Primer composition for detecting gene site mutation of drug for neurodegenerative disease, kit and application

Abstract

The application provides a primer composition for detecting gene site mutations of drugs for treating neurodegenerative diseases, a kit and application. The primer composition comprises primers with nucleotide sequences shown in SEQ ID NO. 1-32, which correspond to 10 genes of DRD3, SLC22A1, DRD2, COMT, HLA-A, CHAT, ANKK1, AGTR1, ADRB2 and CYP2D6, and a total of 16 mutation sites are designed; single-tube multiplex PCR amplification can be performed, and specific and efficient detection of any site mutation result can be realized at one time, thereby providing accurate guidance for clinical drug type selection suggestion, dose selection suggestion, efficacy prediction or toxicity risk assessment and the like.

Description

Technical Field

[0001] This invention relates to the field of gene locus mutation detection kit technology, specifically to primer compositions, kits, and applications for detecting gene locus mutations in drugs for neurodegenerative diseases. Background Technology

[0002] Neurodegenerative diseases are a group of chronic illnesses characterized by the gradual loss of neurons and their slow decline in function, commonly seen in the elderly. Currently, there are no effective cures for these diseases; treatment primarily relies on medication to control symptoms and slow disease progression. Common neurodegenerative diseases include Alzheimer's disease and Parkinson's disease, which typically require long-term medication.

[0003] Pharmacogenomics (PGx) refers to the study of individual differences in the body's response to drugs (toxicity and efficacy) caused by genetic variations. Changes in the genetic variations and expression levels of genes involved in drug metabolism, transport, and target action affect drug concentration and sensitivity in the body, thus causing individual differences in drug efficacy. The core goal of pharmacogenomics is to guide medication based on individual genetic information, achieving precision medicine with personalized medicine tailored to each individual. Clinical applications of pharmacogenomics aim to solve the problems of "ineffective medication" or "adverse reactions" in traditional drug use, providing a basis for personalized medication through gene testing. For patients with neurodegenerative diseases, the detection of individual gene differences is mainly applied in the following directions: (1) guiding drug selection and dosage adjustment; (2) predicting and avoiding serious adverse reactions; (3) assessing drug efficacy and the risk of drug failure.

[0004] Currently, pharmacogenomics detection technologies mainly include qPCR, Sanger sequencing, and nucleic acid mass spectrometry, each with its own advantages and disadvantages.

[0005] 1. qPCR (qPCR)

[0006] qPCR is one of the most mature and widely used technologies in clinical applications. Its advantages are mainly reflected in the following aspects: (1) mature technology, simple operation, and relatively low requirements for laboratory hardware; (2) low cost and standardized process; (3) applicable to clinical point-of-care testing scenarios. In addition, qPCR also has obvious limitations, mainly that it can only detect one site at a time. If it is designed to detect multiple targets at the same time, there is a potential risk of mutual interference between primers. Furthermore, it cannot detect unknown variants and can only detect a few preset sites.

[0007] 2. Sanger sequencing

[0008] As a representative of first-generation sequencing technology, Sanger sequencing has long been the "gold standard" for detecting gene polymorphisms, but it is mainly used for confirmatory testing of a small number of samples and a small number of loci. Sanger sequencing results are highly accurate and can detect unknown variations outside of known loci of target genes, but like qPCR, it also has corresponding limitations. Sanger sequencing can only detect 1-2 loci at a time, and its cost is relatively high, making it unsuitable for large-scale application.

[0009] 3. Nucleic acid mass spectrometry

[0010] Nucleic acid mass spectrometry achieves genotyping by directly detecting the molecular weight of nucleic acids. It boasts high sensitivity, specificity, and accuracy, and can analyze multiple sites in a single test. However, the investment in mass spectrometry equipment is high, limiting its large-scale application, and its accuracy in detecting gene structural variations (gene fragment insertions, deletions, rearrangements, etc.) is severely insufficient.

[0011] Currently, common neurodegenerative diseases such as Alzheimer's disease and Parkinson's syndrome are treated with drugs such as donepezil, rivastigmine, galantamine, memantine, levodopa, pramipexole, and ropinirole. Most of these drugs have a basis in pharmacogenomics research. If a single test could identify the gene loci related to any common neurodegenerative disease drug and efficiently confirm genetic variations, recommendations for drug selection, dosage selection, efficacy prediction, and toxicity risk assessment could be obtained, enabling patients to choose more effective and safer treatment options. Summary of the Invention

[0012] This invention proposes a primer composition and kit for detecting gene locus mutations in drugs for neurodegenerative diseases, which can meet the needs of detecting any common clinical neurodegenerative disease drug-related gene loci in a single test and efficiently confirm genetic variations.

[0013] The technical solution of this invention is implemented as follows: A first aspect of the present invention is to provide a primer composition comprising primers with nucleotide sequences as shown in SEQ ID NO. 1-32, wherein the primers correspond to the genes and sites to be detected as follows:

[0014] A second aspect of the present invention is to propose the application of the primer composition described above in the preparation of gene site mutation detection products for drugs used in neurodegenerative diseases.

[0015] Furthermore, the products include reagents, kits, chips, or instrument platforms.

[0016] A third aspect of the present invention is to provide a gene site mutation detection kit for drugs used in neurodegenerative diseases, comprising the primer composition described in the first aspect.

[0017] Furthermore, the test kit also includes at least one of the following: nucleic acid extraction reagent, multiplex PCR amplification reagent, adapter primers, and library construction reagent.

[0018] Preferably, the adapter primer consists of a universal sequence complementary sequence, an index sequence of 6-10 bases, and a sequencing adapter sequence.

[0019] Preferably, the multiplex PCR amplification reagent includes 5×Multi-PCR Mix and Multi-PCR Enzyme Mix; and / or, the library amplification reagent includes HiFi Amplification Mix.

[0020] Furthermore, in the kit, the concentration of any of the primers is 0.1-0.5 μM.

[0021] A fourth aspect of the present invention is to provide an application of the detection kit described in the third aspect, the application comprising at least one of the following: a) Develop gene site mutation detection products for drugs used in neurodegenerative diseases; b) Develop risk assessment products for medications used in neurodegenerative diseases; c) Develop efficacy evaluation products for drugs used to treat neurodegenerative diseases.

[0022] A fifth aspect of the present invention is to provide a method for detecting gene site mutations in drugs for neurodegenerative diseases, for non-diagnostic purposes, comprising the following steps: S1. Extract DNA from the sample; S2. Using DNA as a template, perform PCR amplification and purification using the aforementioned primer combination; S3. Using the purified product as a template, a sequencing library is obtained by amplification using library amplification reagents and adapter sequences; S4. Sequencing of the sequencing library and analysis of the mutation detection results.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: The primer composition provided by this invention is designed for 16 mutation sites in 10 genes, including DRD3, SLC22A1, DRD2, COMT, HLA-A, CHAT, ANKK1, AGTR1, ADRB2, and CYP2D6. Through single-tube multiplex PCR amplification, it can achieve specific and efficient detection of mutation results at any site in a single operation, providing accurate guidance for clinical drug selection, dosage selection, efficacy prediction, or toxicity risk assessment.

[0024] The detection method described in this invention, through multiplex PCR amplification, library amplification and preparation, and sequencing, can detect multiple mutation sites simultaneously. The entire process can be completed within 12 hours, resulting in more accurate site results and mutation frequency analysis. Furthermore, only 0.5M reads are needed per sample to meet the analysis requirements. Taking a commonly used domestic sequencing chip with a throughput of 100M as an example, a single chip can detect up to 200 samples, significantly reducing the cost per site per sample compared to other methodologies. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a schematic diagram of the multiplex PCR sequencing technology process described in Embodiment 1 of the present invention. Detailed Implementation

[0027] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0028] This invention provides a primer composition designed for 16 mutation sites in 10 neurodegenerative disease drug-related genes, including DRD3, SLC22A1, DRD2, COMT, HLA-A, CHAT, ANKK1, AGTR1, ADRB2, and CYP2D6, specifically comprising the nucleotide sequences shown in SEQ ID NO. 1-32. The corresponding sites and genotypes for the primers are shown in Table 1.

[0029] Table 1:

[0030] The primers shown in SEQ ID NO.1-32 above match the target sequences on the individual genome that cover the mutation sites to be detected based on the principle of complementary base pairing. Genomic regions that cannot be matched or have a low matching rate cannot be amplified. It has been verified that single-tube amplification can specifically detect the genotypes of each mutation site and will not cause non-specific amplification.

[0031] The drugs associated with the mutation sites of the above genotypes and their usage instructions are shown in Table 2.

[0032] Table 2:

[0033] In this invention, single-tube multiplex PCR amplification using the above primer composition enables the specific and efficient detection of mutations at any of the 16 mutation sites in 10 neurodegenerative disease drug-related genes in a single operation, providing accurate guidance for clinical drug selection recommendations, dosage selection recommendations, efficacy prediction, or toxicity risk assessment.

[0034] This invention also proposes a kit for detecting pharmacogenomic site mutations based on multiplex PCR sequencing technology, which includes primer compositions with nucleotide sequences as shown in SEQ ID NO.1-32, as well as nucleic acid extraction reagents, multiplex PCR amplification reagents, adapter primers, library construction reagents, etc.

[0035] Specifically, the primer composition contains any sequence length of 40-47 bp, with the upstream 21 bp of the forward and reverse primers being the adapter ligation sequence for the amplification primer system to match the library construction, and the remainder being the target sequence that accurately matches the mutation site to be detected.

[0036] In a preferred embodiment, the primer compositions shown in SEQ ID NO.1-32 are mixed at a final concentration of 0.1-0.5 μM per primer at a ratio of 1:1 after synthesis, which is called a multiprimer mix.

[0037] In a preferred embodiment, the adapter primer consists of a universal sequence complementary sequence, a 6-10 base index sequence, and a sequencing adapter sequence. Combinations containing unique index sequences can be used to distinguish different sample data generated from the same sequencing batch.

[0038] In a preferred embodiment, the multiplex PCR amplification reagent includes 5×Multi-PCR Mix and Multi-PCREnzyme Mix; the library amplification reagent includes HiFi Amplification Mix.

[0039] In this invention, after multiplex PCR amplification using the above detection kit, a sequencing library is prepared by ligating the sequence with adapters. The library can then be sequenced and analyzed using a common next-generation sequencing platform to obtain the gene site mutation detection results.

[0040] It is understandable that, in addition to gene site mutation detection, the sequencing analysis results above, combined with the genotype mutation sites associated with drugs and medication instructions shown in Table 2, can be used to provide recommendations on drug selection, dosage selection, medication risk assessment, medication efficacy assessment, or to prepare related products for neurodegenerative diseases.

[0041] To make the technical problems solved by the present invention, the technical solutions and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments.

[0042] Unless otherwise specified, the molecular biology experimental methods described in the following examples were performed according to the specific methods listed in *Molecular Cloning: A Laboratory Manual* (4th Edition) (J. Sambrook & MR. Green, 2017), or according to the kit and product instructions. Other experimental methods, unless otherwise specified, were conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples were standard laboratory equipment; the experimental materials used in the following examples, unless otherwise specified, were purchased from a regular biochemical reagent store.

[0043] Example 1

[0044] 1. Design of primers for detecting gene locus mutations in drugs for neurodegenerative diseases

[0045] The primer sets described in this invention are used for multiplex PCR amplification primers to detect mutations at 16 sites in 10 genes, including DRD3, SLC22A1, DRD2, COMT, HLA-A, CHAT, ANKK1, AGTR1, ADRB2, and CYP2D6, as well as library amplification primers for library construction, as detailed below: Multiplex PCR amplification primers: SEQ ID NO.1~SEQ ID NO.32; Library construction primers: SEQ ID NO.33~SEQ ID NO.34; For multiplex PCR amplification, primers were designed using Primer3 software, centered around the target mutation site, to generate as many available primers as possible for each target region. The designed primers were filtered based on factors such as primer amplification specificity, whether the primers contained simple repetitive sequences, and the presence of high-frequency SNP sites (defined as sites with a smaller allele frequency of 0.5% or higher in dbSNPs). The remaining candidate primers were combined according to the principle of minimizing primer interactions, specifically minimizing the 3' end complementarity and overall primer complementarity, ensuring that the number of complementary bases at the 3' end between primers does not exceed 10, and that the overall complementarity between primers does not exceed 75%. A self-developed evaluation system combined with the Dicy and MFEprimer workflows was used to screen for the optimal primer combinations.

[0046] Specifically, the correspondence between multiplex PCR amplification primers and genes / sites is shown in Table 3.

[0047] Table 3:

[0048] After constructing adapter ligation sequences (AGACGTGTGCTCTTCCGATCT or TACACGACGCTCTTCCGATCT) for amplification primers by adding matching libraries, the sequences shown in Table 4 were obtained.

[0049] Table 4:

[0050] The adapter ligation sequence is the sequence used to construct the amplification primer system by matching the library. The primer sequence obtained by ligating the adapter ligation sequence with the amplification primer for the target site is the multiplex PCR amplification primer. Preferably, after the multiplex PCR amplification primers are synthesized, they are mixed at a final concentration of 0.2 uM per primer at a 1:1 ratio to form the multiprimer mix.

[0051] Library construction primers and library amplification primer sequences are as follows: SEQ ID NO.33: 5'-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTC[AGACGTGTGCTCTTCCGATCT]-3'; SEQ ID NO.34: 5'-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCC[TACACGACGCTCTTCCGATCT] -3'.

[0052] In this sequence, the 21bp sequence marked with "[ ]" is the upstream sequence matching the multiplex PCR amplification product, and NNNNNNNN in the sequence is the sequencing tag, i.e., the index sequence. The index sequence is different in different samples. Adding a combination containing a unique index sequence can be used to distinguish different sample data generated from the same batch of sequencing. Using the primer combination described in this invention, a sequencing library containing the target site can be obtained by performing multiplex PCR amplification followed by a single amplification step.

[0053] 2. Gene locus mutation detection kit for drugs used in neurodegenerative diseases

[0054] A drug gene site mutation detection kit was prepared using the above probe combination. The kit also includes oral swab nucleic acid extraction reagent, multiplex PCR amplification reagent, and library construction reagent.

[0055] 3. Methods for detecting gene locus mutations in drugs for neurodegenerative diseases

[0056] like Figure 1 As shown, the method for detecting gene site mutations in drugs for neurodegenerative diseases includes the following steps: 1) Total DNA was obtained from the sample after nucleic acid extraction; 2) Using the DNA obtained in step 1) as a template, prepare the amplification reaction system using the multiplex PCR amplification reagents shown in Table 4 and complete the amplification to obtain the target sequence amplification product containing the mutation site to be detected. Add chean buffer to the amplification product, incubate, and then purify with magnetic beads to remove residual primers and other impurities; 3) Using the purified amplification product obtained in step 2) as a template, further amplification was performed using library amplification reagents and library construction primers shown in SEQ ID NO. 33-34. The product was purified by magnetic beads to obtain a library that can be used for sequencing. 4) The library was sequenced using sequencing platforms such as Fastaseq 300, Salus Pro, and Illumina NextSeq. Preferably, the sequencing cycle number was 75 cycles. Bioinformatics analysis was then performed to obtain the gene site mutation results for the neurodegenerative disease drugs described in this invention.

[0057] Example 2: Detection of gene locus mutations in oral swab samples for drugs used in neurodegenerative diseases

[0058] Three oral swab samples were collected and labeled C1, C2, and C3, and tested using the methods described in Example 1. The specific implementation steps are as follows: 1. Oral swab samples were extracted using the magnetic bead method. Total DNA was obtained by lysis with lysis buffer and purification steps. After extraction and purification, 50 μL of Nuclease-Free Water was used for elution.

[0059] 2. Multiplex PCR amplification

[0060] Prepare the following reaction system in a sterile PCR tube, vortex to mix, and then place the sample tube in the PCR instrument.

[0061] The reaction procedure is as follows (the PCR instrument's heating cap is set to 105℃):

[0062] After amplification, 50 μL of chean buffer was added to the amplification product, and the mixture was incubated at room temperature for 5 min before magnetic bead purification to remove residual primers and other impurities. The purified product was then eluted with 25 μL of nuclease-free water.

[0063] 3. Library Construction

[0064] Using the amplification product from the previous step as a template, prepare the following reaction system in a sterile PCR tube, vortex to mix, and then place the sample tube in the PCR instrument.

[0065] In this example, the SEQ ID NO.33 and SEQ ID NO.34 sequencing tags (i.e., index sequences) are different in different samples. The index sequences corresponding to C1, C2, and C3 in this example are as follows: C1: TAACCTGC / AGTGGTAG; C2: TGTCACCT / ATCCACCT; C3: ACCAACGT / GAGACTAG; The reaction procedure is as follows (the PCR instrument's heating cap is set to 105℃):

[0066] After amplification, magnetic beads were used for purification to remove residual primers and other impurities. The purified product was then eluted with 25 μL of nuclease-free water.

[0067] 4. Sequencing and Analysis

[0068] After library quality control, sequencing was performed using Fastaseq 300 with 75 sequencing cycles. Bioinformatics analysis yielded the mutation results for the corresponding gene loci in samples C1, C2, and C3. The primer combinations, kits, and methods described in this invention are completely consistent with the current gold standard, Sanger sequencing results.

[0069] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer composition, characterized in that, Primers, including those with nucleotide sequences as shown in SEQ ID NO. 1-32, are used to detect the genes and sites shown below: 。 2. The use of the primer composition of claim 1 in the preparation of gene site mutation detection products for drugs used in neurodegenerative diseases.

3. The application as described in claim 2, characterized in that, The products include reagents, reagent kits, chips, or instrument platforms.

4. A gene site mutation detection kit for drugs used in neurodegenerative diseases, characterized in that, Includes the primer composition of claim 1.

5. The detection kit as described in claim 4, characterized in that, It also includes at least one of the following: nucleic acid extraction reagents, multiplex PCR amplification reagents, adapter primers, and library construction reagents.

6. The detection kit as described in claim 5, characterized in that, The adapter primer consists of a universal sequence complementary sequence, a 6-10 base index sequence, and a sequencing adapter sequence.

7. The detection kit as described in claim 5, characterized in that, The multiplex PCR amplification reagents include 5×Multi-PCR Mix and Multi-PCR Enzyme Mix; and / or, the library amplification reagents include HiFi Amplification Mix.

8. The detection kit as described in claim 4, characterized in that, The concentration of any of the primers is 0.1-0.5 μM.

9. The application of the detection kit according to any one of claims 4-8, characterized in that, The application includes at least one of the following: a) Develop gene site mutation detection products for drugs used in neurodegenerative diseases; b) Develop risk assessment products for medications used in neurodegenerative diseases; c) Develop efficacy evaluation products for drugs used to treat neurodegenerative diseases.

10. A method for detecting gene site mutations in drugs for neurodegenerative diseases, for non-diagnostic purposes, characterized in that, Includes the following steps: S1. Extract DNA from the sample; S2. Using the DNA obtained in step S1 as a template, perform PCR amplification and purification using the primer composition described in claim 1; S3. Using the purified product as a template, a sequencing library is obtained by amplification using library amplification reagents and adapter sequences; S4. Sequencing of the sequencing library and analysis of the mutation detection results.

Images