A rapid and efficient anti-tumor mRNA vaccine analysis and detection method and application thereof

CN122811338APending Publication Date: 2026-09-25NANJING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611233803.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2026-05-28
Filing Date
2026-08-14
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

[0005]针对上述问题,本发明首次提出一种基于接力式双引擎Cas12a系统与PER反应耦合的三重信号放大检测策略,用于抗肿瘤mRNA疫苗的高灵敏、高特异性分析,克服了传统单一Cas12a系统信号放大能力有限、难以实现双模态输出的不足

Benefits of technology

(1)三重信号放大,显著提升检测灵敏度

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811338A_ABST
    Figure CN122811338A_ABST
Patent Text Reader

Abstract

The application discloses a kind of fast and efficient anti-tumor mRNA vaccine analysis detection method and its application, the method constructs the double-engine relay activation mechanism with time sequence logic: first engine is mediated by full-length crRNA, second engine is formed based on programmable split crRNA and split-DNA assembly, and two engines are started in turn. Coupling the relay double-engine Cas12a system with primer exchange reaction (PER), in the presence of target, PER performs the first signal amplification, and its product activates the first engine and the second engine Cas12a in turn, completes the second and third signal amplification, significantly improves the detection sensitivity and specificity. At the same time, dual-mode signal output of fluorescence and test strip is adopted to ensure the detection accuracy. The whole reaction is completed in a single tube, and the operation is simple and fast, which provides a new technology for the screening and pharmacokinetic study of anti-tumor mRNA vaccine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines and its applications. Background Technology

[0002] Cancer is a major disease that seriously threatens human health, with lung cancer being one of the malignant tumors with the highest incidence and mortality rates. Traditional cancer treatments mainly include surgery, chemotherapy, and radiotherapy, but these methods are often accompanied by significant adverse reactions and limitations. In recent years, immunotherapy, by recognizing tumor-specific antigens and activating the body's immune response, has opened up new directions for cancer treatment. In particular, the rapid development of mRNA vaccines has shown great potential in the field of cancer treatment. Currently, mRNA vaccines targeting malignant tumors such as lung cancer have entered multiple clinical trial phases. Highly sensitive and real-time monitoring of the mRNA levels of key antigens in mRNA vaccines has important scientific value for efficacy evaluation, toxicity testing, and pharmacokinetic studies.

[0003] CRISPR technology, with its powerful gene-editing capabilities, is gradually demonstrating transformative potential in the fields of biosensing and rapid detection. Among them, the Cas12a protein not only possesses targeted cleavage activity but also unique trans-cleavage capabilities, enabling ultrasensitive recognition and signal amplification of target molecules, laying the foundation for the development of next-generation high-sensitivity biosensing technologies. However, traditional Cas12a detection systems mostly rely on full-length crRNA and Cas12a protein forming a single functional unit. This results in a fixed system structure and a single signal output mode, making it difficult to achieve multiple signal amplification and diverse outputs. Furthermore, since most detection targets are DNA analytes, the sensitivity and specificity for RNA, especially mRNA, still need improvement.

[0004] Primer exchange reaction (PER) is an emerging isothermal nucleic acid signal amplification technique that enables efficient signal amplification under isothermal conditions. However, there are no reports in the current technology of effectively coupling PER with the Cas12a system to construct a multiple signal amplification strategy for mRNA vaccine detection.

[0005] To address the aforementioned issues, this invention proposes for the first time a triple signal amplification and detection strategy based on a relay-type dual-engine Cas12a system coupled with PER reaction, for high-sensitivity and high-specificity analysis of anti-tumor mRNA vaccines, overcoming the shortcomings of traditional single Cas12a systems, such as limited signal amplification capability and difficulty in achieving dual-modal output.

[0006] Therefore, it is necessary to develop a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines and its applications. Summary of the Invention

[0007] The purpose of this invention is to provide a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines and its applications.

[0008] To achieve the above-mentioned objectives, the technical solution adopted in this application is as follows: Firstly, this application provides a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines.

[0009] Secondly, this application provides a signal amplification system for implementing the method.

[0010] Thirdly, this application provides a method for the application of in preparing kits for screening, evaluating efficacy, detecting toxicity, or analyzing pharmacokinetics of antitumor mRNA vaccines.

[0011] Fourthly, this application provides the application of a signal amplification system in the preparation of kits for screening, evaluating efficacy, detecting toxicity, or analyzing pharmacokinetics of antitumor mRNA vaccines.

[0012] Fifthly, this application provides a kit for detecting anti-tumor mRNA vaccines, comprising a signal amplification system and a reporter molecule for outputting a detection signal.

[0013] The first aspect of this application provides a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines, comprising the following steps: contacting the sample to be tested with a primer exchange reaction system to trigger the first signal amplification and generate an intermediate product; The intermediate product is brought into contact with a Cas12a detection system, which includes a first Cas12a activation unit guided by full-length crRNA. The second Cas12a activation unit is formed by the assembly of programmable splitting crRNA and split-DNA; The intermediate product sequentially and selectively activates the first Cas12a activation unit and the second Cas12a activation unit to achieve the second and third signal amplification; The second Cas12a activation unit can only be activated after the first Cas12a activation unit has been activated and completed its reverse cutting function.

[0014] Furthermore, the primer exchange reaction system includes: a DB strand capable of forming a dumbbell-shaped hairpin structure, primers, and a DNA polymerase with strand displacement activity, the nucleotide sequence of the DB strand being shown in SEQ ID NO:1.

[0015] Furthermore, the nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:5.

[0016] Furthermore, the target mRNA is the NY-ESO antigen mRNA in the lung cancer mRNA vaccine, and the nucleotide sequence of the detection target region of the NY-ESO antigen mRNA is as shown in SEQ ID NO:6.

[0017] A second aspect of this application provides a signal amplification system for implementing the method, the characteristic signal amplification system comprising: The primer exchange reaction module is used to generate intermediate products in the presence of the target, thereby achieving the first signal amplification; The relay-type dual-engine Cas12a module includes: The first engine: composed of Cas12a protein and full-length crRNA; The second engine consists of Cas12a protein, splitting crRNA, rRNA, and split-DNA. The system is configured such that intermediate products prioritize activating the first engine, and the second engine is only activated after the first engine has been activated.

[0018] Furthermore, the nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:5.

[0019] The third aspect of this application provides a method for the use of in preparing kits for screening, evaluating efficacy, detecting toxicity, or performing pharmacokinetic analysis of antitumor mRNA vaccines.

[0020] The fourth aspect of this application provides the use of a signal amplification system in the preparation of kits for screening, evaluating efficacy, detecting toxicity, or analyzing pharmacokinetics of antitumor mRNA vaccines.

[0021] The fifth aspect of this application provides a kit for detecting anti-tumor mRNA vaccines, comprising a signal amplification system and a reporter molecule for outputting a detection signal.

[0022] Furthermore, the reporter molecules include fluorescent reporter molecules and / or test strip reporter molecules.

[0023] Beneficial effects: This invention is superior to existing technologies in terms of detection sensitivity, specificity, ease of operation and adaptability to complex samples, and provides a brand-new technical means for screening, efficacy evaluation and pharmacokinetic studies of anti-tumor mRNA vaccines.

[0024] Compared with the prior art, the present invention has the following advantages: (1) Triple signal amplification significantly improves detection sensitivity This invention is the first to couple primer exchange reaction (PER) with a novel relay-style dual-engine Cas12a system, achieving a cascaded signal amplification strategy of "PER first amplification → first engine Cas12a second amplification → second engine Cas12a third amplification". Experimental results show that this method has a detection limit as low as 34.6 fM for target mRNA and a wide linear range (10 fM-2 pM), which is far superior to traditional single Cas12a detection systems.

[0025] (2) The "dual-engine relay activation" mechanism improves specificity and signal-to-noise ratio. A dual-engine Cas12a system with time-series logic gating was constructed: the second engine is only activated after the first engine is correctly activated by the PER product and cleaved. This design effectively avoids non-specific leakage, significantly improves the selectivity and signal-to-noise ratio (S / N ratio) of detection, and has good distinguishing ability for single-base mismatch sequences.

[0026] (3) Dual-mode signal output ensures accurate and reliable detection results. It employs both fluorescence signal (quantitative analysis using an ELISA reader) and color development on test strips (qualitative analysis using visual inspection) output methods, enabling both high-throughput quantitative analysis and rapid on-site visual detection. The results are cross-validated, reducing the risk of false negatives / false positives.

[0027] (4) It is easy to operate and has a fast response, making it suitable for field applications. The entire testing process is completed in a single tube, without the need for complex thermal circulation equipment. Under isothermal conditions (37°C), the total reaction time is approximately 1.5 hours. The operation is simple and quick, making it easy to promote to grassroots laboratories or point-of-care testing.

[0028] (5) It has good stability and strong practicality in complex biological samples. In complex biological matrices such as serum and urine, this method still maintains good fluorescence response and recovery rate, indicating its strong anti-interference ability. It can be used for the detection of mRNA vaccines in real biological samples, providing a reliable tool for pharmacokinetic studies and vaccine efficacy evaluation.

[0029] (6) It has versatility and programmability This invention, by changing the variable region sequence of crRNA, can be easily adapted to different target mRNAs, and is applicable to the detection of various anti-tumor mRNA vaccines (such as lung cancer NY-ESO antigen mRNA), showing good versatility and expansion potential. Attached Figure Description

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0031] Figure 1 This is a schematic diagram illustrating the working principle of the novel relay-type dual-engine Cas12a system combined with PER triple signal amplification for detecting mRNA vaccines according to the present invention. Figure 1 A is a diagram showing the overall testing steps of the novel relay-type dual-engine Cas12a system combined with PER according to the present invention. Figure 1 B is a diagram illustrating the specific testing process of the novel relay-type dual-engine Cas12a system combined with PER according to the present invention.

[0032] Figure 2 This verifies the feasibility of the target initiating primer exchange reaction in this invention. Figure 2 A is a schematic diagram illustrating the principle of the target-induced primer exchange reaction of this invention. Figure 2 B is a diagram showing the primer exchange reaction characterized by non-denaturing polyacrylamide gel electrophoresis according to the present invention.

[0033] Figure 3 This is a feasibility analysis diagram of the novel relay-type dual-engine Cas12a system coupled with the PER system of the present invention. Figure 3 A is a feasibility diagram of fluorescence intensity for this invention. Figure 3 B is the fluorescence spectrum analysis diagram of this invention. Figure 3 C is an analytical diagram of the test strip of the present invention.

[0034] Figure 4 To verify the synergistic relay effect of the novel relay-type dual-engine Cas12a system of this invention, we present: (A) the working principle of the traditional Cas12a system; (B) the working principle of the novel relay-type dual-engine Cas12a system; (C) a comparison of fluorescence spectral analysis of the two Cas12a systems; and (D) a comparison of fluorescence intensity analysis of the two Cas12a systems.

[0035] Figure 5 This is a diagram showing the optimized DB stem length according to the present invention. Figure 5 A is a diagram showing the four DB stem length structures of this invention. Figure 5 B is a comparison diagram of fluorescence intensity for different stem length structures in this invention.Figure 5 C- Figure 5 D is a comparison diagram of the S / N Ratio of various stem length structures in this invention.

[0036] Figure 6 This is a linear relationship diagram of the present invention. Figure 6 A is the fluorescence spectrum obtained by detecting different concentrations of target mRNA vaccines according to the present invention. Figure 6 B represents the correlation between fluorescence intensity and target mRNA vaccine concentration in this invention. The inset shows the linear relationship between fluorescence and target mRNA vaccine concentration.

[0037] Figure 7 This is a selectivity and stability diagram of the present invention. Figure 7 A is the selectivity diagram of the present invention. Figure 7 B represents the stability diagram of this invention. Detailed Implementation

[0038] To make the technical problems, technical solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0039] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0040] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms “a,” “the,” and “the” used in the embodiments of this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0041] The first aspect of this application provides a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines, comprising the following steps: contacting the sample to be tested with a primer exchange reaction system to trigger the first signal amplification and generate an intermediate product; The intermediate product is brought into contact with a Cas12a detection system, which includes a first Cas12a activation unit guided by full-length crRNA. The second Cas12a activation unit is formed by the assembly of programmable splitting crRNA and split-DNA; The intermediate product sequentially and selectively activates the first Cas12a activation unit and the second Cas12a activation unit to achieve the second and third signal amplification; The second Cas12a activation unit can only be activated after the first Cas12a activation unit has been activated and completed its reverse cutting function.

[0042] In some embodiments, the primer exchange reaction system includes: a DB strand capable of forming a dumbbell-shaped hairpin structure, primers, and a DNA polymerase with strand displacement activity, wherein the nucleotide sequence of the DB strand is shown in SEQ ID NO:1.

[0043] In some embodiments, the nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:5.

[0044] In some embodiments, the target mRNA is the NY-ESO antigen mRNA in a lung cancer mRNA vaccine, and the nucleotide sequence of the detection target region of the NY-ESO antigen mRNA is as shown in SEQ ID NO:6.

[0045] A second aspect of this application provides a signal amplification system for implementing a method, the characteristic signal amplification system comprising: The primer exchange reaction module is used to generate intermediate products in the presence of the target, thereby achieving the first signal amplification; The relay-type dual-engine Cas12a module includes: The first engine: composed of Cas12a protein and full-length crRNA; The second engine consists of Cas12a protein, splitting crRNA, rRNA, and split-DNA. The system is configured such that the intermediate products preferentially activate the first engine, and the second engine is only activated after the first engine has been activated.

[0046] In some embodiments, the nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:5.

[0047] The third aspect of this application provides a method for the preparation of a kit for screening, evaluating efficacy, detecting toxicity, or performing pharmacokinetic analysis of antitumor mRNA vaccines.

[0048] The fourth aspect of this application provides the application of a signal amplification system in the preparation of kits for screening, evaluating efficacy, detecting toxicity, or analyzing pharmacokinetics of antitumor mRNA vaccines.

[0049] The fifth aspect of this application provides a kit for detecting anti-tumor mRNA vaccines, comprising a signal amplification system and a reporter molecule for outputting a detection signal.

[0050] In some embodiments, the reporter molecules include fluorescent reporter molecules and / or test strip reporter molecules.

[0051] Example 1 The present invention provides a rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines, comprising the following steps: contacting the sample to be tested with a primer exchange reaction system to trigger the first signal amplification and generate an intermediate product; The intermediate product is brought into contact with a Cas12a detection system, which includes a first Cas12a activation unit guided by full-length crRNA. The second Cas12a activation unit is formed by the assembly of programmable splitting crRNA and split-DNA; The intermediate product sequentially and selectively activates the first Cas12a activation unit and the second Cas12a activation unit to achieve the second and third signal amplification; The second Cas12a activation unit can only be activated after the first Cas12a activation unit has been activated and completed its reverse cutting function.

[0052] The primer exchange reaction system includes: a DB strand capable of forming a dumbbell-shaped hairpin structure, primers, and a DNA polymerase with strand displacement activity. The nucleotide sequence of the DB strand is shown in SEQ ID NO:1.

[0053] The nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:5.

[0054] The target mRNA is the NY-ESO antigen mRNA in the lung cancer mRNA vaccine. The nucleotide sequence of the detection target region of the NY-ESO antigen mRNA is as shown in SEQ ID NO:6. Example 2

[0055] The present invention provides a signal amplification system for implementing the method. The signal amplification system includes a primer exchange reaction module for generating an intermediate product in the presence of a target to achieve the first signal amplification; and a relay-type dual-engine Cas12a module, which includes: The first engine: composed of Cas12a protein and full-length crRNA; The second engine consists of Cas12a protein, splitting crRNA, rRNA, and split-DNA. The system is configured such that intermediate products preferentially activate the first engine, and the second engine is only activated after the first engine has been activated.

[0056] The nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:5. Example 3

[0057] The application of a method of the present invention in the preparation of a kit for screening, evaluating efficacy, detecting toxicity, or performing pharmacokinetic analysis of antitumor mRNA vaccines. Example 4

[0058] The present invention relates to the application of a signal amplification system in the preparation of kits for screening, evaluating efficacy, detecting toxicity, or performing pharmacokinetic analysis of antitumor mRNA vaccines. Example 5

[0059] This invention discloses a kit for detecting anti-tumor mRNA vaccines, comprising a signal amplification system and a reporter molecule for outputting a detection signal. The reporter molecule includes a fluorescent reporter molecule and / or a test strip reporter molecule.

[0060] Example 6

[0061] 1.1 Experimental Reagents (1) The synthesis and modification of the oligonucleotide sequences used were completed by Shanghai Sangon Biotech Co., Ltd. The oligonucleotide sequences and modifications are shown in Table 1: The synthesized oligonucleotide sequences and group modifications are shown in Table 1: Table 1 Target (NY-ESO) CAGGAUGCCC CA CCGCUUCC CGUG crRNA UAAUUUCUACUAAGUGUAGAUUGAAUUUAGUAAUAACAGGA rRNA UAAUUUCUACUAAGUGUAGAU S-crRNA AACUAUACAACCUACUACCUCA primer TCCTGTTAT Split-DNA AAATGAGGTAGTAGGTTGTATAGTT PCR product TCCTG TTATTACTAAATTCA 8-DB ACTAAATTCAGGGCCTTTTGGCCCTGAATTTAGTAATAACAGGATGCCACGGGAAGCGGTGGGGCATCCTGTTATT-Inverted dT 6-DB ACTAAATTCAGGGCCTTTTGGCCCTGAATTTAGTAATAACAGGAT CACGGGAAGCGGTGGGGCATCCTGTTATT-Inverted dT 5-DB ACTAAATTCAGGGCCTTTTGGCCCTGAATTTAGTAATAACAGGACACGGGAAGCGGTGGGGCATCCTGTTATT-Inverted dT 4-DB ACTAAATTCAGGGCCTTTTGGCCCTGAATTTAGTAATAACAGGCACGGGAAGCGGTGGGGCATCCTGTTATT-Inverted dT Test strip Reporter FAM-TTTTTTATTTTTTT-Biotin Free DNA GCCTAATGTAGTGGCTTGACTCATAGTAATAGCAGGACTACATTAGGCTAGCTACAACGACTCGGTAC FQ -Reporter FAM-TTATTT-BHQ1 MAGE-C1 mRNA CUGAGUGGAAUAGGGGUGCG MicroRNA-122 UGG AGU GUG ACA AUG GUG UUU G lncRNA HULC CAACUGACUCCUACAUAUUAGCAUUAACAG TYR mRNA CAUCAGCUCAGACUAUGUCAUC MT1 CAGGAUGCCC CA CCGCUUCC CGUG MT4 CAGGUCGGCG CA CCGCUUCC CGUG In the above sequences, 5-DB corresponds to SEQ ID NO:1, primer is the primer sequence, crRNA corresponds to SEQ ID NO:2, S-crRNA corresponds to SEQ ID NO:3, rRNA corresponds to SEQ ID NO:4, Split-DNA corresponds to SEQ ID NO:5, and Target(NY-ESO) corresponds to SEQ ID NO:6.

[0062] (2) All chemical reagents used in this invention are of analytical grade. TBE, APS, NaCl, Tris-HCl, MgCl2, and TEMED were provided by Aladdin Biotechnology Co., Ltd. (Shanghai, China). Bst DNA polymerase, 10×Bst buffer (200 mM Tris-HCl, 100 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4, 1% Triton X-100), EnGen® Lba Cas12a (M0653T), and 10×NEBuffer r2.1 reaction buffer (500 mM NaCl, 100 mM Tris-HCl, 100 mM MgCl2, 1000 µg / ml Recombinant Albumin, pH 7.9) were purchased from New England Biolabs (Beijing, China). dATP (100 mM), dTTP (100 mM), dCTP (100 mM), MgSO4 (100 mM), and DEPC-H2O were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). CRISPR Single-Target Nucleic Acid Test Strip was purchased from Nanjing Wopan Biotechnology Co., Ltd. Low-salt hybridization buffer (10 mM Tris-HCl, 1.0 mM EDTA, 150 mM NaCl, pH 7.4).

[0063] 2.2 Experimental Apparatus Ultrapure water was purified using a Millipore Milli-Q pure water system to a standard greater than 18.25 M Ω cm−1. Non-denaturing polyacrylamide gel electrophoresis was performed using a Tianneng EPS300 electrophoresis system. Gel imaging was performed using a Genosens 2100 imager. A constant temperature mixer (Hangzhou Youning Instrument Co., Ltd.) was used. An FA1204B electronic balance (Shanghai Jingke Instrument Co., Ltd.) and an FE20 laboratory pH meter (Shanghai Mettler Toledo Instrument Co., Ltd.) were used. Fluorescence analysis was performed on an M200 PRO Multimode Reader (TECAN, Switzerland) with an excitation wavelength of 485 nm. A B-20R benchtop centrifuge (NACHT GmbH, Germany) was used.

[0064] The DB DNA single strands were added to a low-salt hybridization buffer (10 mM Tris-HCl, 1.0 mM EDTA, 150 mM NaCl, pH 7.4) to a final concentration of 1 μM, and then annealed at 95°C for 5 min. Afterwards, the mixture was slowly cooled to room temperature or placed at 4°C to induce the formation of a dumbbell-shaped DB solution. Finally, the constructed DB strands were stored at 4°C.

[0065] This experiment used non-denaturing polyacrylamide gel electrophoresis to verify the PER reaction. First, a 10 mL 8% gel was prepared by adding 2.6 mL Acryl / Bis (30%), 2 mL 5×TBE, 100 μL 10% APS, and 10 μL TEMED to 5.3 mL ddH₂O. The mixture was poured into a gel pan and allowed to stand for at least 45 min. Then, the successfully prepared sample was mixed with 6×DNA Loading buffer (containing GelRed) and injected into the wells of the previously prepared gel. Electrophoresis was performed at 120 V for 45 min using 1×TBE buffer. Finally, imaging was performed using a gel imaging system.

[0066] The following reaction system was set up: target mRNA (sequence shown in SEQ ID NO:7), DB strand, primers, Bst DNA polymerase, and buffer were added, and the reaction was carried out at 37°C for 30 min. Electrophoresis results showed that a distinct new band (PER product) appeared when the target was present (lane 5), while no such band was observed when the target was absent (lane 4), confirming that the target could successfully induce the PER reaction.

[0068] 1. Tertiary signal amplification detection of target mRNA Different concentrations of the target were placed in centrifuge tubes. Then, 5 µL of 1 µM dumbbell-shaped DB solution, 5 µL of 10 µM primer solution, 1 µL of 1 µM Bst DNA polymerase, and 5 µL of 10× Bst buffer were added to the reaction solution. The total volume was then brought to a final volume with low-salt hybridization buffer and mixed thoroughly. The reaction was carried out at 37°C for 30 min. Afterward, 2 µL of 1 µM Cas12a protein, 2 µL of 10 µM FQ fluorescent reporter molecule, 2 µL of 1 µM crRNA, 3 µL of 1 µM S-crRNA, 3 µL of 1 µM rRNA, 1 µL of 1 µM MSplit-DNA, and 6 µL of 10× NEBuffer r2.1 buffer were added to the centrifuge tubes. The reaction was carried out at 37°C for 1 hour. The reaction solution was then transferred to a black 96-well plate. Fluorescence changes and intensity were monitored using an ELISA reader (M200 PRO Multimode Reader) at a fixed excitation wavelength of 485 nm and a fixed emission wavelength of 525 nm. 10 μL of 10 µM TSETReporter was added, and the reaction was carried out at 37°C for 20 minutes. A CRISPR Single-Target Nucleic Acid Test Strip was then inserted, and the changes in the test strip were observed after 5 minutes.

[0069] 2. Detection of serum and urine samples To validate the application of this method in real biological samples, the target mRNA in serum and urine samples was detected. Whole blood samples from healthy individuals were provided by the First Affiliated Hospital of Nanjing Medical University and approved by the ethics committee. After extraction, whole blood was centrifuged at 3500 rpm for 10 minutes, and the supernatant was collected for preparation. Urine samples were obtained from healthy individuals and diluted with ultrapure water before use. All samples were stored at −20°C.

[0070] 3. Experimental Results and Analysis Experimental principle: To meet the demand for highly sensitive and real-time monitoring of mRNA sequences in lung cancer mRNA vaccines, a novel relay-style dual-engine Cas12a system coupled with a PER reaction for triple signal amplification is proposed for the first time for detecting tumor mRNA vaccines. The working principle of the scheme is as follows: Figure 1 As shown, the target first binds to the stem-loop structure of the DB strand, opening the DB hairpin and exposing the primer exchange site. The primers then undergo a primer exchange reaction catalyzed by Bst DNA polymerase, achieving the first signal amplification and generating a large number of PER products. These products serve as the activating strand of the full-length crRNA, initiating the relay-style dual-engine Cas12a system.

[0071] The PER product first pairs with full-length crRNA, activating the first engine, Cas12a, which undergoes trans-cleavage to generate fluorescence, completing the second signal amplification. Subsequently, the full-length crRNA is released from the Cas12a protein complex, providing a pairing site for the split crRNA. The split crRNA binds to split-DNA, activating the second engine, Cas12a, completing the third signal amplification. These two engines work synergistically, coupling the PER reaction to achieve highly efficient triple signal amplification, significantly improving detection sensitivity and specificity. The system simultaneously outputs fluorescence signals and test strip color development results; this dual-signal mode further ensures detection accuracy. In the absence of a target, the DB dumbbell design remains closed, preventing subsequent reactions from starting and keeping the system silent. Furthermore, the entire reaction can be completed in a single centrifuge tube, making operation simple and quick.

[0072] Figure 1 This is a schematic diagram illustrating the working principle of the novel relay-type dual-engine Cas12a system combined with PER triple signal amplification for detecting mRNA vaccines according to the present invention. Figure 1 A is a diagram showing the overall testing steps of the novel relay-type dual-engine Cas12a system combined with PER according to the present invention. Figure 1 B is a diagram illustrating the specific testing process of the novel relay-type dual-engine Cas12a system combined with PER according to the present invention.

[0073] 3.2 Feasibility Verification First, we need to verify whether the target can trigger a primer exchange reaction. The triggering mechanism is as follows: Figure 2 As shown in Figure A, when the target is present, it can bind to the DB strand, opening the DB hairpin and exposing the primer exchange site. The primers then undergo a primer exchange reaction catalyzed by Bst DNA polymerase, resulting in signal amplification and the production of a large amount of PER products. Figure 2 B. Polyacrylamide gel electrophoresis was used to verify the primer exchange reaction. Compared to lanes 1 and 2, the band in lane 3 showed a significant increase, indicating that the target bound to the DB chain and the DB hairpin opened. In lane 4, when the target was absent, there was no positional change, and no new product was observed. Compared to lane 4, lane 5 showed a band that shifted significantly downwards, verifying the successful formation of the PER product. These results confirm that the target successfully induced the primer exchange reaction.

[0074] Figure 2 This verifies the feasibility of the target initiating primer exchange reaction in this invention. Figure 2 A is a schematic diagram illustrating the principle of the target-induced primer exchange reaction of this invention. Figure 2 B is a diagram showing the primer exchange reaction characterized by non-denaturing polyacrylamide gel electrophoresis according to the present invention.

[0075] Next, the feasibility of the novel relay-style dual-engine Cas12a system was verified separately. The PER product was directly added to the system, and both UV irradiation and fluorescence signal intensity detection were performed. The control group showed virtually no fluorescence, indicating the absence of PER product triggering. Even with the pre-added split-DNA, the activation strand of the second engine splitting the Cas12a system, the dual-engine relay Cas12a system remained inactive and did not activate. In contrast, the experimental group produced a significant fluorescence signal, demonstrating that the PER product can directly activate the novel relay-style dual-engine Cas12a system. This verifies the feasibility of the novel relay-style dual-engine Cas12a system.

[0076] Finally, the feasibility of the overall reaction of the novel relay-type dual-engine Cas12a system coupled with the PER reaction and its triple signal amplification system was verified. Both the target group and the non-target control group were mixed with DB strands, primers, the relay-type dual-engine Cas12a system, and a fluorescent reporter probe. After irradiation under UV light, the experimental group produced a significant fluorescence signal compared to the control group. This indicates that the addition of the target can open the hairpin of DB, producing the PER product, which then activates the novel relay-type dual-engine Cas12a system. Using a microplate reader, the fluorescence intensity was as follows: Figure 3 As shown in Figure A, a strong fluorescence signal (red bar graph) is generated in the solution when the target mRNA is present. However, in the absence of target mRNA, only a very weak fluorescence signal is observed in the control group (green bar graph). The fluorescence changes at a fixed excitation wavelength of 485 nm and a fixed emission wavelength of 525 nm are shown below. Figure 3 As shown in Figure B, a significant fluorescent signal was generated in the presence of the target mRNA, while the control group showed no fluorescence. The control group exhibited virtually no fluorescence, confirming that in the absence of the target, the primer exchange reaction could not occur because the system could not open the DB hairpin, thus preventing activation of the novel relay-style dual-engine Cas12a system. When the test strip was added to the solution and reacted with its reporter probe, the results were as follows... Figure 3 As shown in Figure C, compared to the control group, the experimental group all exhibited a distinct red band above the control group, consistent with the fluorescence signal output results. In summary, these experimental results fully demonstrate the feasibility of using a triple signal amplification system analysis platform based on a novel relay-type dual-engine Cas12a system coupled with the PER reaction to detect vaccine mRNA.

[0077] Figure 3 This is a feasibility analysis diagram of the novel relay-type dual-engine Cas12a system coupled with the PER system of the present invention. Figure 3 A is a feasibility diagram of fluorescence intensity for this invention. Figure 3 B is the fluorescence spectrum analysis diagram of this invention. Figure 3 C is an analytical diagram of the test strip of the present invention.

[0078] 3.3 Verification of the Collaborative Relay Function of the Novel Relay-Type Dual-Engine Cas12a System To verify the synergistic and relay-effect properties of the novel relay-style dual-engine Cas12a system, a comparison was made between the traditional full-length crRNA Cas12a system and the novel relay-style dual-engine Cas12a system. First, the different ways in which the two crRNAs occupy the Cas protein in the relay-style dual-engine Cas12a system were verified. The split crRNA in this detection platform is a traditional crRNA split into two parts: a repetitive sequence (rRNA) and a variable-order S-crRNA sequence. The activation strand of the split crRNA, split-DNA, is also pre-added. In the relay-style dual-engine Cas12a system, the traditional full-length crRNA occupies the Cas protein first. When there is no PER product activation, the split crRNA cannot enter the Cas protein. Thus, even with the presence of the activation strand of the split crRNA, split-DNA remains quiescent. The addition of the PER product group to the relay-style dual-engine Cas12a system produced a strong fluorescence signal, while all control groups without the PER product showed almost no fluorescence signal. The fluorescence spectral analysis results were consistent with the fluorescence intensity results. The two control groups were traditional crRNA and split crRNA, added to the system simultaneously and sequentially, respectively. The findings that neither addition method affected the fluorescence signal further indicate that when both conventional crRNA and split crRNA are added simultaneously, the conventional crRNA can quickly occupy the Cas protein, while the split crRNA can only enter the Cas protein after the conventional crRNA is released.

[0079] Subsequently, the traditional full-length crRNA Cas12a system was compared with the novel relay-style dual-engine Cas12a system, such as... Figure 4 As shown in A and 4B, compared to the traditional full-length crRNA Cas12a system, the novel relay-style dual-engine Cas12a system, after releasing crRNA, initiates the splitting crRNA cleavage. At this point, the dormant splitting crRNA Cas12a system is activated, performing trans-cleavage again. The entire novel relay-style dual-engine Cas12a system repeatedly activates Cas12a trans-cleavage activity, improving cleavage efficiency and signal-to-noise ratio. Figure 4 C neutralization Figure 4D. The fluorescence spectrum and fluorescence intensity of the novel relay-type dual-engine Cas12a system are significantly higher than those of the control group. The system signal-to-noise ratio of the novel relay-type dual-engine Cas12a system is also significantly increased. These results demonstrate that the novel relay-type dual-engine Cas12a system is significantly superior to the traditional Cas12a system, exhibiting excellent relay and synergistic effects. The second engine can only be activated after the first engine is activated by the PER product and completes cleavage, thus achieving stepwise amplification of the target signal. This ingenious design ultimately achieves a highly efficient multi-signal amplification design.

[0080] Figure 4 This diagram illustrates the collaborative relay operation of the novel relay-type dual-engine Cas12a system of this invention. Figure 4 A) The working principle of the traditional Cas12a system. Figure 4 B) Working principle of the new relay-type dual-engine Cas12a system. Figure 4 C) Comparison of fluorescence spectral analysis between the two Cas12a systems. Figure 4 D) Comparison of fluorescence intensity analysis between the two Cas12a systems.

[0081] 3.4 Condition Optimization To achieve optimal detection results, several key experimental conditions were optimized, including reporter probe concentration, Bst concentration, crRNA ratio, Cas12a protein concentration, reaction temperature, reaction time, and DB stem length. The S / N ratio was set to F / F0, where F and F0 represent the fluorescence intensity in the presence and absence of the target, respectively.

[0082] First, the report probe concentration affects detection efficiency. The S / NR ratio reaches its highest relative value at a report probe concentration of 200 nM, indicating that at 200 nM, the novel relay-type dual-engine Cas12a system coupled with PER's triple signal amplification can fully utilize its signal amplification and reporter probe cleavage capabilities. However, higher concentrations do not further increase signal amplification. Therefore, 200 nM is the most economical and optimal concentration for the reaction. Next, the reaction time was optimized. Results showed that the signal-to-noise ratio (SNR) gradually increased with increasing reaction time, and the increase plateaued slightly at 60 min. Subsequently, the S / N ratio continued to increase with time. Good detection results were achieved at 90 min, sufficient for reporter probe cleavage; therefore, 90 min was chosen for subsequent reactions. Next, the Bst polymerase concentration was optimized. In the low-concentration stage, the S / N ratio generally increased with increasing concentration, reaching a maximum at 1.6 / 100 µL. Afterward, the SNR decreased with further increases in concentration. Considering its economic viability, this approach was deemed appropriate. Ultimately, 1.6 U / 100 µL was selected as the concentration for subsequent Bst polymerase reactions.

[0083] The crRNA ratio is one of the key factors affecting signal amplification. When the crRNA ratio is 2:3:3, the S / NR ratio reaches its peak, indicating that the novel relay-style dual-engine Cas12a system can fully utilize its reaction capability to cleave the reporter probe at this ratio. Other ratios significantly reduce signal amplification. Therefore, a 2:3:3 crRNA ratio is the most optimal for the reaction.

[0084] The reaction temperature was optimized. A significant positive correlation was found between reaction temperature and signal-to-noise ratio (SNR). Within the temperature range of 25℃-37℃, the SNR value increased significantly with increasing temperature. After 37℃, the SNR value decreased with further temperature increases, and 37℃ was ultimately selected as the subsequent reaction temperature. The concentration of Cas12a protein also had an impact. Within the Cas12a protein reaction concentration range of 10nM-200M, the SNR value increased significantly with increasing temperature as the concentration gradually increased, indicating better detection performance. However, after 200nM, the SNR value decreased with further increases in Cas12a protein concentration, and 200nM was ultimately chosen as the subsequent Cas12a protein reaction concentration.

[0085] Finally, the stem length of the DB chain was optimized. Four types of DB chain structures are shown below. Figure 5 As shown, the length of the DB stem has a significant impact on the S / NRatio value. Figure 5 For C and 5D, the S / N ratio gradually increases as stem length decreases, reaching a maximum at DB-5, and then gradually decreases as stem length decreases thereafter. Figure 5 B. The fluorescence intensity of the experimental group also showed consistent results. This may be because when the stem length is too long, the hairpins of the DB bind tightly, making it difficult for the target to open the DB, resulting in a low S / N ratio. Conversely, when the DB hairpins are too short, the hairpins may open spontaneously, leading to a high background signal and a decreased S / N ratio. The stem length is most optimal when the structure is DB-5. Therefore, DB-5 was chosen as the subsequent reaction sequence.

[0086] Figure 5 This is a diagram showing the optimized DB stem length according to the present invention. Figure 5 A is a diagram showing the four DB stem length structures of this invention. Figure 5 B is a comparison diagram of fluorescence intensity for different stem length structures in this invention. Figure 5 C- Figure 5 D is a comparison diagram of the S / N Ratio of various stem length structures in this invention.

[0087] 3.5 Linear Relationship To explore the detection performance of the constructed triple signal amplification biosensor based on the novel relay dual-engine Cas12a system for mRNA, the fluorescence signal response induced by different concentrations of mRNA vaccine targets was detected and analyzed.

[0088] like Figure 6 As shown in Figure A, when the target concentration increases from 0 pM to 50 pM, the fluorescence signal intensity continuously increases, and the fluorescence intensity value is positively correlated with the target concentration, which is consistent with expectations. Figure 6 As shown in Figure B, within the dynamic range of 10 fM to 2 pM, absorbance intensity exhibits a linear relationship with fluorescence intensity, with a regression equation of Y = 590.6*X + 126.1 and a correlation coefficient of 0.96. Here, Y represents fluorescence intensity, and X represents the concentration of the mRNA vaccine target. The calculated detection limit is 34.6 fM. Test strip results show that without the target, there is no obvious color band. As the target concentration increases, the test strip bands become more distinct, consistent with the fluorescence signal results. These results indicate that as the target concentration increases, more DB chains are opened, forming more PER products. This activates the novel relay-type dual-engine Cas12a system, enhancing its non-specific cleavage activity to cleave surrounding fluorescently labeled substrates, thereby releasing a large amount of fluorescence signal and achieving a significant signal amplification effect, resulting in a significant increase in the final fluorescence intensity.

[0089] Figure 6 This is a linear relationship diagram of the present invention. Figure 6 A is the fluorescence spectrum obtained by detecting different concentrations of target mRNA vaccines according to the present invention. Figure 6 B is a graph showing the relationship between fluorescence intensity and target mRNA vaccine concentration according to the present invention. The inset shows the linear relationship between fluorescence and target mRNA vaccine concentration, and the error bar represents the standard deviation (n = 3).

[0090] 3.6 Selectivity, stability and recovery rate To verify the selectivity of the triple signal amplification biosensor based on the novel relay-type dual-engine Cas12a system, a comparative experiment was conducted. mRNAs with one, four, and other base mismatches with the target, respectively, were selected as samples. Figure 7A. The fluorescence signal intensity reaches its highest level only when the correct target is present; when one or more base mismatches are present in the sample, the fluorescence signal shows a significant downward trend. Furthermore, to further expand the comprehensiveness of the validation, experiments were conducted under the same conditions using miRNA-122, lncRNA HUCL, DNA, and other mRNAs. The results showed that the fluorescence signals produced by these samples were almost identical to those of the blank group. This series of detailed experimental results strongly demonstrates that the detection strategy possesses extremely high selectivity and accuracy. This is mainly because, in the absence of a target, the dumbbell-shaped DB design is tightly packed and cannot open on its own, resulting in no PER product and the inability to activate the novel relay-type dual-engine Cas12a system. This unique design allows the entire detection process to accurately identify the target, thus possessing excellent selectivity. This avoids non-specific signal leakage and multi-component interference problems from the source, ensuring the reliability of the detection results.

[0091] Figure 7 This is a selectivity and stability diagram of the present invention. Figure 7 A is the selectivity diagram of the present invention. Figure 7 B represents the stability diagram of this invention.

[0092] 3.7 Application capability in real samples To verify the analytical capability of this protocol in complex biological matrices, fluorescence intensity was measured by adding the target to reaction buffer, serum, and urine, respectively. Figure 7 As shown in Figure B, the fluorescence intensity in the reaction buffer, diluted urine, and serum showed no significant difference compared to the reaction buffer. This indicates that the proposed novel relay-style dual-engine Cas12a system combined with the PER signal amplification strategy maintains good stability even in complex environments. Subsequently, the recovery rate of this method in complex biological matrices was tested, using reaction buffer, serum, and urine as detection matrices for comparison. The analytical performance of this method in diluted urine and serum was essentially the same as that in the standard buffer. These results fully demonstrate that the method can maintain good stability in complex biological matrices. This further validates that the proposed new method is a reliable candidate tool for vaccine mRNA target analysis and has great potential in clinical assays.

[0093] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope. The scope of protection of the present invention is defined by the appended claims, specification, and their equivalents.

Claims

1. A rapid and efficient method for analyzing and detecting anti-tumor mRNA vaccines, characterized in that... The process includes the following steps: contacting the sample to be tested with the primer exchange reaction system to trigger the first signal amplification and generate an intermediate product; The intermediate product is contacted with a Cas12a detection system, which includes a first Cas12a activation unit guided by full-length crRNA. The second Cas12a activation unit is formed by the assembly of programmable splitting crRNA and split-DNA; The intermediate product sequentially and selectively activates the first Cas12a activation unit and the second Cas12a activation unit to achieve the second and third signal amplification; The second Cas12a activation unit can only be activated after the first Cas12a activation unit has been activated and completed its reverse cutting function.

2. The method according to claim 1, characterized in that: The primer exchange reaction system includes: a DB strand capable of forming a dumbbell-shaped hairpin structure, primers, and a DNA polymerase with strand displacement activity, wherein the nucleotide sequence of the DB strand is shown in SEQ ID NO:

1.

3. The method according to claim 1, characterized in that: The nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:

5.

4. The method according to claim 1, characterized in that: The target mRNA is the NY-ESO antigen mRNA in the lung cancer mRNA vaccine, and the nucleotide sequence of the detection target region of the NY-ESO antigen mRNA is as shown in SEQ ID NO:

6.

5. A signal amplification system for implementing the method according to any one of claims 1-4, characterized in that: The signal amplification system includes: The primer exchange reaction module is used to generate intermediate products in the presence of the target, thereby achieving the first signal amplification; The relay-type dual-engine Cas12a module includes: The first engine: composed of Cas12a protein and full-length crRNA; The second engine consists of Cas12a protein, splitting crRNA, rRNA, and split-DNA; the system is configured such that the intermediate product preferentially activates the first engine, and the second engine is only activated after the first engine is activated.

6. The signal amplification system according to claim 5, characterized in that: The nucleotide sequence of the full-length crRNA is shown in SEQ ID NO:2, the nucleotide sequence of the split crRNA is shown in SEQ ID NO:3, the nucleotide sequence of the rRNA is shown in SEQ ID NO:4, and the nucleotide sequence of the split-DNA is shown in SEQ ID NO:

5.

7. The use of the method according to any one of claims 1-3 in the preparation of a kit for screening, evaluating efficacy, detecting toxicity, or performing pharmacokinetic analysis of antitumor mRNA vaccines.

8. The use of the signal amplification system of claim 5 or 6 in the preparation of kits for screening, evaluating efficacy, detecting toxicity, or performing pharmacokinetic analysis of antitumor mRNA vaccines.

9. A kit for detecting anti-tumor mRNA vaccines, characterized in that: It includes the signal amplification system as described in claim 5 or 6, and a report molecule for outputting the detection signal.

10. The reagent kit according to claim 9, characterized in that: The reporter molecules include fluorescent reporter molecules and / or test strip reporter molecules.