Primer compositions, kits and methods for the identification of animal-derived ingredients in feed and food

Abstract

The application provides a primer composition, a kit and a method for identifying animal-derived components in feed and food. The application combines third-generation nanopore sequencing technology to realize rapid sequencing and distinguish species component information, and is suitable for rapid identification of animal species components in feed and food. By designing a 12S universal amplification primer sequence, the sample to be identified is subjected to PCR amplification; then, sequencing technology is used to quickly obtain the original sequencing data of the amplification product of the sample to be identified; high-quality sequences with a reserved length of 200-300 bp and a sequencing quality Q>9 in the original sequencing data are obtained; the obtained high-quality sequences are compared with a database, and the information of the classification result is counted, so that the animal-derived components contained in the sample to be identified can be accurately obtained, and high-throughput, rapid and accurate identification of animal-derived components in the sample can be realized.

Description

Technical Field

[0001] This invention relates to the field of molecular identification and sequencing technology, and in particular to a primer composition, kit, and method for identifying animal-derived components in feed and food. Background Technology

[0002] Animal-derived feed is the foundation of animal husbandry, and its species composition directly affects its nutritional value, safety, and cost. Accurately identifying the animal species composition in feed is crucial for ensuring feed quality, achieving precise nutrient delivery, tracing the source of contamination or adulteration (such as the illegal addition of cheap or harmful animal ingredients), and meeting regulatory requirements.

[0003] Currently, the identification of animal components in feed mainly relies on the following techniques: 1. Morphological identification: This method primarily relies on microscopic observation of animal cell morphology and tissue characteristics. However, for feed products that have undergone grinding or high-temperature processing, the animal tissue structure has been destroyed, and morphological characteristics have disappeared or become difficult to identify, leading to the failure of this method or extremely low accuracy. 2. Chemical marker detection: Such as near-infrared spectroscopy and chromatography. These methods indirectly reflect the chemical composition of the sample, but are easily affected by factors such as sample origin, processing technology, and storage conditions. They lack specificity and are difficult to accurately distinguish complex animal species, especially for the identification of unknown species. 3. DNA-based molecular identification techniques: These methods are based on the unique genetic information of a species, possessing high specificity and sensitivity, and represent the current direction of development.

[0004] DNA-based molecular identification techniques primarily utilize traditional PCR amplification combined with agarose gel electrophoresis. This method amplifies target DNA fragments using specific primers and then performs qualitative identification via electrophoresis. While relatively simple to operate, it suffers from extremely low resolution, unable to distinguish between mixed species samples, only confirming the presence of a specific species, and has limited sensitivity, making it prone to false negatives. More importantly, it cannot achieve simultaneous identification and quantitative analysis of multiple species components, limiting its value in complex feed matrix applications. In recent years, third-generation sequencing technologies, represented by nanopore technology, have made significant progress. Their unique single-molecule real-time sequencing principle can generate ultra-long reads and offers disruptive advantages such as portable equipment, real-time readings, and high sequencing speed. This provides the possibility for developing next-generation rapid on-site molecular detection technologies. Therefore, developing rapid and efficient sample pretreatment and data analysis methods compatible with nanopore sequencing platforms to truly leverage their "speed" and "on-site" advantages, and establishing dedicated bioinformatics analysis workflows and databases for complex animal components in feed, to achieve high-throughput, automated, and accurate species identification, has significant practical implications and broad application prospects. Summary of the Invention

[0005] This invention provides a primer composition, kit, and method for identifying animal-derived components in feed and food.

[0006] In a first aspect, the present invention provides a method for identifying animal-derived components in a sample, comprising: S1. Extract genomic DNA from the sample to be tested, and use the genomic DNA as a template to perform PCR amplification using the first primer and the second primer to obtain the amplification product; the first primer is a single-stranded DNA molecule with nucleotide sequence SEQ ID NO:1, and the second primer is a single-stranded DNA molecule with nucleotide sequence SEQ ID NO:2. S2. Construct a sequencing library based on the amplification product and perform nanopore sequencing. After obtaining at least 200Mb of data, stop sequencing and obtain the sequencing results of the sample to be tested. S3. Retain sequences with sequencing quality Q > 9 and sequence length of 200-300 bp from the sequencing results to obtain the sequence information of the sample to be tested; S4. Construct a local database, which includes the sequence information of the 12S gene of animal standards; S5. Compare the sequence information of the sample to be tested with the sequence information of the 12S gene of the animal standard to determine the types of animal-derived components in the sample to be tested.

[0007] As described above, this invention designs identifiable amplification fragments by performing global sequence alignment of the 12S region of mitochondria in various animals, and simultaneously designs corresponding forward amplification primers Animal-F (i.e., the first primer) and reverse amplification primers Animal-R (i.e., the second primer). SEQ ID NO:1 is specifically 5'-GTYGGTAAAYCTCGTGCCAGC-3'; SEQ ID NO:2 is specifically 5'-CATAGTGGRGTATCTAATCCCAG-3', ensuring that amplification products can be obtained for multiple animal species.

[0008] The method described above further includes: identifying animal components in two or more test samples; and in constructing a sequencing library from the amplified genomic DNA of each test sample, attaching sequencing barcode sequences to both ends of the amplified products to distinguish different test samples. The barcode sequences can be configured using conventional techniques in the art. In one specific embodiment, the barcode sequences are selected from at least one of the sequences shown in SEQ ID NO:14-22.

[0009] As described above, due to the possibility of sequences not being separated during nanopore sequencing, resulting in continuous perforation sequencing and multiple short sequences being sequenced into one long sequence, step 3 requires length filtering based on the size of the target band, i.e., selecting sequences with a length of 200-300 bp to obtain the sequence information of the sample to be tested.

[0010] The method described above can be used to construct a local database from the sequence information of the 12S gene of the animal standard, facilitating the comparison of the sequence of the sample to be tested with the local database. In one specific embodiment, the local database includes sequences with nucleotide sequences shown in SEQ ID NO:3-11.

[0011] As described above, when the sample to be tested includes two or more animal-derived components, the method further includes: determining or assisting in determining the proportion of the two or more animal-derived components in the sample to be tested based on the alignment results. Further, the total sequence BLAST results of the sample to be tested are statistically analyzed, and the content of each animal-derived component in the sample to be tested is inferred based on the relative abundance of a certain animal component's sequencing sequence in the total sequencing results.

[0012] In the method described above, in S5, when the sequence information of the sample to be tested is not less than 95% identical to the sequence information of the 12S gene of the animal standard, it is determined that the sample to be tested contains the animal-derived component corresponding to the standard.

[0013] In the method described above, the animal is selected from at least one of pig, cow, sheep, chicken, duck, sea bass, anchovy, mackerel, and sardine.

[0014] In the method described above, the sample to be tested is feed and / or food.

[0015] In a second aspect, the present invention provides a primer composition comprising a first primer and a second primer, wherein the first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1, and the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:2.

[0016] Thirdly, the present invention provides a kit comprising the above-described primer composition.

[0017] Fourthly, the present invention provides the application of the above-described primer composition or the above-described kit in identifying animal-derived components in samples.

[0018] Fifthly, the present invention provides a method for constructing an animal component identification database, comprising: S1. Extract genomic DNA from animal components, and use the genomic DNA as a template to perform PCR amplification using a first primer and a second primer to obtain an amplification product; the first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1, and the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:2. S2. Construct a sequencing library based on the amplification product and perform nanopore sequencing. After obtaining at least 200Mb of data, stop sequencing and obtain the sequencing results of the sample to be tested. S3. Sequences with sequencing quality Q > 9 and sequence length of 200-300 bp in the sequencing results are retained to construct an animal component identification database.

[0019] This invention provides a method for identifying animal components based on the 12S gene sequence. Combined with third-generation nanopore sequencing technology, it achieves rapid sequencing to distinguish species components, suitable for the rapid identification of animal species components in samples. By designing universal 12S amplification primer sequences, polymerase chain reaction (PCR) amplification is performed on the sample to be identified. Subsequently, sequencing technology is used to rapidly obtain the raw sequencing data of the amplified products of the sample to be identified. The raw sequencing data is preprocessed into a FastQ format file, retaining high-quality sequences with a length of 200-300 bp and sequencing Q > 9 that match the length of the amplified products. Based on an established sequence identification and alignment database, the obtained high-quality sequences are queried and classified. The information from the classification results is statistically analyzed, noise in the results is removed, and the query results of all sequences are merged. This allows for accurate identification of the component information of the feed animal sample, achieving high-throughput, rapid, and accurate identification of animal components in the sample. Attached Figure Description

[0020] Figure 1 The agarose gel electrophoresis results of the amplification products obtained by amplifying the genomic DNA of nine animals using the primer pairs provided in Example 1 are shown. M represents the marker, and lanes 1-9 are the amplicon products corresponding to pig, cow, sheep, chicken, duck, sea bass, anchovy, mackerel, and sardine, respectively. Figure 2 The agarose gel electrophoresis results of the amplification products obtained by amplifying the genomic DNA of nine animals using the primer pairs provided in Comparative Example 1 are shown. M represents the marker, and lanes 1-9 are the amplicon products corresponding to pig, sea bass, anchovy, mackerel, cattle, sheep, duck, chicken, and sardine, respectively. Figure 3 The results show the sequencing percentage of reads obtained by different identification methods in Example 4. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, embodiments of this invention, and should not be construed as limiting the invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention. In the description of this invention, it should be understood that the terminology used is for descriptive purposes only and should not be construed as indicating or implying relative importance.

[0022] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0023] Example 1: Construction of the 12S database of animal-derived feed and design and validation of universal amplification primers Based on the information in Table 1, the whole genome sequences of nine species were downloaded from the NCBI database. These nine species include pigs, cattle, sheep, chickens, ducks, sea bass, anchovies, mackerel, and sardines. 12S gene fragments from the whole genomes of these nine species were extracted and imported into MEGA11 software for sequence alignment using default parameters. After alignment, unaligned sequences at both ends were manually deleted. Universal primers were designed for the aligned differential regions, which must meet two requirements: 1. High conservation within species to prevent misidentification due to isolated mutations; 2. Sufficient sequence differences between species to distinguish all candidate species. Primer Premier 5 was used to predict primer information, retaining primer sequences that did not contain dimers or hairpin structures. Finally, we obtained the forward amplification primer Animal-F and the reverse amplification primer Animal-R. The forward amplification primer Animal-F is a single-stranded DNA molecule with the nucleotide sequence shown in SEQ ID NO:1, and the reverse amplification primer Animal-R is a single-stranded DNA molecule with the nucleotide sequence shown in SEQ ID NO:2. The degenerate bases Y represent C and T, and R represents A and G.

[0024] SEQ ID NO:1 is as follows: 5'-GTYGGTAAAYCTCGTGCCAGC-3'; SEQ ID NO:2 is as follows: 5'- CATAGTGGRGTATCTAATCCCAG -3'.

[0025] The reverse sequence introduces degenerate bases to reduce the bias of primer amplification, saves all downloaded reference sequences in the same FASTA file, and uses BLAST to build a local alignment database.

[0026] Table 1. Numbering of the complete genome sequences of 9 species

[0027] Genomic nucleic acid (gDNA) was extracted from the above 9 positive animal standards: Using BayBiopure Magnetic Bead DNA Extraction Kit for Deep-Processed Foods (FDDM-64), 50 mg of dried animal sample was placed in a 2 mL centrifuge tube, 700 μL of LCTAB lysis buffer and 10 μL of RNase A were added, and the mixture was thoroughly vortexed and mixed at 65°C for 30-60 minutes, vortexing several times during the process. After the solution cooled to room temperature, 550 μL of separation buffer (SF) was added, and the mixture was vortexed and centrifuged at 13000× for 5 minutes. Using a BayBiopure BBEX-32 fully automated nucleic acid extraction and purification instrument, the upper aqueous phase solution was added to column 1 / 7 of a deep-well plate, and the automated extraction program was run. After about 30 minutes, the extracted gDNA was in column 5 / 11. The obtained gDNA was transferred to a 1.5 mL centrifuge tube, 1 μL was taken to determine the concentration, and the remaining solution was stored at -20°C for later use.

[0028] Preparation of amplicon products by PCR reaction: Using the genomic nucleic acid gDNA extracted from the 9 positive animal standards as templates, polymerase chain reaction was carried out using forward amplification primer Animal-F and reverse amplification primer Animal-R. The reaction system and reaction procedure are shown in Table 2-3.

[0029] Table 2. Polymerase Chain Reaction (PCR) Reaction System

[0030] Table 3. Polymerase Chain Reaction (PCR) Reaction System

[0031] The BayBiopure DNA Purification and Recovery Kit was used. 50 μL of the PCR amplification product was used for DNA purification. The amplification product was added to the first column of a deep-well plate and then loaded onto an automated extractor. The purification was completed in 20 minutes. The purified amplicon product was stored at 4°C.

[0032] The concentration of the purified product was quantitatively determined using a Qubit HS dsDNA analyzer, and the quality of the purified product was determined using a NanoDrop micro-spectrophotometer. The concentration of the purified DNA ranged from 39.2 to 114.5 ng / μL, the A260 / A280 ratio ranged from 1.21 to 1.96, and the A260 / A230 ratio ranged from 1.61 to 2.23, as shown in Table 4.

[0033] Table 4. Detection results of amplification products of 9 positive animal standards

[0034] Mix 5 μL of amplification product with 6× DNA loading buffer (containing SDS) (purchased from Yisheng Biotechnology, catalog number 10212ES08), and verify the amplification results using 1× agarose gel electrophoresis. The verification results are as follows: Figure 1 As shown, lanes 1-9 are the amplification products corresponding to pigs, cattle, sheep, chickens, ducks, sea bass, anchovies, mackerel, and sardines, respectively. The results indicate that the designed amplification primers can amplify the identification fragments of the nine animals, and the band lengths are as expected. The amplicon sequences designed for the mitochondrial 12S reference genomes of the nine animals are shown in SEQ ID NO:2-11.

[0035] Pig (SEQ ID NO:3): 5'-GTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAATTAATAGATCCACGGCGTAAAGAGTGTTTAAGAAAAAAAAATCACAATAGAGTTAAATTATAACTAAGCTGTAAAAAGCCCTAGTTAAAATAAAATAACCCACGAAAGTGACTCTA6ATAATCCTGACACACGATAGCTAGGACCCAAACTGGGATTAGATACCCCACTATG-3'.

[0036] Cow (SEQ ID NO:4): 5'-GTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAGCTAACAGGAGTACGGCGTAAAACGTGTTAAAGCACCATACCAAATAGGGTTAAATTCTAACTAAGCTGTAAAAAGCCATGATTAAAATAAAAATAAATGACGAAAGTGACCCTACAATAGCCGACGCACTATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATG-3'.

[0037] Ovine (SEQ ID NO:5): 5'-GTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTGACCCAAGCTAACAGGAGTACGGCGTAAAGCGTGTTAAAGCATCATACTAAATAGAGTTAAATTTTAATTAAACTGTAAAAAGCCATAATTATAACAAAAATAAATGACGAAAGTAACCCTACAATAGCTGATACACCATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATG-3'.

[0038] Chicken (SEQ ID NO:6): 5'-GTTGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAAACCCAAATCAATAGCTACCCGGCGTAAAGAGTGGCCACATGTTATCTGCACCAGCTAAGATTAAAATGCAACCAAGCTGTCATAAGCCTAAGATCCACCTAAACCCAACCCAAATCCATCTTAGCCTCAACGATTAATTTTAACCCACGAAAGCTAGGACCCAAACTGGGATTAGATACCCCACTATG-3'.

[0039] Duck (SEQ ID NO:7): 5'-GTCGGTAAATCTTGTGCCAGCCACCGCGGTCATACAAGAGACCCAAATCAACTGTCCTACAAGCGGCGTAAAGAGTGGTAAGATGCCTATCCTACCTAACTAAGATCAAAATGCAACTAAGCTGTCGCAAGCACAAGATGCACCTAAACACACCATCAAGATGATCTTAGAAACTAGCGATTAATTTGAACCCACGAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATG-3'.

[0040] Japanese seabass (SEQ ID NO:8): 5'-GCCGGTAAAACTCGTGCCAGCCACCGCGGTTATACGAGAGGCCCAAGTTGATAGTCACCGGCGTAAAGGGTGGTTAGGATAAAATTAAAGACTAAAGCCGAACACCTTCAAGGCTGTTATACGCACCCGAAAGTAAGAAGCTCAATCACGAAAGTGGCTTTACTCCTTCCGAATCCACGAAAACTAGGACACAAACTGGGATTAGATACCCCACTATG-3'.

[0041] Anchovy (SEQ ID NO: 9): 5'-GCCGGTAAAACTCGTGCCAGCCACCGCGGTTATACGAGAGACCCTAGTTGATTGAAGCGGCGTAAAGAGTGGTTATGGAATTTTCTACCCTAAAGCAGAAAACCTCTCAAACTGTTATACGCACCCAGAGGTTGAAACCCCTTACACGAAAGTGACTTTATTTTCGCCTACCAGAAGCCACGAAAGCTGGGACACAAACTGGGATTAGATACCCCACTATG-3'.

[0042] Mackerel (SEQ ID NO: 10): 5'-GCCGGTAAAACTCGTGCCAGCCACCGCGGTTATACGATAGGCCCAAGTTGACAGAACCCGGCGTAAAGCGTGGTTAGGGAAAACTCAAAACTAAAGCCGAATATCTTCAGGGCAGTTATACGCTTCCGAAGACACGAAGCCCTTCCACGAAAGTGACTTTATTACCCCCGACCCCACGAAAGCTAGGACACAAACTGGGATTAGATACCCCACTATG-3'.

[0043] Sardine (SEQ ID NO: 11): 5'-GCCGGTAAAACTCGTGCCAGCCACCGCGGTTATACGAGGGACCCTAGTTGATTTAATCGGCGTAAAGAGTGGTTATGGAGAATAAGAAACTAAAGCCGAAGACCTCTTAGGCCGTCATACGTACCTAGAGGCTCGAATAACAAACACGAAAGTAGCTTTACCCCTTCCTGCCAGAACCCACGAGAGCTGGGATACAAACTGGGATTAGATACCCCACTATG-3'.

[0044] Comparative Example 1: Selection of Optimal Amplification Primer Pairs A comparison of the amplification results of the universal primer pair LCO1490-HCO2198 for animal-derived components. Forward primer (SEQ ID NO:12): 5'-GGTCAACAAATCATAAAGATATTGG-3' Reverse primer (SEQ ID NO:13): 5'-TAAACTTCAGGGTGACCAAAAAATCA-3'.

[0045] Using the genomic DNA extracted in Example 1 as a template, PCR amplification was performed using the primer pairs described above. Information on various components is the same as in Table 2, and amplification conditions are shown in Table 3.

[0046] Mix 5 μL of amplification product with 6× DNA loading buffer (containing SDS) (purchased from Yisheng Biotechnology, catalog number 10212ES08), and verify the amplification results using 1× agarose gel electrophoresis. The verification results are as follows: Figure 2 As shown, lanes 1-9 are the amplification products corresponding to NC (negative control), pig, sea bass, anchovy, mackerel, cow, sheep, duck, chicken, and sardine, respectively. The results show that the COI LCO1490-HCO2198 primers could not completely amplify the identification fragments of the nine animals, and the amplification effect in fish was poor, which was not as good as the primers provided in Example 1.

[0047] Example 2: Third-generation nanopore amplicon sequencing and single-species identification analysis A third-generation nanopore amplicon sequencing library was constructed using the ligation method according to the instructions for the sequencing library preparation reagent (BGI Genomics, H940-000081): 1. End-of-pipe repair Take an appropriate amount of the amplification products of the 10 positive animal standards purified in Example 1, and make up the volume to 12.5 μL with enzyme-free water. Then add 1.75 μL of DNA final repair buffer and 0.75 μL of DNA final repair enzyme to each sample, mix thoroughly, centrifuge, and place on a PCR instrument. The program is shown in Table 5. Heat cover at 75°C.

[0048] Table 5. End-of-phase repair response procedure

[0049] After the program finishes running, add 15 μL of purified magnetic beads to the system, recover and purify the end repair product, and take 1 μL for Qubit HS dsDNA quantification.

[0050] 2. Sequencing barcode link According to the reaction system shown in Table 6-7, the volume of the end-repair products of the nine positive animal standards was brought up to 11.5 μL using enzyme-free water. A barcode sequence and barcode ligase mixture were added to each sample to ligate barcodes to both ends of the end-repair products from different species, facilitating species differentiation. After thorough mixing and centrifugation, the mixture was incubated at 20°C for 20 minutes on a PCR instrument and stored at 4°C (with the heat cap closed). After the reaction, 1 μL of stop buffer was added to each solution, and the mixture was incubated at 75°C for 10 minutes on a PCR instrument and stored at 4°C (with the heat cap closed at 90°C).

[0051] Table 6. Barcode Linked Reaction System

[0052] Table 7. Nucleotide sequence of barcode X

[0053] The barcode ligation products of nine positive animal standards were combined into a 1.5 μL centrifuge tube. 0.8X magnetic beads were added according to the total volume. The barcode ligation products were recovered, and 1 μL was taken for Qubit HS dsDNA quantification.

[0054] 3. Sequencing adapter ligation The barcode ligation products after mixing were prepared according to the reaction system described in Table 8. After thorough mixing and centrifugation, the mixture was reacted at 20°C for 15 minutes on a PCR instrument and stored at 4°C (with the heat cap closed). 40 μL of magnetic beads were added to the reaction solution for recovery and purification. Finally, the library was obtained and 1 μL was used for Qubit HS dsDNA quantification.

[0055] Table 8. Sequencing adapter ligation reaction system

[0056] Take 200ng of library, load the amplicon library according to the microarray sequencing guide and start sequencing. Set the corresponding experimental parameters and stop sequencing after ensuring that at least 200Mb of data is obtained for each sample. Use seqkit (Version: 2.10.0) to check the size and length of the FASTQ data after sequencing. Only keep the sequences with sequencing quality Q>9 and sequence length of 200-300bp.

[0057] The local alignment database constructed in Example 1 was selected. The sequences retained after sequencing were identified locally using BLAST. The species affiliation of each retained sequence was statistically analyzed. The identification results of all sequences corresponding to each sample were statistically analyzed, and false positives caused by sequencing errors were excluded. A proportion greater than 95% was sufficient to confirm the corresponding species. The results are shown in Table 9, which demonstrates that the method provided by this invention has high accuracy.

[0058] Table 9. Comparison of Sequencing Reserved Sequences and the Local Database of Example 1

[0059] Example 3: Sequencing analysis of simulated sample PCR product mixing ratio To further verify the ability of this invention to distinguish adulterated mixed samples, whole-genome gDNA of positive animal standards was extracted and corresponding amplicon products were prepared according to the method in Example 1. The concentration of the purified product was quantitatively detected using Qubit HS dsDNA. Several positive samples were randomly selected and mixed according to the species types and proportions shown in Table 10, based on a total amount of 150 ng, to simulate three different mixed samples.

[0060] Table 10. Percentage of Simulated Mixed Samples

[0061] Following the same sequencing library construction method as in Example 3, sequencing libraries were constructed with three different proportions of mixed samples. Each mixed sample was prepared in duplicate, and different barcodes were linked to the different proportions of the mixed samples and the replicates of each sample for differentiation. 200 ng of the library was used for sequencing, and sequencing was stopped after 4 hours to ensure that each barcode yielded at least 200 Mb of data (FastQ format). The size and length of the FastQ data were checked using seqkit (Version: 2.10.0), and only sequences with a sequencing quality Q > 9 and a sequence length of 200-300 were retained.

[0062] The local BLAST database constructed in Example 1 was selected, and the preserved sequences were identified using local BLAST. The species affiliation of each preserved sequence was determined, and the identification results of all sequences corresponding to each sample were statistically analyzed. The results are shown in Table 11.

[0063] Table 11. Identification results of samples with different mixing ratios

[0064] The results show that for multi-component mixed samples, this method can identify components as low as 10% in the mixed sample and can reflect the mixing ratio information of the original sample to a certain extent.

[0065] Example 4: Sequencing analysis of mixed proportions of genomic products from simulated samples In practical applications, the mixing of multiple species components is a direct mixing of the raw materials themselves. To test the possible multi-component mixing situations that may be encountered in practice, the positive standard genomic gDNA was mixed according to the proportions shown in Table 12, and the total mass of gDNA was 150 ng.

[0066] Table 12. Mixing ratio of genomic gDNA for positive samples

[0067] The mixed genomic gDNA was used as a PCR amplification template. Amplification products were prepared according to the PCR procedure in Example 1. The amplification products were purified and recovered using an automated instrument. 1 μL of the resulting solution was used for quantification of the purified product concentration using Qubit HS dsDNA. Following the method in Example 3, libraries were constructed for all amplicon samples, with two replicates for each mixed sample. 200 ng of the library was used for sequencing. The sequencing data were processed according to the method in Example 3, and component information was statistically identified. The compiled results are shown in Table 13.

[0068] Table 13. Identification results of each group of mixed samples

[0069] This invention designs universal PCR amplification primer pairs targeting the 12S region of animal-derived feed components, enabling the simultaneous amplification of identification regions for multiple components and distinguishing various animal-derived feed ingredients. Verification through examples shows that it can distinguish at least nine common feed ingredients from pigs, cattle, sheep, chickens, ducks, sea bass, anchovies, mackerel, and sardines. Addressing the low accuracy and sequential read issues of third-generation sequencing, this invention proposes sequencing quality and length filtering schemes for the sequencing data after sequencing to obtain high-quality data for subsequent analysis.

[0070] Example 5: Comparison of the accuracy of different bioinformatics analysis methods for identifying components in mixed feed To verify the accuracy of the method proposed in this invention in the identification of complex components in feed, this embodiment compares it with the mainstream K-mer-based classification algorithm (Kraken2) and its abundance estimation correction algorithm (Bracken) in the current metagenomics field.

[0071] Method A (the method of this invention): Construct a local 12S gene database containing the target crop and its common closely related species. Use the BLASTn program to align sequencing reads to the local database, setting the parameters as follows: Identity ≥ 95%, Coverage ≥ 90%. Count the number of reads aligned to each species and calculate the relative abundance.

[0072] Method B (Comparison with Method 1 - Kraken2): The standard Kraken2 workflow was used, with the Standard Animal Database containing animal genomes selected as the database. Default parameter settings (k=35) were used, and species classification was performed directly on the Reads.

[0073] Method C (Comparison with Method 2 - Bracken): Based on the Kraken2 analysis results, the abundance was re-estimated and corrected using the Bracken (Bayesian Reestimation of Abundance) algorithm, and the read length parameter was set to the actual average read length of sequencing.

[0074] The relative abundance of species obtained by the three methods was compared with the actual read sequencing percentage, and the results are shown in Table 14. Figure 3 As shown: Table 14. Read sequencing percentage obtained by the three methods

[0075] Compared to commonly used metagenomic analysis software, the "specific primers + local BLAST library construction" strategy described in this invention can effectively overcome the high error rate interference of third-generation sequencing, significantly reduce read waste, and more accurately restore the true species composition ratio in mixed feed samples, demonstrating significant technical advantages.

[0076] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for identifying animal-derived components in a sample, characterized in that, include: S1. Extract genomic DNA from the sample to be tested, and use the genomic DNA as a template to perform PCR amplification using the first primer and the second primer to obtain the amplification product; The first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1, and the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:2; S2. Construct a sequencing library based on the amplification product and perform nanopore sequencing. After obtaining at least 200Mb of data, stop sequencing and obtain the sequencing results of the sample to be tested. S3. Retain sequences with sequencing quality Q > 9 and sequence length of 200-300 bp from the sequencing results to obtain the sequence information of the sample to be tested; S4. Construct a local database, which includes the sequence information of the 12S gene of animal standard samples; S5. Compare the sequence information of the sample to be tested with the sequence information of the 12S gene of the animal standard to determine the types of animal-derived components in the sample to be tested.

2. The method according to claim 1, characterized in that, The method further includes: identifying animal-derived components in two or more test samples; and in constructing a sequencing library from the amplified genomic DNA of each test sample, ligating sequencing barcode sequences to both ends of the amplified product to distinguish different test samples.

3. The method according to claim 1, characterized in that, When the sample to be tested includes two or more animal-derived components, the method further includes: determining or assisting in determining the proportion of the two or more animal-derived components in the sample to be tested based on the comparison results.

4. The method according to claim 1, characterized in that, In S5, if the sequence information of the sample to be tested is at least 95% identical to the sequence information of the 12S gene of the animal standard, then the sample to be tested is determined to contain the animal-derived component corresponding to the standard.

5. The method according to claim 1, characterized in that, The animal is selected from at least one of the following: pig, cow, sheep, chicken, duck, sea bass, anchovy, mackerel, and sardine.

6. The method according to claim 1, characterized in that, The samples to be tested are feed and / or food.

7. A primer composition, characterized in that, It includes a first primer and a second primer, wherein the first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1, and the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:

2.

8. A reagent kit, characterized in that, Includes the primer composition of claim 7.

9. The use of the primer composition of claim 7 or the kit of claim 8 in the identification of animal-derived components in a sample.

10. A method for constructing an animal component identification database, characterized in that, include: S1. Extract genomic DNA from animal components, and use the genomic DNA as a template to perform PCR amplification using a first primer and a second primer to obtain an amplification product; the first primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:1, and the second primer is a single-stranded DNA molecule with the nucleotide sequence SEQ ID NO:

2. S2. Construct a sequencing library based on the amplification product and perform nanopore sequencing. After obtaining at least 200Mb of data, stop sequencing and obtain the sequencing results of the sample to be tested. S3. Sequences with sequencing quality Q > 9 and sequence length of 200-300 bp in the sequencing results are retained to construct an animal component identification database.

Images