A fluorescent penetration test standard reagent, a preparation method and application thereof

Abstract

The application discloses a fluorescent penetration test standard reagent and a preparation method and application thereof. The application realizes relative balance of detection signals of different labeled fragments in a multicolor fluorescent labeling amplification process in a single reaction system through primer restriction and amplification end control, and further solves the problems of poor balance and insufficient batch stability of the multicolor fluorescent standard reagent in the prior art. In addition, the controllable, stable and uniform multicolor fluorescent standard reagent preparation system constructed by the application can not only meet the consistency and repeatability requirements of a standard reagent for a genetic analyzer spectrum calibration, but also provide a reliable quality control means for a multicolor fluorescent detection system.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a standard reagent for fluorescence permeation testing, its preparation method, and its application. Background Technology

[0002] Fluorescent labeling genotyping technology uses fluorescent dyes with different emission wavelengths labeled at the 5' end of PCR primers, combined with capillary electrophoresis, to achieve simultaneous detection of DNA fragments at multiple sites. It is widely used in individual identification, paternity testing, and analysis of complex biological samples. With the development of multiplex PCR, the number of sites detected in a single reaction system has been increasing, and the number of fluorescence channels has gradually developed from the early four colors to six, eight, or even more. However, the overlapping of dye emission spectra can cause fluorescence crosstalk, producing non-specific peaks and affecting interpretation. Genetic analyzers usually address this by using spectral calibration based on calibration reagents, that is, constructing a calibration matrix to deconvolve the signal and setting a signal threshold to screen for effective peaks, thereby reducing the impact of crosstalk on the results. The quality of calibration reagents directly determines the accuracy of calibration and must meet the following requirements: (1) the signal intensity of each fluorescence channel is reasonable and uniform; (2) the lengths of labeled fragments do not overlap; and (3) the standard reagents have good batch-to-batch stability.

[0003] The preparation of existing fluorescence permeation assay reagents usually includes the following two approaches: (1) quantitative mixing after single-color amplification; (2) adjusting the primer ratio after multi-template amplification. However, in practical applications, there are still several obvious shortcomings: a. Differences in amplification efficiency lead to uneven fluorescence signals. During PCR amplification, the amplification efficiency of different DNA fragments is significantly affected by factors such as fragment length, GC content, primer sequence, and template structure. When different fluorescently labeled fragments are amplified separately, differences in amplification efficiency exist between reaction systems, ultimately making it difficult to maintain consistent endpoint yields for different amplification products. Consequently, the fluorescence peak heights after mixing are inconsistent. If the peak height difference is significant, it will reduce the accuracy of spectral matrix calculations, thereby affecting the spectral penetration test results.

[0004] b. Errors introduced by manual mixing steps. Existing technologies typically require quantitative mixing of multiple amplification products. This process involves numerous steps and is prone to pipetting errors or concentration measurement errors, leading to significant differences between different batches of reagents and affecting the repeatability of test results.

[0005] c. Poor batch stability. Because the mixing ratio of the amplification system and amplification products is difficult to maintain perfectly, different batches of prepared fluorescent standard reagents often exhibit differences in peak height distribution. This batch variation further affects the spectral matrix calculation results, causing fluctuations and systematic biases in the spectral calibration results of the genetic analyzer after calibration at different times or with different batches, thus affecting the instrument's detection stability. Furthermore, in multicolor fluorescence detection systems, excessive differences in signal intensity among the fluorescence channels significantly increase fluorescence crosstalk errors, affecting the calculation results of the matrix algorithm.

[0006] d. The complex operation process hinders standardized production. The stepwise amplification and subsequent mixing process is cumbersome, making it difficult to establish a stable and standardized production system for fluorescence calibration reagents.

[0007] In summary, existing preparation methods still suffer from poor uniformity of amplified products, insufficient batch stability, and complex operation, making it difficult to meet the high consistency requirements of multicolor fluorescence detection systems for standard reagents. Therefore, it is necessary to develop a method for preparing fluorescence permeation assay standard reagents that can simultaneously amplify multiple fluorescently labeled fragments in a single reaction system and achieve consistent amplification endpoint yields by controlling primer consumption, thereby improving the accuracy and repeatability of spectral calibration. Summary of the Invention

[0008] To address at least some of the problems existing in the prior art, this invention artificially synthesizes multiple DNA templates and performs multicolor fluorescent labeling amplification in a single reaction system. Based on the signal intensity of different fluorescent labels on the genetic analyzer, primer concentration and PCR cycle number are quantitatively controlled to ensure the PCR reaction enters a primer-limited state at the endpoint, achieving relative balance in the detection signals of different fluorescent label fragments. This solves the problems of poor uniformity and insufficient batch stability of multicolor fluorescent standard reagents in the prior art. Furthermore, the controllable, stable, and uniform multicolor fluorescent standard reagent preparation system constructed in this invention can meet the requirements of genetic analyzer spectral calibration for the consistency and repeatability of standard reagents, and provides a reliable quality control method for multicolor fluorescence detection systems. Specifically, this invention includes the following:

[0009] In a first aspect, the present invention provides a method for preparing a standard reagent for a fluorescence permeation assay, comprising the step of performing a single-system synchronous amplification of a DNA template using a primer combination containing a sequence such as SEQ ID No. 1-12 under primer restriction conditions and amplification endpoint control conditions, wherein the primer restriction conditions include controlling the final concentration of each primer pair in the reaction system to be less than 0.040 μM, and the amplification endpoint control conditions include controlling the number of PCR cycles in the synchronous amplification program to be greater than 30.

[0010] In some embodiments, according to the method for preparing the fluorescence permeation test standard reagent of the present invention, the primer set includes a first primer set to a sixth primer set, wherein the first primer set includes primer pairs with sequences as shown in SEQ ID No. 1-2, the second primer set includes primer pairs with sequences as shown in SEQ ID No. 3-4, the third primer set includes primer pairs with sequences as shown in SEQ ID No. 5-6, the fourth primer set includes primer pairs with sequences as shown in SEQ ID No. 7-8, the fifth primer set includes primer pairs with sequences as shown in SEQ ID No. 9-10, and the sixth primer set includes primer pairs with sequences as shown in SEQ ID No. 11-12.

[0011] In some embodiments, according to the method for preparing the fluorescent permeation test standard reagent of the present invention, the primer contains a detectable group selected from 6-FAM, HEX, NED, NH618, NH635 or NH650.

[0012] In some embodiments, according to the method for preparing the fluorescent permeation assay standard reagent of the present invention, the first primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 13, the second primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 14, the third primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 15, the fourth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 16, the fifth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 17, and the sixth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 18.

[0013] In some embodiments, according to the method for preparing the fluorescence permeation test standard reagent of the present invention, the single system includes a PCR reaction mixture, a primer combination, a DNA template, and ddH2O.

[0014] In some embodiments, according to the method for preparing the fluorescent permeation assay standard reagent of the present invention, the volume ratio of the primer combination to the DNA template is 1:(1-5).

[0015] In some embodiments, according to the method for preparing the fluorescence permeation test standard reagent of the present invention, the method includes: (1) DNA templates containing different primer binding sites were amplified using cloning primers, and the amplification products were purified by agarose electrophoresis and gel recovery. (2) The purified DNA was ligated and transformed using a cloning vector, and the DNA was then extracted and digested with enzymes to obtain the enzyme digestion product; (3) The product was simultaneously amplified in a single system using the primer combination under primer restriction conditions and amplification endpoint control conditions.

[0016] In some embodiments, according to the method for preparing the fluorescence permeation test standard reagent according to the present invention, the synchronous amplification program in step (3) includes: pre-denaturation at 90-98℃ for 0.5-5 min; denaturation at 90-98℃ for 5-30 s, annealing at 45-65℃ for 1-5 min, extension at 65-75℃ for 10-60 s as one cycle, with a cycle number greater than 30; and final extension at 50-70℃ for 10-30 min.

[0017] A second aspect of the present invention provides a standard reagent for fluorescence permeation testing, which is obtained by the method described in any one of the first aspects.

[0018] A third aspect of the present invention provides a kit for preparing standard reagents for fluorescence permeation testing, comprising: A primer combination containing sequences such as SEQ ID No. 1-12, wherein each primer in the primer combination is configured in the reaction system to a final concentration of less than 0.040 μM; DNA templates with sequences like SEQ ID No. 13-18; and Optional instruction manual, wherein the instruction manual includes instructions on the preparation steps of the standard reagent for fluorescence permeation testing.

[0019] In a fourth aspect, the present invention provides the use of the fluorescence permeation test standard reagent of any of the above claims in the preparation of products for typing detection.

[0020] This invention achieves a relatively balanced amount of multicolor fluorescence amplification products by introducing a primer restriction mechanism at the PCR amplification endpoint. It solves key problems in existing technologies, such as poor uniformity of standard reagents for fluorescence permeation testing, insufficient batch stability, and complex operation procedures. Technically, it is innovative and practical. In application, it can significantly improve the accuracy and repeatability of spectral calibration of genetic analyzers, reduce the detection cost of gene testing, and improve the level of quality control. It has good promotion and application value and industrialization prospects. Attached Figure Description

[0021] Figure 1 The results are from the fluorescence permeation test standard reagents tested on a 3130xL genetic analyzer.

[0022] Figure 2 The results of the fluorescence permeation test standard reagents on a Model 3500 genetic analyzer are shown.

[0023] Figure 3 The results are from the test of the fluorescence penetration test standard reagent on the GA118-24B genetic analyzer.

[0024] Figure 4 The test results of Comparative Example 1 on the GA118-24B genetic analyzer are shown.

[0025] Figure 5 The test results of Comparative Example 2 on the GA118-24B genetic analyzer are shown.

[0026] Figure 6 The test results of Comparative Example 3 on a 3130xL genetic analyzer are shown.

[0027] Figure 7 The test results of Comparative Example 4 on the GA118-24B genetic analyzer are shown. Detailed Implementation

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0031] Preparation method One aspect of the present invention provides a method for preparing a standard reagent for a fluorescence permeation assay, comprising the step of performing single-system simultaneous amplification of multiple DNA templates using primer combinations containing sequences such as SEQ ID No. 1-12 under primer restriction conditions and amplification endpoint control conditions, wherein the primer restriction conditions include controlling the final concentration of each primer pair in the reaction system to be less than 0.040 μM, and the amplification endpoint control conditions include controlling the number of PCR cycles in the simultaneous amplification program to be greater than 30.

[0032] Through extensive experiments, this invention has found that introducing primer restriction conditions and amplification endpoint control conditions during the preparation process can achieve balanced amplification product yield, significantly improve batch stability, and further ensure the balance of fluorescence peak height and the accuracy of calibration results. In this invention, primer restriction conditions refer to controlling the final concentration of each primer in the reaction system to be below 0.040 μM, and amplification endpoint control conditions refer to controlling the number of PCR cycles in the synchronous amplification program to be greater than 30 (preferably greater than 31, 32, 33, 34, 35, 37, or 38 cycles).

[0033] In a preferred embodiment, the primer combination includes a first primer set to a sixth primer set, wherein the first primer set includes primers with sequences as shown in SEQ ID No. 1-2, the second primer set includes primers with sequences as shown in SEQ ID No. 3-4, the third primer set includes primers with sequences as shown in SEQ ID No. 5-6, the fourth primer set includes primers with sequences as shown in SEQ ID No. 7-8, the fifth primer set includes primers with sequences as shown in SEQ ID No. 9-10, and the sixth primer set includes primers with sequences as shown in SEQ ID No. 11-12. In a more preferred embodiment, the first primer set includes an upstream primer with the sequence shown in SEQ ID No. 1 and a downstream primer with the sequence shown in SEQ ID No. 2; the second primer set includes an upstream primer with the sequence shown in SEQ ID No. 3 and a downstream primer with the sequence shown in SEQ ID No. 4; the third primer set includes an upstream primer with the sequence shown in SEQ ID No. 5 and a downstream primer with the sequence shown in SEQ ID No. 6; the fourth primer set includes an upstream primer with the sequence shown in SEQ ID No. 7 and a downstream primer with the sequence shown in SEQ ID No. 8; the fifth primer set includes an upstream primer with the sequence shown in SEQ ID No. 9 and a downstream primer with the sequence shown in SEQ ID No. 10; and the sixth primer set includes an upstream primer with the sequence shown in SEQ ID No. 11 and a downstream primer with the sequence shown in SEQ ID No. 12.

[0034] In a preferred embodiment, the first primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 13, the second primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 14, the third primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 15, the fourth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 16, the fifth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 17, and the sixth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 18.

[0035] In a preferred embodiment, the final concentration of the first primer set in the reaction system is less than 0.040 μM, preferably less than 0.035 μM, even more preferably less than 0.030 μM, and greater than 0.020 μM, for example 0.020-0.040 μM, 0.020-0.035 μM, 0.020-0.030 μM, such as 0.020, 0.021, 0.022, 0.023, 0.024, 0.025, 0.026, 0.027, 0.028, 0.029, 0.030 μM.

[0036] In a preferred embodiment, the final concentration of the second primer set in the reaction system is less than 0.040 μM, preferably less than 0.038 μM, even more preferably less than 0.035 μM, and further preferably less than 0.030 μM. Optionally, its final concentration is greater than 0.010 μM, for example, 0.010-0.040 μM, 0.010-0.035 μM, 0.010-0.030 μM, such as 0.010, 0.020, 0.021, 0.022, 0.023, 0.024, 0.025, 0.026, 0.027, 0.028, 0.029, 0.030, 0.031, 0.032, 0.033, 0.034, 0.035 μM.

[0037] In a preferred embodiment, the final concentration of the third primer set in the reaction system is less than 0.040 μM, preferably less than 0.030 μM, even more preferably less than 0.020 μM, and further preferably less than 0.010 μM. Optionally, its final concentration is greater than 0.005 μM, for example, 0.005-0.040 μM, 0.005-0.010 μM, such as 0.005, 0.006, 0.007, 0.008, 0.009, 0.010 μM.

[0038] In a preferred embodiment, the final concentration of the fourth primer set in the reaction system is less than 0.040 μM, preferably less than 0.030 μM, even more preferably less than 0.020 μM, and further preferably less than 0.018 μM. Optionally, its final concentration is greater than 0.010 μM, for example 0.010-0.040 μM, 0.010-0.018 μM, 0.010-0.017 μM, 0.010-0.016 μM, such as 0.010, 0.011, 0.012, 0.013, 0.014, 0.015, and 0.016 μM.

[0039] In a preferred embodiment, the final concentration of the fifth primer set in the reaction system is less than 0.040 μM, preferably less than 0.030 μM, even more preferably less than 0.020 μM, and further preferably less than 0.019 μM. Optionally, its final concentration is greater than 0.010 μM, for example, 0.010-0.040 μM, 0.010-0.018 μM, such as 0.010, 0.011, 0.012, 0.013, 0.014, 0.015, 0.016, 0.017, and 0.018 μM.

[0040] In a preferred embodiment, the final concentration of the sixth primer set in the reaction system is less than 0.040 μM, preferably less than 0.030 μM, and even more preferably less than 0.025 μM. Optionally, its final concentration is greater than 0.010 μM, for example 0.010-0.040 μM, 0.010-0.025 μM, 0.020-0.025 μM, such as 0.020, 0.021, 0.022, 0.023, 0.024, 0.025 μM.

[0041] In a more preferred embodiment, the molar concentration ratio of the first primer set to the second primer set is (0.58-0.62):1, preferably (0.59-0.61):1; the molar concentration ratio of the second primer set to the third primer set is (3.45-3.55):1, preferably (3.48-3.52):1; the molar concentration ratio of the third primer set to the fourth primer set is (0.61-0.64):1, preferably (0.62-0.63):1; the molar concentration ratio of the fourth primer set to the fifth primer set is (0.87-0.90):1, preferably (0.88-0.89):1; and the molar concentration ratio of the fifth primer set to the sixth primer set is (0.80-0.83):1, preferably (0.81-0.82):1.

[0042] The primers of this invention contain a detectable group selected from 6-FAM, HEX, NED, NH618, NH635, or NH650. In a preferred embodiment, the detectable group is located at the 5' end of the upstream primer of each primer set. In a specific embodiment, the detectable group is located at the 5' end of the upstream primer shown in SEQ ID No. 1, 3, 5, 7, 9, and 11.

[0043] Compared with existing technologies, this invention addresses key technical problems in the preparation of fluorescence permeation assay standard reagents, including "uneven amplification product yield" and "insufficient batch stability." It systematically optimizes aspects such as template design, multiplex PCR system construction, and amplification endpoint control strategies, resulting in a highly controllable, reproducible method for preparing fluorescence permeation assay standard reagents suitable for multicolor fluorescence detection systems. This invention artificially synthesizes multiple DNA templates, ensuring each amplified fragment has an independent primer-binding region, and performs simultaneous multicolor fluorescence amplification within the same PCR reaction system, thus avoiding the inconsistency in reaction conditions between traditional stepwise amplification systems. Simultaneously, by optimizing primer concentration, this invention ensures the PCR reaction enters a primer-limited state at the endpoint. That is, after the amplification reaction reaches the plateau phase, the final yield of each amplified fragment is mainly determined by the total amount of primers, thereby achieving a more consistent yield of different fluorescent fragments. This strategy effectively reduces amplification bias caused by differences in fragment length, GC content, primer binding efficiency, and template structure, resulting in a more balanced intensity distribution of multicolor fluorescence signals and improving the uniformity of the standard reagent.

[0044] This invention optimizes the traditional "multi-system amplification + quantitative mixing" preparation process into a "single-system simultaneous amplification" preparation mode, significantly reducing experimental steps and minimizing the impact of human error in pipetting and concentration measurement on the results. It also avoids the influence of instability differences in different amplification products during the later mixing process, resulting in better repeatability and consistency of the standard reagent across different batches. Furthermore, because this invention uses a unified template system for amplification, reaction conditions are easier to control, providing a technical foundation for the large-scale preparation of fluorescence permeation assay standard reagents. Compared to existing technologies that rely on empirically adjusting primer ratios, this invention achieves automatic consistency in product quantity through an endpoint restriction strategy, exhibiting stronger theoretical rationality and repeatability. It effectively reduces the amplification competition effect commonly found in multiplex PCR systems and improves the stability of multicolor system construction. The fluorescence permeation assay standard reagent prepared by this invention provides a more balanced multi-channel fluorescence signal with a more uniform peak height distribution, ensuring that each fluorescence channel signal is within a reasonable detection range during spectral calibration of the genetic analyzer. This improves the accuracy of matrix algorithms in correcting fluorescence crosstalk, reduces spectral overlap errors between different fluorescent dyes, and enhances signal recognition accuracy. This invention avoids multiple independent amplification steps and subsequent manual mixing, resulting in better batch-to-batch homogeneity and stability of the standard reagents. It can be used as a quality control (QC) material in multicolor fluorescence detection systems to monitor instrument status and system stability. Furthermore, because this invention achieves consistent product yield through primer endpoint control, the results from different batches are less affected by random factors. This effectively extends the lifespan of spectral calibration reagents, reduces the frequency of repeated calibrations in the laboratory, thereby reducing detection costs and improving experimental efficiency.

[0045] In this invention, single-system synchronous amplification refers to the process of performing multicolor fluorescence synchronous amplification in the same PCR reaction system using a reaction solution containing the primer composition described above. The reaction solution or reaction system also includes a PCR reaction mixture, a DNA template, and ddH2O. The specific components of the PCR reaction mixture are not particularly limited; a pre-prepared mixture containing all necessary components except the template and primers, known in the art, can be used. This typically includes, but is not limited to, DNA polymerase, dNTPs (dATP, dTTP, dCTP, dGTP), reaction buffer, and Mg2+. 2+ (Usually MgCl2) etc.

[0046] In this invention, the volume ratio of primer combination to DNA template in the reaction system is 1:(1-5), preferably 1:(1-4), more preferably 1:(1-3), and even more preferably 1:(1-2), for example 1:1, 1:1.2, 1:1.4, 1:1.6, 1:1.8, 1:2.

[0047] In a preferred embodiment, the preparation method of the present invention includes: (1) DNA templates containing different primer binding sites were amplified using cloning primers, and the amplification products were purified by agarose electrophoresis and gel recovery. (2) The purified DNA was ligated and transformed using a cloning vector, and the DNA was then extracted and digested with enzymes to obtain the enzyme digestion product; (3) The product was simultaneously amplified in a single system using the primer combination under primer restriction conditions and amplification endpoint control conditions.

[0048] In step (1) of the present invention, the sequences of the DNA template are shown in SEQ ID No. 13-18 respectively. The cloning primer sequences are not specifically limited and can be designed according to the DNA template sequences. The amplification conditions can be adjusted according to actual needs.

[0049] In step (2) of the present invention, the vector used for cloning PCR products is not particularly limited, and cloning vectors such as, but not limited to, pCloneEZ, pZErO-2, and pCR4Blunt-TOPO can be used.

[0050] In step (2) of the present invention, the synchronous amplification program includes: pre-denaturation at 90-98℃ for 0.5-5 min; denaturation at 90-98℃ for 5-30 s, annealing at 45-65℃ for 1-5 min, and extension at 65-75℃ for 10-60 s as one cycle, with a cycle number greater than 30; and final extension at 50-70℃ for 10-30 min. Preferably, the synchronous amplification program includes: pre-denaturation at 92-98℃ for 1-4 min; denaturation at 92-98℃ for 10-30 s, annealing at 50-65℃ for 1-4 min, and extension at 70-75℃ for 20-50 s as one cycle, with a cycle number greater than 32; and final extension at 55-65℃ for 15-25 min. Preferably, the synchronous amplification program includes: pre-denaturation at 94-96℃ for 1-3 min; denaturation at 94-96℃ for 10-20 s, annealing at 55-65℃ for 1-3 min, and extension at 70-74℃ for 25-35 s as one cycle, with the number of cycles being greater than 34 (but not exceeding 40 cycles, for example, 35, 36, 37, 38, or 39 cycles); and final extension at 58-62℃ for 18-22 min.

[0051] Fluorescence Penetration Test Standard Reagent One aspect of the present invention provides a fluorescence permeation assay standard reagent. The "fluorescence permeation assay standard reagent" refers to a DNA molecular weight standard of the present invention comprising a series of nucleotide fragments with different fragment length distributions, wherein the fragment length is less than 500 bp, preferably less than 400 bp, particularly less than 300 bp, for example less than 200 bp. In a specific embodiment, the fluorescence permeation assay standard reagent comprises nucleotide fragments with fragment lengths of 74, 104, 126, 145, 165, and 196 bp, respectively.

[0052] Reagent test kit In one aspect, the present invention provides a kit for preparing a standard reagent for fluorescence permeation testing, the kit comprising: A primer combination containing sequences such as SEQ ID No. 1-12, wherein each primer pair in the primer combination is configured to a final concentration of less than 0.040 μM in a single reaction system; DNA templates with sequences like SEQ ID No. 13-18; and Optional instruction manual, wherein the instruction manual includes instructions on the preparation steps of the standard reagent for fluorescence permeation testing.

[0053] Those skilled in the art will understand that the kit may include, in addition to the components described above, optional buffer solutions and reagents necessary for gel electrophoresis, purification, polymerase chain reaction, etc.

[0054] The kit of the present invention may also include precautions related to the regulation of the manufacture, use, or sale of the diagnostic kit, in a manner prescribed by government agencies. Additionally, the kit of the present invention may provide detailed instructions for use, storage, and troubleshooting. The kit may also optionally be housed in a suitable device, preferably for high-throughput robotic operation.

[0055] In some embodiments, the components of the kit of the present invention may be disposed in a container. The container typically includes at least one vial, test tube, flask, bottle, syringe, and / or other container means, wherein the solvent may optionally be placed in equal portions. The kit may also include means for containing a second container of sterile, pharmaceutically acceptable buffers and / or other solvents.

[0056] In some embodiments, the components of the kit of the present invention may be provided in dry powder form, such as lyophilized powder. In some embodiments, the components of the kit of the present invention may also be provided in solution form, such as aqueous solution. When present in aqueous solution form, the concentration or content of these components can be readily determined by those skilled in the art according to different needs.

[0057] In kits containing more than one component, the kit typically also includes second, third, or other additional containers for individually holding other components. Additionally, combinations of multiple components may be contained within the containers. Any combination or reagent described herein may be a component of the kit.

[0058] application One aspect of this invention provides the application of a fluorescence permeation test standard reagent in the preparation of products for genotyping detection. Specific applications of genotyping detection include, but are not limited to, individual identification, paternity testing, and analysis of complex biological samples. In some specific embodiments, genotyping detection includes SSR, SNP, and STR genotyping.

[0059] In this invention, the system or platform used for detection is not particularly limited and can be any device or instrument that contains a capillary electrophoresis system, such as, but not limited to, the 3130xL type, 3500 type, GA118-24B type, 7300+3130 type, 3100-AVANT type, GA118-16A type genetic analyzer, etc.

[0060] The present invention does not particularly limit the steps for detection or calibration; exemplary detection or calibration methods include: (1) Inject the fluorescence permeation test standard reagent of the present invention into the capillary of the analyzer; (2) Apply voltage to perform electrophoresis and detect fluorescence signals; (3) Compare the detected fluorescence signal with a preset standard threshold or standard spectrum; and Optionally, (4) the fluorescence detection parameters of the analyzer are adjusted according to the comparison results.

[0061] Example 1. Six DNA templates were artificially synthesized, each containing a different primer binding site. The specific sequences of the six DNA templates are shown in SEQ ID No. 13-18: SEQ ID No. 13: tgaaggaacagtatctagtccaagcggcatccgtctacggaaagcaggtggccagcatgccacgtaagcgaaacaaaaacggggtttaccttaccgaaatcggtacgg ataccgcgaaagagcagatttataaccgcttcacactgacgccggaaggggatgaaccgcttccatttccgttcacttcttgaagaacccggatatttttgatctgac; SEQ ID No.14: gcaggcagaacgggaaatgccaacaagaaaagtgaaagccctagtggatgataagcactggcagattacgcccgtgccgctgaagagcaggtcgaagatggcaggaaagaaatactgtgggacagcaaaaagcgacgcaatgaggcactcgacgctatgtttatgcgctgtcgacgctgcgcatcagtatttcccgctggcagctggatctcagtgcgctgctggcgagcctg; SEQ ID No.15: cggataaattcgcacacaggaagaggatggtgatgaaatcaacagaggcttgccagcaaccaacaagaaaacactggcagattacgcccgtgccttatccggagaggatgaatgacgcgacaggaagaacttgatagcagtccaatctaggtgacagcctgatgacaggtaaacgggtggcaacagtacagaaagacggacgaagtttacggccacttccgtgtctgacctgaattcag; SEQ ID No.16: cgcagcagggcagcaacgggcaatatattgcaggatattaacagtaactgccttcatagatacacagcgacgcaggggacctgcaggattttatgtatgaaaacgcccaccattcccaccgctgcgcgaatatgcggttatcaaatcggtttcagcggatttggagggcagttgcggtcgttgaacccaccgagtgaaagtg; SEQ ID No.17: aggagcgcctgaacgcgctggcgcagcagcgccacgtagtgtgcaaggatgggtggaacgatgaacagacgctgctgcgtgtggctgaggccatcaataaaacctatacccgccggaatggtgcagaaatg tcgatatcccgtatctgctgggatactggcgggattgacccgaccattgtgtatgaacgctcgaaaaaacatggatctagtagcatggcctagtccaagcggcatccgtctaggcgataatccgctggcgc; SEQ ID No. 18: gcatgccggagcaaatgagaaaatcagcattggcctgttcctcccttaccagcagcgccgggatttgtggaaggcgagagtcagttcgcgttatactgtaggaggcggc gcaacgtcgccagctgtctgcacaggagaaatccctgctggcgcataaagatgagacgctggagtacaaacgccagctggctgcacttggcgacaaggttacgtatc.

[0062] 2. Preparation of cloning templates The synthetic DNA template was amplified using cloning primers. The upstream primer sequence was 5'-CAATGTCACAGTGCGATAT, and the downstream primer sequence was 5'-CGCATATTGACACTAACGC. The amplification system is shown in Table 1.

[0063] Table 1 Cloning PCR Reaction System The 2.5×PCR reaction mixture consisted of EzAmp Fast Taq E2 DNA polymerase (hot-start Taq enzyme, NuHigh Biotechnologies), 12 mM Tris-HCl buffer (Sigma-Aldrich), 50 mM KCl (Sigma-Aldrich), 2 mM MgCl2 (Invitrogen), 200 μM dNTP (Invitrogen), 800 μg / mL bovine serum albumin (BSA, Amresco), 0.08% IGEPAL CA-630 (Sigma-Aldrich), 0.2% Tween-20 (Sigma-Aldrich), and 3.5% glycerol (Sigma-Aldrich). Cycling parameters are shown in Table 2.

[0064] Table 2. Cloning PCR Cycling Parameters 3. Agarose gel electrophoresis and gel recovery To prepare a 1.2% agarose gel: Add 0.96 g of agarose to 80 mL of 1×TBE buffer, heat to boiling and dissolve completely until no flocculent precipitate forms. After naturally cooling to approximately 60 °C, add 8 μL of Genered nucleic acid staining reagent (10000×), mix well, and slowly pour into a pre-cleaned gel casting mold. Let it stand on a horizontal table for approximately 60 min to allow it to completely solidify. Then, add 4.8 μL of 6×Loading Buffer to the PCR amplification product, gently pipette to mix, and add the entire mixture to the gel wells. Simultaneously, use 7 μL of DS2000 DNA Marker as a molecular weight standard. Set the electrophoresis conditions to 140 V for approximately 30 min. After electrophoresis, observe the bands under a UV transilluminator to determine if the target band size matches the corresponding marker band. If the band is clear and the size is as expected, cut the corresponding band from the gel and transfer it to a 1.5 mL centrifuge tube for later use.

[0065] Agarose gel DNA recovery was performed using a standard agarose gel DNA recovery kit (Tiangen). 500 μL of equilibration buffer BL was added to the CB2 adsorption column in the collection tube. After centrifugation at 12000 rpm for 1 min, the waste liquid was discarded, and the adsorption column was returned to the collection tube for later use. Next, 700 μL of solution PC was added to the centrifuge tube containing the target gel fragment, and the tube was incubated at 50°C for 30 min, gently inverting the tube during incubation to promote complete dissolution of the gel fragment. After complete dissolution, the entire solution was transferred to a new CB2 adsorption column, centrifuged at 12000 rpm for 1 min, and the waste liquid in the collection tube was discarded. Then, 600 μL of wash buffer PW was added to the adsorption column, centrifuged at 12000 rpm for 1 min, and the waste liquid was discarded. This washing step was repeated once. The adsorption column was then placed in the collection tube and centrifuged at 12000 rpm for 2 min to remove as much residual wash liquid as possible, and then allowed to dry completely at room temperature for several minutes. Finally, the adsorption column was transferred to a new 1.5 mL centrifuge tube, and 30 μL of elution buffer EB was added dropwise to the center of the adsorption membrane. After standing at room temperature for 2 min, the tube was centrifuged at 12000 rpm for 2 min, and the eluted DNA solution was collected.

[0066] 4. DNA cloning DNA ligation and transformation were performed using the CloneSmart pCloneEZ-TA-Amp / HC vector kit (Lucigen) and DH5α competent cells (CWBIO). The DNA ligation system was prepared according to the requirements in Table 3.

[0067] Table 3 DNA Ligation System After slowly mixing the reaction mixture using a pipette, incubate at room temperature for 5 min. Then, slowly add the entire reaction solution to the pre-thawed competent *E. coli* cells, gently stirring the tube to mix, and incubate on ice for 30 min. After incubation, heat-shock the centrifuge tube in a 42°C metal bath for 45 s, then immediately transfer it to ice and continue incubation for 2 min. Take 150 μL of the transformed and ice-bathed bacterial suspension and evenly drop it onto the surface of a solid culture medium plate, spreading the suspension thoroughly using a sterile spreader. Finally, incubate the plate in a biosafety cabinet for approximately 10 min to allow the liquid to be absorbed, then invert it and incubate at 37°C for 16 h. After incubation, pick a single colony along with the pipette tip and place it in a culture tube containing liquid culture medium, incubating at 37°C for 8 h.

[0068] 5. Plasmid extraction and enzyme digestion Plasmid extraction and digestion were performed using a rapid plasmid miniprep kit (Tiangen) and a HindIII restriction endonuclease kit (NEW ENGLANDBiolabs). The cultured bacterial suspension was transferred fractionally to 2 mL centrifuge tubes and centrifuged at 12000 rpm for 1 min. After each centrifugation, the supernatant was aspirated as thoroughly as possible, and the bacterial pellet was collected. 150 μL of solution P1 (containing RNase and TIANRed) was added to the pellet, and the mixture was thoroughly resuspended by shaking. Then, 150 μL of solution P2 was added, and the mixture was gently inverted 8 times to fully lyse the cells. Next, 350 μL of solution P5 was added, and the mixture was immediately and rapidly inverted 15 times to mix. After a flocculent precipitate appeared, the mixture was centrifuged at 12000 rpm for 2 min. The supernatant was transferred to a new adsorption column (placed in a collection tube), centrifuged at 12000 rpm for 1 min, and then the waste liquid was discarded. Add 300 μL of PWT wash buffer containing anhydrous ethanol to the adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and centrifuge again for 1 min to remove residual wash buffer. Then place the adsorption column in a clean centrifuge tube, add 50 μL of elution buffer TB to the center of the adsorption membrane, centrifuge at 12000 rpm for 1 min, collect the plasmid DNA, and store at 4 °C for later use. Next, prepare a 50 μL restriction enzyme digestion system for the digestion reaction. After the reaction, take 1 μL of the digestion product, dilute it 1000 times with diluted TE buffer, and re-verify according to the digestion reaction system (Table 4) and digestion reaction procedure (Table 5). Label the digested products whose fragment size (size value) matches the expectation in the detection results, and store them at 4 °C for later use.

[0069] Table 4 Enzyme digestion reaction system Table 5 Enzyme digestion reaction procedure 6. Information on the 6 pairs (12 lines) of upstream and downstream primers for the 6 DNA template sequences is shown in Table 6.

[0070] Table 6. Upstream and downstream primer information 7. Multiplex amplification The six primer pairs were diluted to 10 μM using dilute TE solution (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0). The concentrations of each primer in the system were adjusted according to the different signal intensities detected by the genetic analyzer for different fluorescent markers, as shown in Table 7. Table 7. Primer system ratios for multiplex amplification Six pairs of artificially synthesized DNA templates were amplified in multiplexes, and the amplification system is shown in Table 8.

[0071] Table 8 Components of the multiplex amplification system The 2.5×PCR reaction mixture consisted of EzAmp Fast Taq E2 DNA polymerase (hot-start Taq enzyme, NuHigh Biotechnologies), 12 mM Tris-HCl buffer (Sigma-Aldrich), 50 mM KCl (Sigma-Aldrich), 2 mM MgCl2 (Invitrogen), 200 μM dNTP (Invitrogen), 800 μg / mL bovine serum albumin (BSA, Amresco), 0.08% IGEPAL CA-630 (Sigma-Aldrich), 0.2% Tween-20 (Sigma-Aldrich), and 3.5% glycerol (Sigma-Aldrich).

[0072] The PCR cycle parameters are shown in Table 9. During this process, the PCR cycle number was increased to 35 to consume as many primers as possible in the reaction system, so that the final detection results would be relatively consistent.

[0073] Table 9 PCR Cycling Parameters 8. Capillary electrophoresis detection The amplification products were subjected to spectral calibration tests on a capillary electrophoresis genetic analyzer. All capillaries were required to pass the spectral calibration test, with a Q value greater than or equal to 0.95 and a C value less than 15.

[0074] 9. Purification Add 5 μL (1% by volume) of proteinase K (20 mg / mL) to the amplification product, incubate at 37°C for 2 h, then add 50 μL of sodium acetate (3 M) and 1250 μL of anhydrous ethanol (refrigerated at 4°C), shake well, let stand for 2 min, and centrifuge at 3000 rpm for 10 min. Discard the supernatant, add 1250 μL of 75% ethanol solution, shake well, let stand for 2 min, and centrifuge at 3000 rpm for 10 min. Repeat this step twice. Aspirate as much ethanol solution as possible, air dry at room temperature, add 50 μL of dilute TE solution (10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0), and mix well. Perform spectral calibration again, ensuring all capillaries pass the calibration test with a Q value greater than or equal to 0.95 and a C value less than 15. Finally, store at 4°C.

[0075] 10. Evaluation of standard reagent values, homogeneity, and stability. (1) Constant value Sequencing primers (Table 10) were designed for each of the six DNA fragments to amplify the DNA templates. The six amplified products were then sent to five sequencing companies for sequencing. The sequence accuracy formula was: Sequence accuracy = Number of correct bases / Total number of bases.

[0076] Table 10 Sequencing Primer Information Sequencing results showed that the sequences and lengths of the six amplified products were consistent with the design scheme.

[0077] (2) Uniformity A. Uniformity within the unit One bottle of fluorescence permeation test standard reagent was randomly selected, and three subsamples were taken from each of the upper, middle, and lower layers, for a total of nine samples. Capillary electrophoresis was performed on a 3500-type genetic analyzer. Each sample was tested three times under the same electrophoresis conditions. The peak areas of the six fragments were recorded using one-way ANOVA (F-test). Table 11-17 shows the statistical results of intra-unit homogeneity.

[0078] Table 11. Peak area of ​​6-FAM labeled fragment for intra-unit homogeneity test Table 12. Peak area of ​​HEX-labeled fragments for intra-unit homogeneity test Table 13. Peak area of ​​NED-labeled fragments for intra-unit homogeneity test Table 14. Intra-unit homogeneity test: peak area of ​​NH618 labeled fragments Table 15. Intra-unit homogeneity test: peak area of ​​NH635 labeled fragments Table 16. Intra-unit homogeneity test: NH650 labeled fragment peak area Table 17 F-test for uniformity within cells Statistical analysis showed that there were no significant differences in peak area among the six segments in the uniformity test within the unit at different locations (upper, middle, and lower layers) of the bottle.

[0079] B. Inter-unit homogeneity Five bottles of fluorescence permeation test standard reagents were randomly selected and subjected to capillary electrophoresis on a 3500-type genetic analyzer. Each sample was tested three times under the same electrophoresis conditions, and the peak areas of the six fragments were recorded. The statistical method used was one-way ANOVA (F-test). Table 18-24 shows the statistical results of homogeneity within the unit.

[0080] Table 18. Peak area of ​​6-FAM labeled fragment for inter-unit homogeneity test Table 19. Inter-unit homogeneity test: peak area of ​​HEX-labeled fragments Table 20. Peak area of ​​NED-labeled fragments for inter-unit homogeneity testing Table 21. Inter-unit homogeneity test: peak area of ​​NH618 labeled fragments Table 22. Inter-unit homogeneity test: peak area of ​​NH635 labeled fragments Table 23. Inter-unit homogeneity test: peak area of ​​NH650 labeled fragments Table 24 F-test for inter-unit homogeneity Statistical analysis showed that there were no significant differences in peak area among the six segments in the inter-unit uniformity test across different sampling methods.

[0081] (3) Stability The fluorescence permeation assay standard reagent was placed at 4℃. Three 1 μL samples were taken at each time point (days 0, 3, 7, and 14) and capillary electrophoresis was performed on a 3500 genetic analyzer. The peak areas of the six fragments were recorded and the average value was calculated. A linear fitting method was used to test the significance of the slope. p >0.05). Stability results are shown in Table 25-31.

[0082] Table 25 Peak Area of ​​6-FAM Marked Fragments Table 26 Peak Area of ​​HEX Marked Fragments Table 27 Peak Area of ​​NED-Labeled Fragments Table 28 Peak Area of ​​NH618 Labeled Fragment Table 29 Peak Area of ​​NH635 Labeled Fragment Table 30 Peak Area of ​​NH650 Labeled Fragments Table 31 Stability test results The slopes of the peak areas of all six fragments were not significant when stored at 4°C for 14 days. p >0.05). The results show that the standard reagent can be stably stored at 4℃ for at least 14 days, which meets the requirements for routine transportation and short-term storage.

[0083] Test case Following the experimental steps described above, the prepared fluorescence permeation test standard reagent was tested on a 3130xL, 3500, GA118-24B genetic analyzer. The test results are shown below. Figure 1-3 .

[0084] Comparative Example 1 When testing on the GA118-24B genetic analyzer, if the primer restriction conditions are not met, i.e., the concentration of fluorescently labeled primers is too low (as shown in Table 32 below), the resulting reagents will affect the success rate of spectral calibration and will prevent the completion of subsequent fluorescence penetration tests. Figure 4 ).

[0085] Table 32 Unoptimized primer concentrations Comparative Example 2 When testing was performed on the GA118-24B genetic analyzer, if the concentrations of different fluorescently labeled primers were increased without primer restriction conditions (as shown in Table 33 below), the success rate of spectral calibration would be affected, resulting in an overall increase in peak height and poor balance. Figure 5 ).

[0086] Table 33 Unoptimized primer concentrations Comparative Example 3 The fluorescence permeation test standard reagents with different fluorescent labels were detected using a 3130xL genetic analyzer. The fluorescent labels were FAM, VIC, HEX, TAMRA, NH635, and NH650. In the peak diagram, the DNA fragment on the far right is fluorescently labeled with NH635. Excessively high peak values ​​can affect the accuracy of spectral calibration. Figure 6 ).

[0087] Comparative Example 4 The amplification cycle number was set to 27, with other conditions remaining unchanged, and tests were performed on a GA118-24B genetic analyzer. It was observed that, compared to the previous example, setting the amplification cycle number to 27 resulted in poor peak height uniformity, specifically manifested as lower signals in the orange and purple peaks. This was attributed to incomplete amplification due to the lower cycle number setting. Figure 7 ).

[0088] Those skilled in the art should understand that the above embodiments are merely for illustrative purposes and are not intended to limit the scope of this application. Those skilled in the art can make other changes or modifications based on the above disclosure, and these changes or modifications still fall within the scope of this application.

Claims

1. A method for preparing a standard reagent for fluorescence permeation testing, characterized in that, The method includes the steps of performing single-system synchronous amplification of a DNA template using primer combinations containing sequences such as SEQ ID No. 1-12 under primer restriction conditions and amplification endpoint control conditions, wherein the primer restriction conditions include controlling the final concentration of each primer pair in the reaction system to be less than 0.040 μM, and the amplification endpoint control conditions include controlling the number of PCR cycles in the synchronous amplification program to be greater than 30.

2. The method for preparing the fluorescence permeation test standard reagent according to claim 1, characterized in that, The primer sets include a first primer set to a sixth primer set. The first primer set includes primer pairs with sequences as shown in SEQ ID No. 1-2, the second primer set includes primer pairs with sequences as shown in SEQ ID No. 3-4, the third primer set includes primer pairs with sequences as shown in SEQ ID No. 5-6, the fourth primer set includes primer pairs with sequences as shown in SEQ ID No. 7-8, the fifth primer set includes primer pairs with sequences as shown in SEQ ID No. 9-10, and the sixth primer set includes primer pairs with sequences as shown in SEQ ID No. 11-12.

3. The method for preparing the fluorescence permeation test standard reagent according to claim 1, characterized in that, The primers contain a detectable group selected from 6-FAM, HEX, NED, NH618, NH635, or NH650.

4. The method for preparing the fluorescence permeation test standard reagent according to claim 2, characterized in that, The first primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 13; the second primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 14; the third primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 15; the fourth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 16; the fifth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No. 17; and the sixth primer set is used to amplify the DNA template with the sequence shown in SEQ ID No.

18.

5. The method for preparing the fluorescence permeation test standard reagent according to claim 1, characterized in that, The single system includes a PCR reaction mixture, primer combination, DNA template, and ddH2O; Preferably, the volume ratio of the primer combination to the DNA template is 1:(1-5).

6. The method for preparing the fluorescence permeation test standard reagent according to claim 1, characterized in that, The method includes: (1) DNA templates containing different primer binding sites were amplified using cloning primers, and the amplification products were purified by agarose electrophoresis and gel recovery. (2) The purified DNA was ligated and transformed using a cloning vector, and the DNA was then extracted and digested with enzymes to obtain the enzyme digestion product; (3) The product was simultaneously amplified in a single system using the primer combination under primer restriction conditions and amplification endpoint control conditions.

7. The method for preparing the fluorescence permeation test standard reagent according to claim 6, characterized in that, The synchronous amplification program in step (3) includes: pre-denaturation at 90-98℃ for 0.5-5 min; denaturation at 90-98℃ for 5-30 s, annealing at 45-65℃ for 1-5 min, extension at 65-75℃ for 10-60 s as one cycle, with a cycle number greater than 30; and final extension at 50-70℃ for 10-30 min.

8. A standard reagent for fluorescence permeation testing, characterized in that, It is obtained by the method described in any one of claims 1-7.

9. A kit for preparing standard reagents for fluorescence permeation testing, characterized in that, include: A primer combination containing sequences such as SEQ ID No. 1-12, wherein each primer pair in the primer combination is configured in the reaction system to a final concentration of less than 0.040 μM; DNA template with a sequence like SEQ ID No. 13-18; and Optional instruction manual, wherein the instruction manual includes instructions on the preparation steps of the standard reagent for fluorescence permeation testing.

10. The application of the fluorescence permeation test standard reagent according to claim 8 in the preparation of products for typing detection.

Images