A method for detecting FEN1 enzyme based on a manganese dioxide nanosheet fluorescent sensing system

Abstract

The application discloses a method for detecting FEN1 enzyme based on a fluorescent sensing system of manganese dioxide nanosheet, and is used for sensitive detection of activity of Flap endonuclease 1 (FEN1). The method comprises the following steps: 1) preparing MnO2 nanosheet; 2) incubating a double-branched substrate DNA with FEN1; 3) adding T2, and after incubation, cooling to obtain a hybridization product of T2 and 5' Flap single-stranded DNA cut by FEN1 reaction; 4) adding Bst DNA polymerase, Nt.BstNBI and dNTPs, and incubating in NEBuffer 3.1 to generate a large number of output (O) sequences. Then, the enzyme is inactivated to terminate the reaction. 5) hybridizing the SDA reaction mixture in the above step with FAM-ssDNA, adding MnO2 nanosheet, and then diluting with Tris-HCl buffer solution, and the final concentration of MnO2 is 40 μg / mL; after incubation at room temperature, the fluorescence emission spectrum under an excitation wavelength of 488 nm is collected, the scanning range is 493-650 nm, and the fluorescence intensity peak value is recorded. The fluorescence signal is linearly related to the logarithm of the activity of FEN1, the range is 5×10 ‑6 U / μL to 0.1 U / μL, and the detection limit is 1.6×10 ‑6 U / μL.

Description

Technical Field

[0001] This invention belongs to the field of quantitative detection of FEN1 enzyme, specifically relating to a method for detecting FEN1 enzyme based on a fluorescence sensing system of manganese dioxide nanosheets. Background Technology

[0002] Currently, tumor diagnosis primarily relies on imaging characteristics to diagnose the presence of tumors, such as traditional imaging techniques like CT, MRI, ultrasound, and radionuclide imaging. Cytogenetic and molecular biological techniques are also used to diagnose tumor development, combining morphological and immunohistochemical methods for more precise results. While these methods offer high accuracy, they are mainly for patients with obvious symptoms and are expensive, making large-scale screening difficult. The most effective method for early tumor diagnosis is to identify tumor markers in body fluids through in vitro diagnostics, particularly protein markers. Studies have shown that FEN1 is involved in various diseases, especially closely related to tumor occurrence, development, and biological behavior. FEN1 expression is also positively correlated with tumor volume, vascular invasion, and distant metastasis. The difference in FEN1 expression levels between normal and tumor cells, and the changes in these levels when coexisting with clinical drugs or FEN1 inhibitors, are of great significance for studying tumor development and evaluating treatment efficacy.

[0003] Currently, the evaluation of FEN1 enzyme expression in conventional biology mainly relies on RT-PCR, enzyme-linked immunosorbent assay (ELISA), Western blotting, and immunohistochemistry. These methods are time-consuming, complex, and cannot quantify FEN. Therefore, there is a need to develop rapid, simple, and highly sensitive methods for FEN quantitative detection. In recent years, strand displacement amplification (SDA) has attracted great interest in various biomarker analyses due to its high detection sensitivity, fast amplification speed, and accurate detection. SDA is an isothermal amplification reaction that generates single-stranded DNA (ssDNA) products through nuclease-assisted extension and strand displacement polymerase at the nick site. This nuclease-assisted target recovery has received widespread attention due to its simplicity, the 1:N target-probe molecule recognition ratio, and strong signal amplification capabilities. However, due to unavoidable background amplification, SDA has always suffered from a low signal-to-noise ratio, thus limiting the achievable detection sensitivity. In view of the above shortcomings, we introduced MnO2 nanosheets into our experimental system for FEN1 detection. Manganese dioxide (MnO2) nanosheets, as a novel two-dimensional nanomaterial, have shown broad application prospects in the field of fluorescence analysis and detection due to their unique physicochemical properties. MnO2 nanosheets possess a broad UV-Vis absorption spectrum, excellent enzyme-mimicking activity, and good water dispersibility. More importantly, they can efficiently quench the emission of various fluorophores, such as fluorescein, rhodamine, and various quantum dots and carbon dots, through fluorescence resonance energy transfer (FRET) or internal filtration effect (IFE). Simultaneously, MnO2 nanosheets exhibit high sensitivity to bioreducing substances such as glutathione (GSH) and ascorbic acid (AA): in the presence of these reducing agents, MnO2 nanosheets are reduced and decomposed into Mn. 2+ The ion quenching effect on the fluorophore disappears, allowing the fluorescence signal to recover. Based on this "switch" or "switch-on" mechanism, researchers have successfully constructed various highly sensitive and selective fluorescence sensing platforms for detecting small biological molecules, enzyme activities (such as telomerase and endonucleases), nucleic acids, and tumor markers. Compared to traditional organic quenchers, MnO2 nanosheets are low-cost, easy to prepare, and biocompatible, making them valuable for applications in disease diagnosis, biochemical analysis, and environmental monitoring. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a method for detecting FEN1 enzyme using a fluorescence sensing system based on manganese dioxide nanosheets. In this invention, FEN1 acts on a double-stranded DNA and cleaves the 5' Flap, causing it to hybridize with the template T2 and initiate an SDA cycle to generate an Output (O) sequence. After the O sequence binds to FAM-ssDNA, the FAM fluorescence is not quenched by MnO2. The FEN1 activity is determined based on the change in fluorescence signal intensity. This method has the advantages of high sensitivity and good accuracy.

[0005] To solve the aforementioned technical problem of sensitive FEN1 detection, the technical solution adopted in this invention is as follows: A fluorescence sensing system based on manganese dioxide nanosheets and its application in the detection of FEN1 enzyme activity includes the following steps: 1) Preparation of MnO2 nanomaterials; 2) Prepare bibranched substrate DNA by reacting the bibranched substrate DNA with FEN1 to obtain the cleaved 5′Flap; 3) Add template 2 to step 2) to hybridize template 2 with the 5′Flap single-stranded DNA cut by the FEN1 enzyme reaction; 4) Add Bst DNA polymerase, Nt.BstNBI and dNTPs to step 3) to carry out SDA reaction to obtain SDA product; 5) React the SDA product from step 4) with FAM-ssDNA in a water bath at 35-40℃ for 1.5-2.5 hours, add MnO2 nanosheets and Tris-HCl buffer, incubate, and then detect the fluorescence spectrum; plot a standard curve with FEN1 enzyme concentration as the x-axis and fluorescence intensity as the y-axis to obtain the standard curve equation. 6) Replace the FEN1 enzyme gradient concentrations in step 2) with the FEN1 enzyme of the desired concentration, and repeat steps 2) to 5) to measure the fluorescence spectrum. Substitute the fluorescence spectrum into the standard curve equation to obtain the concentration of the FEN1 enzyme to be tested. The method described is for non-disease diagnostic purposes.

[0006] Further, step 1) is specifically as follows: Prepare a 0.2~0.4 mmol / mL MnCl2 aqueous solution A, prepare a 1.3 mmol / mL~1.4 mmol / mL TMA·OH aqueous solution, add commercially available hydrogen peroxide (30wt%) to obtain a mixed solution B of TMA·OH and hydrogen peroxide, pour solution B into solution A within 15 s to form a suspension, then continue stirring the suspension at room temperature for at least 24 h, centrifuge, wash, freeze dry to obtain solid MnO2 nanosheets, weigh the solid MnO2 nanosheets and add them to ultrapure water, sonicate until MnO2 is completely dispersed to obtain 0.5~2 mg / mL -1The volume ratio of MnO2 nanosheet solution, TMA·OH aqueous solution and hydrogen peroxide is 9:1, and the volume ratio of solution B to solution A is 2:1.

[0007] Further, the specific steps of step 2) are as follows: Three complementary DNA sequences—upstream oligonucleotide (U), downstream strand (D), and template 1 strand (T1)—are treated in hybridization buffer at 90-95°C for 3-8 minutes, then allowed to cool naturally to room temperature in the water bath to obtain a bibranched DNA substrate. This bibranched DNA substrate is then incubated with FEN1 in 1×Thermo Pol reaction buffer at 35-40°C for 1.5-2.5 hours. The final concentration of the bibranched DNA substrate is 1 μM, and the concentration of FEN1 is 5×10⁻⁶. -6 U / μL to 0.1 U / μL.

[0008] Further, the DNA sequence of upstream strand U from the 5' end to the 3' end is CGACCGTGCCAGCCTAAATTTCAATCCACCCGTCCT (as shown in SEQ ID NO.1), the DNA sequence of downstream strand D from the 5' end to the 3' end is CCAAGGCCAGAC GTAAACCCGACGCCACCTCCTG (as shown in SEQ ID NO.2), and the DNA sequence of template strand 1 (T1) from the 5' end to the 3' end is GCAGGAGGTGGCGTCGGGTGGACGGGTGGATTGAAATTTAGGCTGGCACGGTCG (as shown in SEQ ID NO.3). The final concentration of upstream strand U, downstream strand D, and template strand 1 in the hybridization buffer is 10 μM. The hybridization buffer consists of 50 mM Tris-HCl, 50 mM MgCl2, and water as the solvent.

[0009] Further, step 3) is as follows: add template 2 (T2), incubate in a water bath at 90-95 ℃ for 3-8 minutes, and then allow it to cool naturally to room temperature in the water bath. The DNA sequence of template 2 (T2) from the 5' end to the 3' end is TCAACATCAGTCTGATAAGCTAAGCTGACTCGGGTTTACGTCTGGCCTTGG (as in SEQ ID NO.4). The final concentration of template 2 in the reaction system is 1 μM.

[0010] Further, step 4) is specifically as follows: Bst DNA polymerase, Nt.BstNBI endonuclease, and dNTPs are added and incubated in NEBuffer 3.1 at 50-60°C for 0.5-1.5 hours. Subsequently, the reaction is terminated by inactivating the enzymes at 75-85°C for 5-15 minutes. The final concentration of Bst DNA polymerase is 0.05 U / μL, the final concentration of Nt.BstNBI endonuclease is 0.5 U / μL, and the final concentration of dNTPs is 0.5 mM.

[0011] Further, the specific process of step 5) is as follows: after reacting the SDA product with FAM-ssDNA in a water bath at 35~40℃ for 1.5~2.5 hours, add MnO2 nanosheets and Tris-HCl buffer, incubate for 10~15 minutes and then detect fluorescence. During spectral detection, collect the fluorescence emission spectrum at an excitation wavelength of 488nm, scan the range of 493-650nm, and record the fluorescence intensity value at 518nm.

[0012] Furthermore, the DNA sequence of FAM-ssDNA from the 5' end to the 3' end is FAM-CCAAGGCCAGACGTAAACCCGAGTCAGCT.

[0013] Furthermore, the Tris-HCl buffer solution has the following composition: 10 mM Tris-HCl, 25 mM MgCl2, 5 mM CaCl2, pH 7.5.

[0014] Furthermore, in step 5), the final concentration of FAM-ssDNA is 300 nM and the final concentration of MnO2 is 40 μg / mL.

[0015] The 1×Thermo Pol reaction buffer used above consisted of: 10 mM KCl, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, and pH 8.8.

[0016] 1×NEBuffer 3.1 composition: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml Recombinant Albumin (pH 7.9 @ ​​25℃).

[0017] This application develops a method for detecting the FEN1 enzyme using a fluorescence sensing system based on manganese dioxide nanosheets. This sensor employs strand displacement amplification (SDA) technology for FEN1 detection. Once the 5′Flap of a bibranched DNA substrate is cleaved by the target FEN1, the cleaved 5′Flap initiates a strand displacement amplification process (SDA), generating a large number of output DNA (O) sequences. Subsequently, the O sequences bind to FAM-ssDNA to form double-stranded DNA. The FAM-ssDNA is no longer quenched by MnO2, and the fluorescence signal does not increase with increasing FEN1 concentration. This biosensor exhibits a linear relationship with FEN1 concentration, with a detection range of 5 × 10⁻⁶. -6 The detection limit is 1.6 × 10⁻⁶ U / μL. -6 U / μL. This reliable, accurate, and convenient method holds promise as a powerful tool for point-of-care testing and treatment response assessment.

[0018] Compared with the prior art, the present invention has the following features and advantages: (1) This invention utilizes SDA cyclic amplification to generate a large number of O sequences to improve detection sensitivity.

[0019] (2) This invention utilizes the adsorption effect of MnO2 on single-stranded DNA to quench FAM fluorescence. When the FEN1 target is present, its SDA product hybridizes with FAM-ssDNA to form double-stranded DNA, which is released from MnO2 adsorption, and the fluorescence is restored, thus achieving sensitive detection of FEN.

[0020] (3) The present invention has the advantages of low cost, speed, simplicity, sensitivity and high specificity. Attached Figure Description

[0021] Figure 1 This is a flowchart for FEN1 activity detection; Figure 2 (A) Simulation of double-lobed DNA structure formation using NUPACK. (B) Schematic diagram of the catalytic effect of FEN1 on double-lobed DNA structure. (C) Gel electrophoresis analysis of amplification products; Figure 3 (A) Zeta potential diagram, (B) Particle size distribution diagram, (C) Transmission electron microscopy image of MnO2, (D) UV absorption spectrum of MnO2 and fluorescence spectrum of FAM-ssDNA; Figure 4 In the image: (A) XPS plot of MnO2, (B) O 1S Combining the energy spectrum, (C)Mn 2P 3 / 2 and Mn 2P 1 / 2 The binding energy spectrum, (D) C 1S Combined with the energy spectrum; Figure 5(A) Fluorescence spectra of FAM-ssDNA (300 nM) after adding different concentrations of manganese dioxide nanosheets; (B) Changes in the fluorescence intensity of FAM-ssDNA with the concentration of manganese dioxide nanosheets; (C) Effect of different quenching times of MnO2 nanosheets on the fluorescence intensity of FAM-ssDNA; (D) Effect of different amounts of MnO2 nanosheets on the quenching and recovery of the fluorescence signal of FAM-ssDNA.

[0022] Figure 6 (A) Fluorescence spectra of FAM-ssDNA measured after adding different concentrations of FEN1 amplification products, (ag) 5×10 -6 U / μL, 1×10 -5 U / μL, 4×10 -5 U / μL, 4×10 -4 U / μL, 4×10 -3 U / μL, 4×10 -2 (B) Relationship between peak intensity and different concentrations of FEN1 (U / μL, 0.1 U / μL). Inset: Calibration plot of peak intensity versus logcFEN1; Figure 7 To investigate the inhibitory effect of a manganese dioxide nanosheet-based fluorescence sensing system on ATA. Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments and accompanying drawings. It should be noted that those skilled in the art can make several modifications and improvements without departing from the principle of the present invention, and these should also be considered to fall within the protection scope of the present invention.

[0024] The reagents and instruments used in this experiment are as follows: DNA was purchased from Shanghai Bioengineering Technology Service Co., Ltd., and fluorescence spectra were collected using a Hitachi F7000 fluorescence spectrophotometer.

[0025] DNA sequences used in the experiment:

[0026] The DNA was prepared into a 100 μM solution using ultrapure water (18.2 MΩ·cm at 25 °C, Millipore, USA). All DNA used in the following experiments refers to a 100 μM aqueous solution of that DNA.

[0027] 1×Thermo Pol reaction buffer composition: 20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton® X-100 (pH 8.8 @ 25℃).

[0028] 1×NEBuffer 3.1 Composition: 100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 µg / ml Recombinant Albumin (pH 7.9 @ ​​25℃). Example 1

[0029] A method for detecting FEN1 enzyme based on a fluorescence sensing system using manganese dioxide nanosheets, such as... Figure 1 As shown, the process is as follows: 1) Preparation of MnO2 nanosheets: 0.5937 g of MnCl2•4H2O was dissolved in 10 mL of ultrapure water to obtain a 0.3 mmol / mL MnCl2 solution A. 2.1748 g of TMA•OH (tetramethylammonium hydroxide) was dissolved in 18 mL of water, and 2 mL of H2O2 (30 wt%) was added to obtain a mixed solution B of TMA•OH and H2O2. Solution B was quickly poured into solution A (this step must be completed within 15 s), forming a blackish-brown suspension. The suspension was then stirred at room temperature for 24 h to fully complete the oxidation reaction. To purify MnO2, the resulting solution was centrifuged for 10 min (10000 rpm), washed three times with ethanol and ultrapure water respectively, and dried at -60℃ using a vacuum freeze dryer to remove residual solvent, yielding solid MnO2 nanosheets. Characterization of this material is shown in [link to material description]. Figure 3 , Figure 4 ,from Figure 3 A indicates that the MnO2 nanosheets carry a negative charge of -5.375 mV in solution. From... Figure 3 As shown in B, the hydrated particle size of MnO2 nanosheets is concentrated at 420 nm. Figure 3 C is a transmission electron microscope (TEM) image of MnO2 nanosheets, which shows the layered structure of MnO2, confirming the successful synthesis of MnO2 nanomaterials. Figure 3 In D, since the absorption spectrum of MnO2 nanosheets overlaps significantly with the emission spectrum of FAM-ssDNA, fluorescence resonance energy transfer (FRET) occurs after the addition of MnO2 nanosheets, and the fluorescence of FAM is quenched by the MnO2 nanosheets. Figure 4Figure A shows the X-ray photoelectron spectroscopy (XPS) spectrum of MnO2 nanosheets. The figure reveals three characteristic peaks for MnO2: the O1S peak at 529.08 eV, the MnO2 peak at 642 eV, and the peak of MnO2 at 642 eV. 2P 3 / 2 Peak and Mn at 654 eV 2P 1 / 2 . Figure 4 B and C show the O1S peak and Mn peak, respectively. 2P 3 / 2 Peaks and Mn 2P 1 / 2 The high-resolution characteristic absorption spectrum of the peak was used to calculate Mn. 2P3 / 2 and Mn 2P1 / 2 The energy separation value between them was 12 eV, which is consistent with previous literature reports. These results all demonstrate the successful preparation of MnO2 nanosheets.

[0030] Weigh 30 mg of pre-prepared solid MnO2 nanosheets and add 30 mL of ultrapure water. Sonicate until MnO2 is completely dispersed to obtain 1 mg / mL of the solution. -1 MnO2 nanosheet solution.

[0031] 2) FEN1 cleavage steps for double-stranded DNA substrate: Three complementary DNA sequences—upstream oligonucleotide (U), downstream strand (D), and template 1 strand (T1)—are hybridized in hybridization buffer (50 mM Tris-HCl, 50 mM MgCl2, U, D, and T1 concentrations are all 10 μM, total reaction volume 50 μL) in a 95°C water bath for 5 minutes. Then, the mixture is slowly cooled to room temperature in a water bath (approximately 6 hours) to obtain the double-stranded DNA substrate (structure shown in Figure 1). Figure 2 As shown in Figure A), 1 μL of double-branched DNA double-stranded substrate (final concentration 1 μM) was reacted with different concentrations of FEN1 (5 × 10⁻⁶ m³ / h). -6 U / μL, 1×10 -5 U / μL, 4×10 -5 U / μL, 4×10 -4 U / μL, 4×10 -3 U / μL, 4×10 -2 The 5′ Flap was cleaved at 37 °C for 2 hours in 1×Thermo Pol reaction buffer (total reaction volume 10 μL) at U / μL or 0.1 U / μL. The cleavage sites are shown below. Figure 2 As shown in B.

[0032] 3) Hybridization with Template T2: Then add Template 2 (Template 2, T2, final concentration 1 μM) and incubate in a 95 °C water bath for 5 minutes to eliminate any possible dimers or multimers. The mixture is then slowly cooled in a water bath (approximately 6 hours) to room temperature to obtain the hybridization product of the 5′Flap single-stranded DNA cleaved from the T2 and FEN1 reactions.

[0033] 4) SDA Amplification Step: Next, add Bst DNA polymerase (final concentration 0.05 U / μL), Nt.BstNBI (final concentration 0.5 U / μL), and dNTPs (final concentration 0.5 mM). Incubate at 55 °C for 60 minutes in 0.5 × NE Buffer 3.1 (50 mM NaCl, 25 mM Tris-HCl, 5 mM MgCl2, 50 μg / mL Recombinant Albumin, pH 7.9, with 1 μL of 10 × NE Buffer 3.1 added, for a total reaction volume of 20 μL) to generate a large number of O sequences. Then, incubate at 80 °C for 10 minutes to inactivate the enzyme and terminate the reaction, obtaining the SDA product. The above SDA reaction process is monitored by gel electrophoresis. Figure 2 As shown in lane C, lane 1 represents the DNA marker. The D strand (lane 2) and U strand (lane 3) hybridize with the T1 strand (lane 4) to form a double-stranded DNA substrate (lane 5). In the presence of the target FEN1, the single-stranded 5′ flap is cleaved, forming double-stranded DNA (lane 6) that moves faster than the double-stranded DNA substrate (lane 5). Upon addition of T2 (lane 7), the cleaved 5′ flap DNA fragment hybridizes with T2 (lane 8). Using BstDNA polymerase (lane 9), the cleaved 5′ flap is extended using T2 as a template to form double-stranded DNA. After using Nt.BstNBI, the double-stranded DNA formed in lane 9 is cleaved, producing a large number of O sequences (the band within the red rectangle in lane 10). Without the target FEN1, no O sequences are produced (lane 11). These results indicate that the O sequences are generated by the SDA process initiated by FEN1.

[0034] 5) Fluorescence detection: Add 20 μL of SDA product to FAM-ssDNA, and after hybridization, add 1 mg / mL of FAM-ssDNA. -1MnO2 nanosheet solutions were diluted to 200 μL with Tris-HCl buffer (composition: 10 mM Tris-HCl, 25 mM MgCl2, 5 mM CaCl2, pH 7.5). The final concentration of FAM-ssDNA was 300 nM, and the final concentrations of MnO2 were 0, 5, 16, 20, 32, 40, 45, and 50 μg / mL. After incubation for 12 minutes, fluorescence spectra were measured. Fluorescence emission spectra were acquired at an excitation wavelength of 488 nm, with a scanning range of 493-650 nm, and the fluorescence intensity value at 518 nm was recorded.

[0035] Add 20 μL of SDA product to FAM-ssDNA, and after hybridization, add 1 mg / mL of the product. -1 A solution of MnO2 nanosheets was diluted to 200 μL with Tris-HCl buffer (composition: 10 mM Tris-HCl, 25 mM MgCl2, 5 mM CaCl2, pH 7.5). The final concentration of FAM-ssDNA was 300 nM, and the final concentration of MnO2 was 40 μg / mL. Fluorescence spectra were measured after incubation for 2, 4, 6, 8, 10, 12, 14, and 16 minutes. Fluorescence emission spectra were collected at an excitation wavelength of 488 nm, with a scanning range of 493-650 nm, and the fluorescence intensity value at 518 nm was recorded.

[0036] Experimental results are as follows Figure 5 As shown in A, B, C, and D, from Figure 5 As can be seen from A and B, the fluorescence quenching of FAM becomes more significant with increasing MnO2 concentration. At a final MnO2 concentration of 40 μg / mL, the fluorescence quenching essentially stabilizes. Figure 5 C shows that the reaction time between MnO2 and FAM-ssDNA is 12 minutes, indicating the best inactivation effect. Figure 5 D shows that when the MnO2 concentration is 40 μg / mL, the system has the best signal-to-noise ratio, which is more beneficial for FEN1 detection.

[0037] 6) Plotting the standard curve: Add 20 μL of SDA product to FAM-ssDNA, and after hybridization, add 1 mg / mL of FAM-ssDNA. -1 A solution of MnO2 nanosheets was diluted to 200 μL with Tris-HCl buffer (composition: 10 mM Tris-HCl, 25 mM MgCl2, 5 mM CaCl2, pH 7.5). The final concentration of FAM-ssDNA was 300 nM, and the final concentration of MnO2 was 40 μg / mL. After incubation for 12 minutes, the fluorescence spectrum was measured. The fluorescence emission spectrum was acquired at an excitation wavelength of 488 nm, with a scanning range of 493-650 nm. The fluorescence intensity value at 518 nm was recorded. The experimental results are as follows: Figure 6 The standard curve equation is shown to be y = 6695.96 + 1139.79log c ( c (where y is the concentration of FEN1 and y is the detected fluorescence intensity), FEN1 at 5 × 10 -6 It exhibits good linearity in the range of U / μL to 0.1 U / μL, with a detection limit of 1.6 × 10⁻⁶. -6 U / μL. Example 2

[0038] A method for detecting FEN1 enzyme based on a fluorescence sensing system using manganese dioxide nanosheets is described below: 1) Preparation of MnO2 nanosheets: 0.5937 g of MnCl2•4H2O was dissolved in 10 mL of ultrapure water to obtain a 0.3 mmol / mL MnCl2 solution A. 2.1748 g of TMA•OH was dissolved in 18 mL of water, and 2 mL of H2O2 (30 wt%) was added to obtain a mixed solution B of TMA•OH and H2O2. Solution B was quickly poured into solution A (this step must be completed within 15 s), forming a dark brown suspension. The suspension was then stirred at room temperature for 24 h to fully complete the oxidation reaction. To purify MnO2, the resulting solution was centrifuged for 10 min (10000 rpm), washed three times with ethanol and ultrapure water respectively, and dried at -60℃ using a vacuum freeze dryer to remove residual solvent, yielding solid MnO2 nanosheets. Weigh 30 mg of pre-prepared solid MnO2 nanosheets and add 30 mL of ultrapure water. Sonicate until MnO2 is completely dispersed to obtain 1 mg / mL of the solution. -1 MnO2 nanosheet solution.

[0039] 2) FEN1 cleavage of bibranched DNA double-stranded substrate: Three complementary DNA sequences, the upstream oligonucleotide (U), the downstream strand (D), and the template 1 strand (T1), are hybridized in hybridization buffer (50 mM Tris-HCl, 50 mM MgCl2, U, D, and T1 concentrations are all 10 μM, total reaction volume 50 μL) at 95 °C for 5 minutes. The mixture is then slowly cooled to room temperature in a water bath (approximately 6 hours) to obtain the bibranched DNA double-stranded substrate. 1 μL of the bibranched DNA double-stranded substrate (final concentration 1 μM), different concentrations of ATA inhibitors (2 nM, 50 nM, 100 nM, 200 nM, 400 nM, 600 nM, 800 nM, 1000 nM), and FEN1 (4 × 10⁻⁶) are added. -2The reaction mixture (U / μL) was incubated at 37 °C for 2 hours in 1×Thermo Pol reaction buffer (10 mM KCl, 20 mM Tris-HCl, 10 mM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100, pH 8.8, total reaction volume 10 μL).

[0040] 3) Hybridization with Template T2: Then add 1 μM Template 2 (Template 2, T2, final concentration 1 μM) and incubate in a 95 °C water bath for 5 minutes to eliminate any possible dimers or multimers. Then, slowly cool the mixture in a water bath (approximately 6 hours) to room temperature to obtain the hybridization product of the 5′Flap single-stranded DNA cleaved from the T2 and FEN1 reactions.

[0041] 4) SDA amplification step: Next, add Bst DNA polymerase (final concentration 0.05 U / μL), Nt.BstNBI (final concentration 0.5 U / μL), and dNTPs (final concentration 0.5 mM). Incubate at 55 °C for 60 minutes in NEBuffer 3.1 (50 mM NaCl, 25 mM Tris-HCl, 5 mM MgCl2, 50 μg / mL Recombinant Albumin, pH 7.9, with 1 μL of 10×NEBuffer 3.1 buffer added, for a total reaction volume of 20 μL) to generate the O sequence. Then, incubate at 80 °C for 10 minutes to inactivate the enzyme and terminate the reaction.

[0042] 5) Fluorescence detection: Add 20 μL of SDA product to FAM-ssDNA, hybridize, and then add 1 mg / mL of the solution. -1 A solution of MnO2 nanosheets was diluted to 200 μL with Tris-HCl buffer. The final concentration of FAM-ssDNA was 300 nM, and the final concentration of MnO2 was 40 μg / mL. After incubation for 12 minutes, fluorescence spectra were measured. Fluorescence emission spectra were acquired at an excitation wavelength of 488 nm, with a scanning range of 493-650 nm, and the fluorescence intensity value at 518 nm was recorded. The inhibition rates of different ATA concentrations were calculated and plotted. The results are shown in [Figure number missing]. Figure 7 As can be seen from the figure, IC 50 It is 155 nM.

[0043] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Those skilled in the art can make other variations or modifications based on the above description. It is neither necessary nor possible to exemplify all embodiments here. However, obvious variations or modifications derived from this solution are still within the scope of protection of the present invention.

Claims

1. A method for detecting FEN1 enzyme using a fluorescence sensing system based on manganese dioxide nanosheets, characterized in that, Includes the following steps: 1) Preparation of MnO2 nanosheets; 2) Prepare bibranched substrate DNA by reacting the bibranched substrate DNA with gradient concentrations of FEN1 enzyme; 3) Add template 2 to step 2) so that template 2 and the 5' Flap single-stranded DNA cut by FEN1 enzyme reaction can hybridize; 4) Add Bst DNA polymerase, Nt.BstNBI and dNTPs to step 3) to carry out SDA reaction to obtain SDA product; 5) React the SDA product from step 4) with FAM-ssDNA in a water bath at 35-40℃ for 1.5-2.5 hours, add MnO2 nanosheets and Tris-HCl buffer, incubate, and then detect the fluorescence spectrum; plot a standard curve with FEN1 enzyme concentration as the x-axis and fluorescence intensity as the y-axis to obtain the standard curve equation. 6) Replace the FEN1 enzyme gradient concentrations in step 2) with the FEN1 enzyme of the desired concentration, and repeat steps 2) to 5) to measure the fluorescence spectrum. Substitute the fluorescence spectrum into the standard curve equation to obtain the concentration of the FEN1 enzyme to be tested. The method described is for non-disease diagnostic purposes.

2. The method according to claim 1, characterized in that, Step 1) is as follows: Prepare a 0.2-0.4 mmol / mL MnCl2 aqueous solution A, prepare a 1.3 mmol / mL-1.4 mmol / mL TMA·OH aqueous solution, add commercially available hydrogen peroxide to obtain a mixed solution B of TMA·OH and hydrogen peroxide, pour solution B into solution A within 15 s to form a suspension, then continue stirring the suspension at room temperature for at least 24 h, centrifuge, wash, freeze-dry to obtain solid MnO2 nanosheets, weigh the solid MnO2 nanosheets and add them to ultrapure water, sonicate until MnO2 is completely dispersed to obtain 0.5-2 mg / mL -1 The volume ratio of MnO2 nanosheet solution, TMA·OH aqueous solution and hydrogen peroxide is 9:1, and the volume ratio of solution B to solution A is 2:

1.

3. The method according to claim 1, characterized in that, The specific process of step 2) is as follows: The three complementary DNA sequences—upstream strand U, downstream strand D, and template strand 1—are treated in hybridization buffer at 90-95°C for 3-8 minutes, then allowed to cool naturally to room temperature in the water bath to obtain a bibranched DNA substrate. The bibranched DNA substrate is then incubated with FEN1 in 1×Thermo Pol reaction buffer at 35-40°C for 1.5-2.5 hours. The final concentration of the bibranched DNA substrate is 1 μM, and the concentration range of FEN1 is 5×10⁻⁶. -6 U / μL to 0.1 U / μL.

4. The method according to claim 3, characterized in that, The DNA sequence of upstream strand U from 5' to 3' is CGACCGTGCCAGCCTAAATTTCAATCCACCCGTCCT, the DNA sequence of downstream strand D from 5' to 3' is CCAAGGCCAGACGTAAACCCGACGCCACCTCCTG, and the DNA sequence of template strand 1 from 5' to 3' is GCAGGAGGTGGCGTCGGGTGGACGGGTGGATTG AAATTTAGGCTGGCACGGTCG. The final concentration of upstream strand U, downstream strand D, and template strand 1 in the hybridization buffer is 10 μM. The hybridization buffer consists of 50 mM Tris-HCl, 50 mM MgCl2, and water as the solvent.

5. The method according to claim 1, characterized in that, The specific steps of step 3) are as follows: Add template 2, incubate in a water bath at 90~95 ℃ for 3~8 minutes, and then let it cool naturally to room temperature in the water bath. The DNA sequence of template 2 from the 5' end to the 3' end is TCAACATCAGTCTGATAAGCTAAGCTGACTCGGGTTTACGTCTGGCCTTGG. The final concentration of template 2 in the reaction system is 1 μM.

6. The method according to claim 1, characterized in that, The specific process of step 4) is as follows: Add Bst DNA polymerase, Nt.BstNBI endonuclease and dNTPs, and incubate in NEBuffer 3.1 buffer at 50-60 °C for 0.5-1.5 hours. Then, maintain at 75-85 °C for 5-15 minutes to inactivate the enzymes and terminate the reaction. The final concentration of Bst DNA polymerase is 0.05 U / μL, the final concentration of Nt.BstNBI endonuclease is 0.5 U / μL, and the final concentration of dNTPs is 0.5 mM.

7. The method according to claim 1, characterized in that, The specific process of step 5) is as follows: After reacting the SDA product with FAM-ssDNA in a water bath at 35~40℃ for 1.5~2.5 hours, add MnO2 nanosheets and Tris-HCl buffer, incubate for 10~15 minutes, and then detect fluorescence. During spectral detection, collect the fluorescence emission spectrum at an excitation wavelength of 488nm, scan the range of 493-650nm, and record the fluorescence intensity value at 518nm.

8. The method according to claim 7, characterized in that, The FAM-ssDNA sequence from the 5' end to the 3' end is FAM-CCAAGGCCAGACGTAAACCCGAGTCAGCT.

9. The method according to claim 7, characterized in that, The Tris-HCl buffer solution has the following composition: 10 mM Tris-HCl, 25 mM MgCl2, 5 mM CaCl2, pH 7.

5.

10. The method according to claim 7, characterized in that, In step 5), the final concentration of FAM-ssDNA is 300 nM and the final concentration of MnO2 is 40 μg / mL.

Images