A method for processing a sample and use in detecting pathogenic microorganisms

Abstract

The application discloses a sample processing method and application in detection of pathogenic microorganisms, and belongs to the technical field of molecular biology pathogen detection. The sample processing comprises the following steps: placing the sample into a screw-closed grinding tube with 0.5mm particle size glass grinding beads, homogenizing the broken wall at a high-speed bead mill of 6.0m / s for 40s, instant low-speed centrifugation after the completion of the broken wall, and throwing the residual liquid on the tube wall; adding guanidine salt lysis solution and proteinase K solution into the tube, fully mixing, and placing in a 56 DEG C constant temperature oscillation incubator; performing DNA and RNA nucleic acid extraction and purification by using a magnetic bead co-extraction method to obtain a mixed nucleic acid template. The nucleic acid template obtained through the processing steps can be directly subjected to RT-qPCR. The application adopts a closed hierarchical targeted broken wall and in-situ lysis process, takes into account differential lysis of various pathogens and synchronous nucleic acid preservation, can synchronously detect four types of high-risk pathogens in a single tube, has safety, detection precision and screening efficiency, and is suitable for rapid quarantine and prevention and control requirements.

Description

Technical Field

[0001] This invention relates to the field of molecular biology pathogen detection technology, specifically to a sample processing method and its application in detecting pathogenic microorganisms. Background Technology

[0002] Cross-border vectors such as rodents, ticks, fleas, and mosquitoes are frequently active. These imported vectors commonly exhibit mixed infections and multiple co-carrying characteristics. Bartonella, Echinococcus tapeworm, poliovirus, and Tulafota are all high-risk zoonotic pathogens under key control at ports of entry, exhibiting strong concealment and high risk of importation, making them key and challenging areas for public health security control at ports. These four pathogens belong to three major categories: bacteria, parasites, and RNA viruses, with significant differences in pathogen structure and nucleic acid type. Furthermore, the common co-carrying and latent infection characteristics of imported vectors place extremely high demands on sample pretreatment and simultaneous detection technologies.

[0003] Currently, the mainstream pathogen screening at ports still adopts a single pathogen, single-item detection model. The supporting traditional sample pretreatment techniques have many inherent technical shortcomings and cannot adapt to the integrated testing requirements of four-in-one detection: First, the pathogen lysis adaptability is poor. Echinococcus tapeworm eggs and larvae have a tough cuticle layer, and conventional chemical lysis and heat lysis cannot achieve complete cell wall disruption, resulting in low nucleic acid release efficiency. High-intensity mechanical lysis, on the other hand, causes degradation of poliovirus RNA, making it impossible to simultaneously achieve parasite cell wall disruption and RNA virus preservation. Second, the nucleic acid extraction systems are incompatible. Traditional techniques only support single DNA or single RNA extraction and cannot simultaneously preserve bacterial, parasite DNA, and viral RNA, requiring separate and multiple processing steps. The methods for simultaneous testing in a single tube are problematic due to several factors. First, they present challenges such as sample loss, operational errors, and high risks of cross-contamination, making it difficult to identify mixed infections. Second, there is a significant conflict between biosafety and testing performance. Tulafos is a Class II highly pathogenic bacterium, and conventional open grinding and vortexing processes can easily generate aerosols, posing a risk of laboratory infection. Furthermore, strong inactivation processes can easily damage nucleic acid integrity, leading to decreased detection sensitivity. Third, the pathogen matrix causes severe interference. The bodies of pathogenic organisms contain a large amount of PCR inhibitors such as pigments, polysaccharides, and proteins. Traditional simple boiling and crude extraction methods result in a large amount of residual impurities, which can easily lead to multiplex amplification inhibition and nonspecific amplification, causing false negatives and Ct value deviations. The detection precision and sensitivity cannot meet the CLSI international standards.

[0004] In summary, existing single pretreatment technologies for different pathogenic microorganism samples cannot achieve integrated and highly safe pretreatment of four cross-category high-risk pathogens, which seriously restricts the simultaneous and rapid screening of multiple diseases at ports, accurate identification of mixed infections, and precise prevention and control of imported risks. Summary of the Invention

[0005] The purpose of this invention is to address the aforementioned problems in the prior art by providing a sample processing method that is applicable to integrated nucleic acid preprocessing and screening of multiple pathogenic microorganisms.

[0006] The technical solution of this invention is as follows: In a first aspect, the present invention provides a sample processing method, comprising the following steps: (1) Pretreatment: After removing impurities, the sample is transferred to a screw-sealed grinding tube containing 0.5 mm glass grinding beads, sterile RNase-free PBS is added, and the tube is sealed. (2) Closed-loop cell disruption: The grinding tube is placed in a high-speed bead mill and homogenized for 40 seconds at a speed of 6.0 m / s. After the cell disruption is completed, the tube is centrifuged at a low speed to remove the residual liquid from the tube wall. (3) Inactivation and digestion: Add guanidine salt lysis buffer and proteinase K solution to the tube, mix thoroughly, and incubate at 56°C with constant temperature shaking to inactivate the pathogen and digest the impurities in the sample, releasing nucleic acid; (4) Nucleic acid extraction: DNA and RNA nucleic acid were extracted and purified using magnetic bead co-extraction method to obtain mixed nucleic acid template and complete sample processing.

[0007] Optionally or preferably, the instantaneous low-speed centrifugation condition is centrifugation at 1000~3000 rpm for 3~5 seconds.

[0008] Optionally or preferably, the guanidine salt lysis buffer contains 4.5 M guanidine thiocyanate, 50 mM Tris-HCl at pH 6.4, 20 mM EDTA, and 1% (v / v) Triton X-100; the proteinase K solution contains 20 mg / mL proteinase K, 20 mM Tris-HCl at pH 7.5, and 1 mM CaCl2.

[0009] Optionally or preferably, the screw-sealed grinding tube is 2 mL in size, the glass grinding beads are added at a rate of 50 mg / tube, and the amounts of sterile RNase-free PBS, guanidine salt lysis buffer, and proteinase K solution added are 400 μL, 200 μL, and 20 μL, respectively.

[0010] Optionally or preferably, after step (2) is completed, the process is cooled before proceeding to step (3).

[0011] Secondly, the present invention also provides the application of any of the above-described methods in the detection of pathogenic microorganisms, for detecting biological samples infected with mixed pathogenic microorganisms, the mixed pathogenic microorganisms including bacteria, parasites and RNA viruses.

[0012] Optionally or preferably, the mixed pathogenic microorganisms include Bartonella, Echinococcus tapeworm, poliovirus, and Tulafos.

[0013] Optionally or preferably, the nucleic acid template obtained after sample processing is used for one-step RT-qPCR to detect pathogenic microorganisms. The target sequences corresponding to the detection primer and probe sequences used for Bartonella, Echinococcus tapeworm, poliovirus, and Tulafos are as follows: Bartonella henselae (Bh) target sequence: SEQ ID NO:1; Bartonella quintana (Bq) target sequence: SEQ ID NO:2; Echinococcus granulosus (CE) target sequence: SEQ ID NO:3; Target sequence of Echinococcus multilocularis (AE): SEQ ID NO:4; Poliovirus (Pv) target sequence: SEQ ID NO:5; Francisella tularensis (Ft) target sequence: SEQ ID NO:6.

[0014] The optional or preferred primer and probe sequences for detecting Bartonella, Echinococcus tapeworm, poliovirus, and Tulafos are as follows: Hanseatic bartonite: SEQ ID NO:7~9; Bartonella pentaphyllum: SEQ ID NO:10~12; Echinococcus granulosus: SEQ ID NO:13~15; Echinococcus multilocularis: SEQ ID NO:16~18; Echinococcus tapeworm: SEQ ID NO:19~21; Poliovirus: SEQ ID NO: 22~24; Tulafoss: SEQ ID NO:25~27.

[0015] Compared with the prior art, the present invention has the following beneficial effects: Existing technologies, when detecting samples infected with multiple types of pathogens, often require separate processing for each pathogen type, failing to address both simultaneously. The sample processing method of this invention performs medium-intensity, short-duration (0.5mm glass beads + 6.0m / s for 40s) bead milling in a single, sealed screw-top grinding tube, achieving a triple harmony of "parasite cell disruption, intracellular bacterial release, and RNA preservation." This effectively breaks down the tough cuticle of Echinococcus tapeworms and the host cell membrane, releasing intracellular parasites such as Bartonella and Tulafota, while avoiding excessive mechanical shearing that could cause poliovirus RNA breakage. Furthermore, the grinding is performed within a sealed tube, significantly reducing the risk of aerosol diffusion of Tulafota and Bartonella. After grinding, aerosol-like liquid adheres to the tube wall; a brief, low-speed centrifugation to dissipate this liquid to the bottom of the tube further reduces aerosol diffusion. Since the pressure inside the tube rises after the bead milling is completed, it is best to cool it down briefly before slowly opening the cover and performing step (3) to further reduce the risk of aerosols.

[0016] After grinding, there is no need to transfer the sample. Guanidine salt lysis buffer (guanidine thiocyanate) and proteinase K are added directly in situ. The free nucleic acids and released viruses generated during grinding can be immediately encapsulated by high concentrations of guanidine thiocyanate, inhibiting RNase and preventing the degradation of poliovirus RNA. The fragmented pathogen cells are immediately exposed to the inactivation system, significantly reducing the biosafety risks of Tulafos and Bartonella aerosols. After Echinococcus tapeworm fragmentation, cuticle fragments simultaneously enter the lysis environment, and proteinase K fully digests the keratin, further improving the efficiency of parasite nucleic acid release. This invention forms a synergistic and balanced system through moderate-intensity short-time closed bead milling + immediate guanidine salt enzyme inhibition protection after grinding + moderate isothermal digestion at 56°C. It simultaneously solves the pretreatment needs of three types of pathogens that conflict with each other. Combined with magnetic bead co-extraction, it achieves co-extraction in one tube, eliminating the need for sample separation and reducing sample loss and human contamination. It meets the needs of simultaneous rapid screening of multiple diseases at ports and can support simultaneous detection of four pathogens in a single tube. Attached Figure Description

[0017] Figure 1 To examine the amplification curve of the detection limit of Hensey Bartonella, eight parallel replicates were used.

[0018] Figure 2 To examine the amplification curves of Hanselbarton, eight parallel replicates were used.

[0019] Figure 3 To examine the specific amplification curves of Bartonella henselae, four parallel replicates were used.

[0020] Figure 4 To examine the amplification curve of the five-day Bartonella detection limit, eight parallel replicates were used.

[0021] Figure 5To examine the amplification curves of the five-day heat Bartonella, eight parallel replicates were used.

[0022] Figure 6 To examine the specific amplification curves of Bartonella quintillosa, four parallel replicates were used.

[0023] Figure 7 To examine the amplification curve of the detection limit of Echinococcus multilocularis, eight parallel replicates were used.

[0024] Figure 8 To examine the amplification curves of Echinococcus multilocularis tapeworm precision, eight parallel replicates were used.

[0025] Figure 9 To examine the specific amplification curves of Echinococcus multilocularis, four parallel replicates were used.

[0026] Figure 10 To examine the amplification curve of the detection limit of Echinococcus granulosus, eight parallel replicates were used.

[0027] Figure 11 To examine the amplification curves of Echinococcus granulosus for precision, eight parallel replicates were used.

[0028] Figure 12 To examine the specific amplification curves of Echinococcus granulosus, four parallel replicates were used.

[0029] Figure 13 To examine the amplification curve of the detection limit of poliovirus, eight parallel replicates were used.

[0030] Figure 14 To examine the amplification curves for the precision of poliovirus, eight parallel replicates were used.

[0031] Figure 15 To examine the specific amplification curves of poliovirus, four parallel replicates were used.

[0032] Figure 16 To examine the amplification curve of the detection limit of *Tulafossa*, eight parallel replicates were used.

[0033] Figure 17 To examine the amplification curves for the precision of *Tulafos*, eight parallel replicates were used.

[0034] Figure 18 To examine the specific amplification curves of *Tulafossa*, four parallel replicates were used.

[0035] Figure 19 This is an amplification curve for a mixed sample of four pathogens.

[0036] In the diagram, the orange line represents Bartonella, the green line represents Tulafossa, the red line represents Echinococcus tapeworm, and the blue line represents poliovirus. Detailed Implementation

[0037] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all of them. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial sources. All operations in the embodiments strictly comply with biosafety regulations.

[0038] Part 1: Materials, Reagents, and Composition: (1) Sterile RNase-free PBS buffer (pH 7.2~7.4): Components: NaCl 8.0g / L, KCl 0.2g / L, Na2HPO4 1.44g / L, KH2PO4 0.24g / L, prepared with DEPC water and autoclaved, single use 400μL.

[0039] (2) Guanidine salt lysis buffer: 4.5M guanidine thiocyanate, 50mM Tris-HCl (pH 6.4), 20mM EDTA, 1% (v / v) Triton X-100, single dose 200μL.

[0040] (3) Proteinase K solution: storage concentration 20 mg / mL, solvent is 20 mM Tris-HCl (pH 7.5) and 1 mM CaCl2, single use volume 20 μL.

[0041] (4) Solid grinding media: sterile glass grinding beads with a particle size of 0.5 mm, 50 mg / tube.

[0042] (5) Nucleic acid co-extraction and purification reagents: Total nucleic acid (DNA+RNA) co-extraction kit using magnetic beads (commercially available). The kit includes washing buffer 1 and washing buffer 2, with a single-step volume of 500 μL; RNase-free elution buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA), with an elution volume of 40 μL.

[0043] (6) RT-qPCR system (20 μL): 2×One Step RT-qPCR Probe Master Mix 10.0 μL, containing hot-start Taq enzyme, M-MLV reverse transcriptase, RNase inhibitor, UDG anti-contamination system, dNTPs, magnesium ions, PCR buffer system and stabilizer; primer mixture (10 μM) 1.6 μL; four-channel specific probe mixture (4 μM) 1.0 μL; RNase-free pure water 5.0 μL; mixed nucleic acid template 2.0 μL.

[0044] Pathogenic microorganism targets and corresponding primer and probe sequences: 1. Bartonoid, Bh Upstream primer F: gcaaacggtttatcccccac (SEQ ID NO:7) Probe P: HEX-acaggcccagagaaaaaccggg-BHQ1 (SEQ ID NO:8) Downstream primer R: cgtctctcaagtttcttatcacgc (SEQ ID NO:9); Target sequence: ctgaatattttttttcaatttacgatctcgcaaacggtttatcccccacaagatagggaggggtacaaaaatacaggcccagagaaaaaccgggagggaaaatatcagataaccaataccattccatctgactccacccaacatctgtgttt cactcaatatatgcatgagagacattgccaaaacaggagaccctacaaccattataatgaggaatatagagagcgtgataagaaacttgagagacgcttttttattatttttcaatgtataatttttcaacgaaaacacccttgtttt (seq ID NO:1).

[0045] 2. Barton body, Bq Upstream primer F: taagtgccctgtggtttgca (SEQ ID NO:10) Probe P: HEX-cctgtggaatctgcgcccgg-BHQ1 (SEQ ID NO:11) Downstream primer R: atgggggtttgcatacctgg (SEQ ID NO:12); Target sequence: aaatgccggtcccgatgccaaatggaatttaagtgccctgtggtttgcagctatctgcgtttttgttattattgggggtacttggtgggctatttcccatttgaattataatatgatgggtagttcagggcgtgttattgagccagaaaaacagttatcgggcgaaaacatacctgtgcggaaactgccaagtatgcgagttcctgtggaatctgcgcccggttctgaaatgcctgtggggcaagtaccaggtatgcaaacccccatagaacttgcacctaactctgaaacgttggtgga (SEQ ID NO: 2).

[0046] 3. *Echinococcus granulosus*, CE Forward primer F: aagggccctaacaaggttgg (SEQ ID NO: 13), Probe P: ROX-tggtttgttgcagaggtttgctga-BHQ2 (SEQ ID NO: 14), Reverse primer R: ggcagccaaaaaccacaaca (SEQ ID NO: 15); Target sequence: ccttttttgttttaggggagcgtaaggttttgggctattctcagtctcgtaagggccctaacaaggttggtgtaattggtttgttgcagaggtttgctgatctattgaagttggtaattaagtttaagtgtttttacttccaaagtcgtaggtatgttggtttgtttggtgttgtgttattaatggctttggtgattgtttattcatttatttatggtagatattatagagctagttatagaggcctctccgtgttgtggtttttggctgccgccagaacatctaggtattctttgttgt (SEQ ID NO: 3).

[0047] 4. *Echinococcus multilocularis*, AE Forward primer F: tggggagtctgaaagggagt (SEQ ID NO: 16), Probe P: ROX-tggttggtggtggttttgttggt-BHQ2 (SEQ ID NO: 17), Downstream primer R: cgaacacgaggtaacgttgc (SEQ ID NO:18); Target sequence: ctatgtgagactaatcgtataccatttgattatggggagtctgaaagggagttagttagtgggtttaatgttgagtatagcggtatatactttacgtgtttgtttgcttgtgagtatatagttgtatatgtgttttcatggttgattgttgt aatgatggttggtggtggttttgttggtttgtttatgttgttgtttaatttattattttttatgtgagctcgggcaacgttacctcgtgttcgttatgatttatttgtgaaatttttctgagaggtttgtttatgtttactgatttta (seq ID NO:4).

[0048] 5. Poliomyelitis (Pv) Upstream primer F: ggctgatgagtctgggcatt (SEQ ID NO:19) Probe P: Pacific Blue-cgttggcggcctacccatgg-Dabcyl (SEQ ID NO: 20), Downstream primer R: gcgttacgacaagctaccct (SEQ ID NO:21); Target sequence: cgttgcgctcagcactctaccccgagtgtagcttaggctgatgagtctgggcattccccaccggtgacggtggcccaggctgcgttggcggcctacccatggctaacgccatgggacgctatttgtgaacaaggtgtgaagagcctattgag ctacctaagagtcctccggcccctgaatgcggctaatcccaaccacggagcaagtgccttcaacccagagggtagcttgtcgtaacgcgcaagtctgtggcggaaccgactactttgggtgtccgtgtttccttttatttttattgtg (seq ID NO:5).

[0049] 6. Tulafossilella, Ft Upstream primer F: gcgctttgactaacaaggaca (SEQ ID NO:22) Probe P: FAM-actctccatcaggtgctggtgct-BHQ1 (SEQ ID NO:23) Downstream primer R: acctaaaccagcaaatactctacca (SEQ ID NO:24); Target sequence: gttttgcagctaataatttcattgctccttttgcaaatacttatagcgctttgactaacaaggacaatacttggggtcctcaagatagaactggccagtggtacttaggtgtagatgctaacggtct agctggaactcctaactctccatcaggtgctggtgctaacttcacaatcggttataacatcaataaatacttcgctgtacagtacaaccaattagttggtagagtatttgctggtttaggtga (seq ID NO:6).

[0050] Part Two: Examination of Primer / Probe Specificity, Precision, and Detection Limit Positive plasmids were prepared using six target sequences from the four types of pathogens (Bartonella, Echinococcus granulosus, poliovirus, and Tulafos) in Part 1, and the primer and probe specificity, precision, and detection limit were investigated.

[0051] 1. Specificity: A 4-channel real-time fluorescent PCR detection system was used. Positive plasmid templates for four pathogens were added separately, and each template was tested using a single-template, individual sample addition method. That is, only one pathogen template was added to each reaction system, and each template was set up in 4 parallel replicates. At the same time, a near-pathogen control group and a negative control were set up. After amplification, the amplification curves and Ct values ​​of the four fluorescent channels were observed simultaneously to verify the cross-reactivity of the reagents.

[0052] Similar pathogens to Bartonella henselae: Rickettsia, Anaplasma phagocytosis, Brucella; Similar pathogens to Bartonella fever-like bacteria: Rickettsia, Anaplasma phagocytosis, Brucella; Similar pathogens to Echinococcus granulosus: Taenia solium and Taenia bovis; Similar pathogens to Echinococcus multilocularis: Taenia solium and Taenia bovis; Similar pathogens to poliovirus: Enterovirus 71, Coxsackievirus, Echovirus; Similar pathogens to Tulafoss: the new culprit Francisella, Mirage Francisella, Brucella.

[0053] 2. Precision (Reproducibility): Referring to CLSI EP5-A2 "Precision performance evaluation of quantitative measurement methods; Approval Guideline - Second Edition", positive plasmids of four pathogens at weak positive concentration levels were selected as samples for precision validation. Eight parallel tests were performed, and the results were statistically analyzed. The positive concordance rate of the sample test results should be 100%, and the intra-assay imprecision (CV) result of the Ct value should not exceed 5.00%.

[0054] 3. Limit of Detection (Sensitivity): Based on the theoretical lower limit of detection of molecular PCR technology, and after reviewing literature, existing similar products, and the intended use of the kit, the limit of detection is determined to be 1000 copies / mL, which is currently the standard limit of detection for similar products, while meeting the detection requirements. In this experiment, the template loading volume is 2μL, and the theoretical template input amount for a single reaction is 2 copies. This low template amount is used to verify the minimum detection capability of the system. If the positive detection rate is higher than 95%, this concentration can be set as the limit of detection concentration.

[0055] Test results as follows Figures 1-18 As shown, this demonstrates that the primers and probes of the present invention have very high specificity and can effectively distinguish between the target pathogen and similar pathogens.

[0056] Part Two: Processing and Verification of Detection Efficacy for Mixed Infection Samples 1. Preparation of positive samples from multiple mixed infections Positive samples from multiple mixed infections were prepared by artificial compounding of inactivated pathogenic microorganism standards and negative vector biological matrix.

[0057] Negative vector substrate: Healthy rodent tissue free from Bartonella, Echinococcus granulosus, Tulafos, and poliovirus nucleic acid contamination was used as a blank substrate; Bartonella henselae (Bh) cells, inactivated Echinococcus granulosus (CE) larvae, inactivated Tulafossa (Ft) cells, and inactivated poliovirus (Pv) virus.

[0058] The above four types of inactivated pathogens were uniformly diluted to the same copy concentration gradient (10) using inactivated RNase-free pure water. 3 ~10 4 (Copies / mL), and equal volumes of the above four types of inactivated pathogen diluents were taken and thoroughly vortexed according to the ratio of Bh:CE:Ft:Pv=1:1:1:1, and added to the blank matrix to simulate positive samples of vector organisms with natural multiple mixed infections.

[0059] 2. Sample processing (1) Pretreatment: Transfer the positive samples of multiple mixed infections to a closed grinding tube with RNase-free screw cap containing 50mg of sterile 0.5mm glass grinding beads, add 400μL of sterile RNase-free PBS buffer, tighten the cap to completely seal and prevent subsequent aerosol leakage.

[0060] (2) Closed-loop graded targeted cell disruption: Place the grinding tube in a high-speed bead mill and set the parameters to 6.0 m / s and 40 s for homogenization and disruption; after grinding, centrifuge at 2000 rpm for 3-5 s, throw the liquid adhering to the tube wall to the bottom of the tube, and then let it stand at room temperature for 1 min to cool.

[0061] (3) In-situ lysis and digestion: Without transferring the sample, add 200 μL of guanidine salt lysis buffer and 20 μL of proteinase K directly into the sealed grinding tube in situ, and vortex thoroughly to mix; incubate at 56℃ with shaking for 25 min. This step can rapidly inactivate highly pathogenic pathogens such as Tularemia and strongly inhibit RNase, while fully digesting tapeworm keratin and sample miscellaneous proteins, and simultaneously preserving the integrity of DNA and RNA nucleic acids.

[0062] (4) Gradient purification of nucleic acid: After incubation, all liquid phases were aspirated and DNA / RNA were extracted simultaneously using magnetic bead method. The mixture was washed with washing buffer 1 to remove macromolecular proteins and polysaccharide inhibitors, and with washing buffer 2 to remove salt ions and guanidine salt residues. The mixture was then air-dried at room temperature to remove ethanol residues. Finally, 40 μL of RNase-free elution buffer was used to elute the mixture to obtain a high-purity DNA / RNA mixed nucleic acid template.

[0063] (5) Template preservation: The eluted nucleic acid template is temporarily stored on ice and RT-qPCR amplification is completed within 2 hours to avoid RNA degradation and ensure detection accuracy.

[0064] 3. One-step RT-qPCR The PCR amplification program was performed using an RT-qPCR system (with 2 μL of the template treated above added): (1) Reverse transcription stage: 50℃ for 10 min (to complete the reverse transcription of poliovirus RNA); (2) Pre-denaturation stage: 95℃ for 30s; (3) Amplification cycle stage: 95℃ for 10s, 60℃ for 30s (collect fluorescence), for a total of 40 cycles.

[0065] After amplification, the instrument automatically generates an amplification curve and Ct value for result interpretation.

[0066] The results are as follows Figure 19 As shown, the four types of pathogenic microorganisms each exhibit their own unique curves, indicating that the sample processing effect is good and that nucleic acid release and extraction can meet the amplification and detection requirements.

[0067] The method of this invention enables the detection of four cross-category pathogens through single-sample pretreatment and simultaneous amplification in one tube. It can replace the traditional multi-tube split and multi-stage detection mode, and the detection cycle is reduced to less than 2 hours, which is suitable for the work requirements of high-frequency customs clearance, rapid quarantine and immediate handling at ports.

[0068] This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of ​​the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. A sample processing method, characterized in that, Includes the following steps: (1) Pretreatment: After removing impurities, the sample is transferred to a screw-sealed grinding tube containing 0.5 mm glass grinding beads, sterile RNase-free PBS is added, and the tube is sealed. (2) Closed-loop cell disruption: The grinding tube is placed in a high-speed bead mill and homogenized for 40 seconds at a speed of 6.0 m / s. After the cell disruption is completed, the tube is centrifuged at a low speed to remove the residual liquid from the tube wall. (3) Inactivation and digestion: Add guanidine salt lysis buffer and proteinase K solution to the tube, mix thoroughly, and incubate at 56°C with constant temperature shaking to inactivate the pathogen and digest the impurities in the sample, releasing nucleic acid; (4) Nucleic acid extraction: DNA and RNA nucleic acid were extracted and purified using magnetic bead co-extraction method to obtain mixed nucleic acid template and complete sample processing.

2. The sample processing method according to claim 1, characterized in that, The instantaneous low-speed centrifugation conditions are 1000~3000 rpm for 3~5 seconds.

3. The sample processing method according to claim 1, characterized in that, The guanidine salt lysis buffer contains 4.5 M guanidine thiocyanate, 50 mM Tris-HCl at pH 6.4, 20 mM EDTA, and 1% (v / v) Triton X-100; the proteinase K solution contains 20 mg / mL proteinase K, 20 mM Tris-HCl at pH 7.5, and 1 mM CaCl2.

4. The sample processing method according to claim 3, characterized in that, The screw-sealed grinding tubes are 2 mL in size. The amount of glass grinding beads added is 50 mg / tube. The amounts of sterile RNase-free PBS, guanidine salt lysis buffer, and proteinase K solution added are 400 μL, 200 μL, and 20 μL, respectively.

5. The sample processing method according to claim 1, characterized in that, After step (2) is completed, the product is cooled before proceeding to step (3).

6. The application of the method according to any one of claims 1 to 5 in the detection of pathogenic microorganisms, characterized in that, Biological samples used to detect infections with mixed pathogens, including bacteria, parasites, and RNA viruses.

7. The application according to claim 6, characterized in that, The mixed pathogenic microorganisms include Bartonella, Echinococcus tapeworm, poliovirus, and Tulafos.

8. The application according to claim 7, characterized in that, The nucleic acid templates obtained after sample processing were used for one-step RT-qPCR to detect pathogenic microorganisms. The target sequences corresponding to the primer and probe sequences used for detecting Bartonella, Echinococcus tapeworm, poliovirus, and Tulafos are as follows: Hanseatic arthropod target sequence: SEQ ID NO:1; Bartonella quintillione target sequence: SEQ ID NO:2; Echinococcus granulosus target sequence: SEQ ID NO:3; Target sequence of Echinococcus multilocularis: SEQ ID NO:4; Poliovirus target sequence: SEQ ID NO:5; Tulafollicle target sequence: SEQ ID NO:

6.

9. The application according to claim 8, characterized in that, The primer and probe sequences used for detecting Bartonella, Echinococcus tapeworm, poliovirus, and Tulafos are as follows: Hanseatic bartonite: SEQ ID NO:7~9; Bartonella pentaphyllum: SEQ ID NO:10~12; Echinococcus granulosus: SEQ ID NO:13~15; Echinococcus multilocularis: SEQ ID NO:16~18; Echinococcus tapeworm: SEQ ID NO:19~21; Poliovirus: SEQ ID NO: 22~24; Tulafoss: SEQ ID NO:25~27.

Images