 13-year-old high-quality broiler chickens as experimental material, pectoral muscle tissue from 3-4 high-quality broiler hens was used. The tissue was digested with collagenase I for 15 minutes, and digestion was terminated with twice the volume of high-glucose medium. The mixture was centrifuged at 4000 rpm for 10 minutes, and the supernatant was collected. The supernatant was filtered through 100-mesh, 400-mesh, and 600-mesh sieves, and the filtrate was centrifuged at 4000 rpm for 10 minutes. The supernatant was transferred to cell culture dishes and incubated at 37℃ in a 5% CO2 incubator for differential adhesion three times. After 40 minutes of incubation, the cell supernatant was transferred to new cell culture dishes and incubated at 37℃ in a 5% CO2 incubator. Once the cells reached 70% confluence, they were passaged and seeded into 12-well plates.

[0046] Once the cells reached approximately 50% confluence, transfection with the KCNJ3 gene lentiviral recombinant vector was performed. The original culture medium was aspirated from the culture dish and replaced with fresh medium. 20 μL of 4*10^8 titer KCNJ3 gene overexpression lentiviral vector and LV5 vector were transfected dropwise. After addition, the culture plate was gently shaken up and down, and then incubated at 37°C with 5% CO2. After 24 hours, the viral transfection solution was aspirated, fresh medium was replaced, and the cells were incubated for another 48 hours. Fluorescence was observed using an inverted fluorescence microscope. Figure 4 This preliminary result indicates that the KCNJ3 gene lentiviral recombinant vector has been successfully transfected into myoblasts. Further, myoblasts were collected, and total RNA was extracted. qPCR was used to detect the expression of KCNJ3 after transfection with the KCNJ3 gene lentiviral recombinant vector. The results are as follows: Figure 5 As shown, the expression of the KCNJ3 gene was significantly increased after transfection with the lentiviral recombinant vector, indicating that the lentiviral recombinant vector model of stable high expression of the KCNJ3 gene in chicken primary myoblasts was successfully constructed.

[0047] Furthermore, qPCR was used to detect the expression changes of the cell differentiation marker gene corresponding to the KCNJ3 gene in the lentiviral recombinant vector transfected with the KCNJ3 gene. The results are as follows: Figure 6 As shown, the expression of MyoD, MyoG, and Myomaker genes in the lentiviral transfection group was significantly higher than that in the control group (NC). p <0.01).

[0048] The above description is only a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. Any equivalent modifications or changes made by those skilled in the art based on the content disclosed in the present invention should be included within the scope of protection set forth in the claims.

Claims

1. A lentiviral recombinant vector stably overexpressing the KCNJ3 gene in chicken primary myoblasts, characterized in that, The KCNJ3 gene contains a full-length CDS sequence and an LV5 vector, and the KCNJ3 gene lentiviral recombinant vector can stably overexpress the KCNJ3 gene in primary chicken myoblasts.

2. The method for constructing the KCNJ3 gene lentiviral recombinant vector according to claim 1, characterized in that, Includes the following steps: Step 1: Obtain the full-length CDS amplification product of the chicken KCNJ3 gene using PCR. Step 2: Digest the full-length CDS amplification product of the KCNJ3 gene obtained in Step 1 with NotI and BamHI; Step 3: Digest the LV5 vector with NotI and BamHI; Step 4: Purify the enzyme digestion products from Step 2 and Step 3, and then directionally ligate the purified enzyme digestion products to obtain the ligation products. Step 5: Transform the ligation product from Step 4 into TOP10 competent cells, screen for positive clones and perform sequencing verification to obtain the KCNJ3 gene expression vector plasmid with the correct sequence. Step 6: The KCNJ3 gene expression vector plasmid obtained in Step 5 is subjected to ultrapure extraction. The extracted plasmid and the packaging plasmid are co-transfected into 293T cells for lentivirus packaging, collection and titer detection, thus obtaining the KCNJ3 gene lentiviral recombinant vector.

3. The construction method according to claim 2, characterized in that, Step 1 specifically includes: Step 1.1: Design primers based on the CDS sequence of the KCNJ3 gene published in GenBank. The CDS sequence of the KCNJ3 gene is shown in SEQ ID NO.

1. Add the homologous sequences of NotI and BamHI from the LV5 vector to the upstream and downstream primers, respectively. Step 1.2: Perform a PCR reaction using the primers. The PCR reaction system is as follows: 1 µl template, 10× Pfu Buffer (+Mg) 2+ 5µl of dNTP, 1µl of KCNJ3-F, 1µl of KCNJ3-R, 41µl of ddH2O, and 0.3µl of Pfu DNA polymerase; PCR cycling conditions were: 95℃ for 3 min, 1 cycle; 94℃ for 30 sec, 55℃ for 30 sec, and 72℃ for 30 sec, 30 cycles; and 72℃ for 5 min, 1 cycle. Step 1.3: After the PCR reaction is completed, the KCNJ3 gene fragment is recovered by agarose gel electrophoresis and gel excision.

4. The construction method according to claim 3, characterized in that, The primer sequences mentioned in step 1.1 are as follows: The sequence of the upstream primer KCNJ3-F is: GGTTCCAAGCTTAAGCGGCCGCGCCACCATGTCGGCGCTGCGGAGGAAGCTGGGCGATGAGTACC; The sequence of the downstream primer KCNJ3-R is: tcagtagagagtgtcggatccTTATGTGAAGCGGTCGGAATTCATTTTTCTCAGTTTTGGAGGAA.

5. The construction method according to claim 2, characterized in that, In step 4, the directional ligation was performed using the ClonExpress® Entry One Step Cloning Kit. The ligation reaction system consisted of: 4 µl of 5×CE EntryBuffer, 1 µl of KCNJ3 gene full-length CDS digestion and purification product, 2 µl of LV5 vector digestion and purification product, 2 µl of ExnaseEntry, and 11 µl of ddH2O. After the reaction was completed, the reaction tube was immediately placed in an ice-water bath to cool for 5 min.

6. The construction method according to claim 2, characterized in that, In step 5, the specific operation of transforming into TOP10 competent cells is as follows: add 10µl of ligation product to the competent cells, mix well, and incubate on ice for 30 min; heat shock in a water bath at 42℃ for 90 s, and quickly transfer to an ice bath for cooling for 3 min; add 800µl of antibiotic-free LB medium, and revive and culture on a shaker at 37℃ and 250r / min for 45 min; take 200µl of the revived bacterial solution and spread it on an LB plate containing 50µg / ml ampicillin, and culture at 37℃ for 16 h.

7. The construction method according to claim 2, characterized in that, The packaging plasmids mentioned in step 6 are pGag / Pol, pRev, and pVSV-G.

8. The construction method according to claim 2, characterized in that, The specific procedure for co-transfection is as follows: When 293T cells reach 50%-60% confluence, add 3 μL each of the KCNJ3 gene expression vector plasmid and packaging plasmid to 1.5 mL of serum-free DMEM and mix well; take another 1.5 mL of serum-free DMEM, add 200 μL of RNAi-Mate transfection reagent and mix well. After incubating at room temperature for 5 min, mix the two tubes and incubate at room temperature for 20-25 min to form a transfection mixture; add the transfection mixture to the cell culture medium and incubate at 37℃ in a 5% CO2 incubator for 4-6 h; then aspirate the transfection solution, add DMEM culture medium containing 10% FBS, and continue culturing at 37℃ in a 5% CO2 incubator for 72 h; Centrifuge at 4℃ and 4000rpm for 4 min; filter the supernatant after centrifugation using a 0.45μm filter; centrifuge the filtrate at 4℃ and 20000rpm for 2 h, collect the concentrate, and store at -80℃ to obtain the KCNJ3 gene lentiviral recombinant vector.

9. The application of the KCNJ3 gene lentiviral recombinant vector according to claim 1 in the overexpression of the KCNJ3 gene in chicken primary myoblasts.

10. The application of the KCNJ3 gene lentiviral recombinant vector according to claim 1 in the preparation of an in vitro expression model for studying the regulation of chicken muscle development.