Use of S100A1 in preparation of DKD diagnosis kit and DKD treatment drug

CN122811354APending Publication Date: 2026-09-25SHANDONG PROVINCIAL HOSPITAL AFFILIATED TO SHANDONG FIRST MEDICAL UNIVERSITY (SHANDONG PROVINCIAL HOSPITAL)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611171078.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-04
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

然而,截至目前,关于S100A1在糖尿病肾病肾小管损伤中究竟发挥何种生物学功能、通过何种分子机制参与疾病进程,以及其是否能够作为DKD诊断生物标志物或治疗靶点,国内外均尚无明确研究予以阐明

Benefits of technology

[0019]本发明具有以下有益效果:本发明首次揭示了S100A1在糖尿病肾病近端肾小管损伤中的关键致病作用和具体分子机制,为糖尿病肾病的早期诊断提供了新的生物标志物,并为靶向治疗提供了新的药物作用靶点。基于S100A1的检测试剂盒可用于糖尿病肾病的辅助诊断和病情监测,具有较好的临床应用前景。同时,靶向S100A1的干扰RNA等敲低表达的物质能够有效减轻糖尿病肾病的肾小管损伤和间质纤维化,为糖尿病肾病的治疗提供了新的药物选择和研发方向。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811354A_ABST
    Figure CN122811354A_ABST
Patent Text Reader

Abstract

The application discloses application of S100A1 in preparation of a DKD diagnosis kit and a DKD treatment drug, and relates to the technical field of diagnosis and treatment of diabetic kidney disease. The application finds that S100A1 is expressed in a diabetic nephropathy patient's proximal tubular epithelial cell in a high level, and is significantly related to a kidney function damage index. In a human proximal tubular epithelial cell cultured in vitro, S100A1 is knocked down, high-sugar induced cell damage is reduced, and S100A1 is overexpressed, and damage is aggravated. Mechanism research shows that S100A1 promotes K48 site ubiquitination degradation of KLF15 protein by enhancing the binding of E3 ubiquitin ligase MDM2 and KLF15, releases the transcriptional inhibition of KLF15 on ID1, up-regulates ID1 expression, and then induces inflammation and fibrosis of the proximal tubular epithelial cell. In-vivo experiments prove that proximal tubular specific knockdown of S100A1 can significantly reduce kidney damage of a diabetic nephropathy mouse. The application provides a new biomarker for diagnosis of diabetic nephropathy, and provides a new drug target and strategy for targeted treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of diagnostic and treatment technology for diabetic kidney disease, and particularly relates to the application of S100A1 in the preparation of DKD diagnostic kits and drugs for treating DKD. Background Technology

[0002] Diabetic kidney disease (DKD) is one of the most common and serious microvascular complications of diabetes, and it has become the leading cause of end-stage renal disease (ESRD) worldwide. With the continuous increase in the prevalence of diabetes, the incidence of DKD is also showing a rapid upward trend year by year, placing a heavy burden on patients' health and on social medical resources. For a long time, research on the pathogenesis of DKD has focused on glomerular lesions, believing that glomerular sclerosis and loss of filtration function are the core driving factors of disease progression. However, in recent years, increasing research evidence suggests that tubular damage is not a secondary manifestation of DKD, but rather appears in the very early stages of the disease and persists throughout its development, serving as an important pathophysiological basis for the continuous progression of DKD. Under the continuous stimulation of a high-glucose environment, renal tubular epithelial cells undergo a series of pathological changes, including activated inflammatory responses, abnormal deposition of extracellular matrix, and epithelial-interstitial transdifferentiation, ultimately leading to tubulointerstitial fibrosis and accelerating the progressive loss of renal function. Therefore, in-depth exploration of the key molecular mechanisms of renal tubular injury and the discovery of new targets that can intervene in renal tubular injury at an early stage are of vital scientific significance and clinical translational value for the prevention and treatment of DKD.

[0003] S100A1 (S100 calcium-binding protein A1) belongs to the S100 calcium-binding protein family. These proteins, as important intracellular calcium ion sensors, bind to calcium ions, triggering conformational changes and subsequently interacting with various downstream receptors and signal transduction molecules. They are widely involved in regulating key biological processes such as inflammatory responses, cell differentiation and proliferation, energy metabolism, apoptosis, and calcium homeostasis. S100A1 is highly expressed in myocardial tissue, and previous studies have largely focused on its role in cardiac function regulation. However, its role in kidney diseases, particularly diabetic nephropathy, has been rarely reported. Notably, in our previous study, by comparing single-cell RNA sequencing (scRNA-seq) data from human kidney samples of healthy controls and DKD patients, we discovered for the first time a significantly elevated expression level of S100A1 in proximal tubular epithelial cells of DKD patients. This finding strongly suggests that S100A1 may be involved in the pathological process of proximal tubular damage in DKD. However, to date, there are no clear studies, either domestically or internationally, clarifying the exact biological function of S100A1 in renal tubular damage in diabetic nephropathy, the molecular mechanisms by which it participates in the disease process, and whether it can serve as a diagnostic biomarker or therapeutic target for DKD.

[0004] Therefore, in-depth exploration of the specific role and molecular mechanism of S100A1 in renal tubular damage in diabetic nephropathy, and clarifying its potential value as a new target for disease diagnosis and targeted therapy, is not only an urgent need to fill the knowledge gap in this field, but also expected to provide new theoretical basis and intervention strategies for the clinical diagnosis and treatment of DKD. This is precisely the key technical problem that those skilled in the art urgently need to solve. Summary of the Invention

[0005] The purpose of this invention is to provide novel applications of S100A1 as a biomarker in the diagnosis and targeted therapy of diabetic nephropathy. Specifically, it involves the application of reagents for detecting S100A1 in the preparation of diagnostic kits for diabetic nephropathy, and the application of substances that knock down S100A1 expression in the preparation of drugs for treating diabetic nephropathy. This invention is based on the first discovery that S100A1 is specifically highly expressed in proximal tubular epithelial cells of diabetic nephropathy and exerts pro-inflammatory and pro-fibrotic effects through a novel S100A1-MDM2-KLF15-ID1 signaling pathway, thus providing new targets and strategies for the diagnosis and treatment of diabetic nephropathy.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] In a first aspect, the invention provides the use of a reagent for detecting S100A1 in the preparation of a diagnostic kit for diabetic nephropathy.

[0008] Furthermore, the reagent for detecting S100A1 comprises a primer set, which includes the upstream primer for S100A1 shown in SEQ ID NO.3 and the downstream primer for S100A1 shown in SEQ ID NO.4.

[0009] Furthermore, the primer set also includes the upstream β-actin primer shown in SEQ ID NO.13 and the downstream β-actin primer shown in SEQ ID NO.14.

[0010] In a second aspect, the present invention provides a diagnostic kit for diabetic nephropathy, the kit comprising a primer set including the upstream primer S100A1 shown in SEQ ID NO.3 and the downstream primer S100A1 shown in SEQ ID NO.4.

[0011] Furthermore, the primer set also includes the upstream β-actin primer shown in SEQ ID NO.13 and the downstream β-actin primer shown in SEQ ID NO.14.

[0012] This invention reveals that S100A1 expression is significantly elevated in proximal renal tubular epithelial cells of patients with diabetic nephropathy, and its expression level is negatively correlated with estimated glomerular filtration rate and positively correlated with serum creatinine and 24-hour urinary protein. Therefore, detecting the expression level of S100A1 in subject samples can provide important reference for the diagnosis and disease assessment of diabetic nephropathy.

[0013] In a third aspect, the present invention provides an interfering RNA, the sequence of which is shown in SEQ ID NO.1.

[0014] A fourth aspect of the invention provides the use of the interfering RNA in the preparation of a medicament for treating diabetic nephropathy.

[0015] Furthermore, the drug is used to reduce inflammation and fibrosis of proximal renal tubular epithelial cells in diabetic nephropathy.

[0016] Furthermore, the drug treats diabetic nephropathy by inhibiting the S100A1-MDM2-KLF15-ID1 signaling pathway.

[0017] Specifically, interfering with the S100A1-MDM2-KLF15-ID1 signaling pathway means knocking down S100A1, weakening the binding of E3 ubiquitin ligase MDM2 to KLF15, reducing the ubiquitination and degradation of KLF15 protein, thereby restoring the transcriptional repression function of KLF15 on ID1 and downregulating ID1 expression.

[0018] This invention demonstrated this mechanism through in vitro and in vivo experimental systems. In cultured human proximal tubular epithelial cells, knockdown of S100A1 reversed the upregulation of high glucose-induced proximal tubular injury markers KIM-1, cytotoxic cytokines IL-1β, IL-6, and TNF-α, as well as fibrosis-related molecules Collagen I, Collagen IV, and Fibronectin. Conversely, overexpression of S100A1 increased the expression levels of these genes. Mechanistically, S100A1 enhances the binding of the E3 ubiquitin ligase MDM2 to the transcription factor KLF15, promoting the ubiquitination and degradation of KLF15 protein at the K48 site. This relieves the transcriptional repression of ID1 by KLF15, upregulates ID1 protein expression, and subsequently induces inflammation and fibrosis in proximal tubular epithelial cells. In vivo experiments showed that specific knockdown of S100A1 in the proximal tubules significantly reduced kidney damage in mice with STZ combined with a high-fat diet-induced diabetic nephropathy, reversed the increase in the urinary albumin / creatinine ratio, reduced the tubulointerstitial injury score, and inhibited the upregulation of KIM-1, IL-1β, IL-6, Collagen I, Fibronectin and ID1 in the kidneys, thereby reducing macrophage infiltration.

[0019] This invention offers the following advantages: It reveals for the first time the key pathogenic role and specific molecular mechanism of S100A1 in proximal tubular damage in diabetic nephropathy, providing a new biomarker for the early diagnosis of diabetic nephropathy and a novel drug target for targeted therapy. The S100A1-based detection kit can be used for the auxiliary diagnosis and monitoring of diabetic nephropathy, showing promising clinical application prospects. Simultaneously, substances that knock down the expression of S100A1, such as interfering RNA, can effectively alleviate tubular damage and interstitial fibrosis in diabetic nephropathy, providing new drug options and research directions for the treatment of diabetic nephropathy. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1The expression and distribution of S100A1 in renal tissue of DKD patients are shown. A shows single-cell RNA sequencing analysis of proximal tubules from DKD patients and normal controls (NM), revealing upregulated S100A1 expression in the proximal tubules of DKD patients. B shows KIT database analysis, indicating increased S100A1 expression in proximal tubular cells of DKD patients. C shows representative immunohistochemical staining results of S100A1 in human renal tissues from DKD patients and controls. n=20; ***P < 0.001. D shows the correlation analysis between S100A1 expression in renal tubules of DKD patients and estimated glomerular filtration rate (eGFR), serum creatinine (Scr), and 24-hour urinary protein. E shows representative immunofluorescence co-staining images of S100A1 and the proximal tubular marker LTL in DKD renal tissue, n=3.

[0022] Figure 2 This diagram illustrates the role of S100A1 in high glucose-induced HK-2 cell damage. A shows real-time PCR analysis of S100A1 mRNA levels in HK-2 cells stimulated under normal glucose (NG) and high glucose (HG) conditions; B shows S100A1 protein expression in HK-2 cells under normal glucose (NG), high glucose (HG), or hyperosmolar control (HO) conditions; C shows Western blot analysis of KIM-1 protein levels in HK-2 cells transfected with control siRNA (si-NC) or S100A1 siRNA (si-S100A1) under HG stimulation; D shows real-time PCR analysis of IL-1β, IL-6, TNF-α, and MCP-1 mRNA levels in HK-2 cells transfected with si-NC or si-S100A1 and stimulated with HG; E shows Western blot analysis of IL-1β, IL-6, and TNF-α protein expression levels in each group of samples; F shows Collagen levels in HK-2 cells transfected with si-NC and si-S100A1 and stimulated with HG. I. Western blot analysis of Collagen IV and Fibronectin. Data are expressed as mean ± standard deviation, n=3; *P < 0.05, **P < 0.01, ***P < 0.001.

[0023] Figure 3The diagram illustrates the effect of S100A1 overexpression on HK-2 cell damage. A shows the Western blot analysis of KIM-1 protein levels in HK-2 cells after S100A1 overexpression. B shows the real-time PCR analysis of IL-1β, IL-6, TNF-α, and MCP-1 mRNA levels in HK-2 cells overexpressing S100A1. C shows the Western blot analysis of IL-1β, IL-6, and TNF-α protein expression levels in each group. D shows the Western blot analysis of Collagen I, Collagen IV, and Fibronectin in HK-2 cells with S100A1 overexpression. Data are expressed as mean ± standard deviation, n=3, ***P < 0.001.

[0024] Figure 4 The diagram shows the effect of S100A1 promoting HK-2 cell damage by upregulating ID1. A is a volcano plot: showing the differentially expressed genes (DEGs) in HK-2 cells overexpressing S100A1 compared to the control group: red dots represent upregulated genes, blue dots represent downregulated genes, and gray dots represent genes with no significant difference. B is a violin plot: showing S100A1 overexpression (S100A1) based on transcriptome sequencing data. OEC shows the expression level of ID1 in HK-2 cells of the control and treatment groups. D shows the changes in ID1 mRNA and protein expression in HK-2 cells transfected with si-NC or si-S100A1 under HG conditions, as shown by real-time PCR and Western blot analysis. E compares the expression levels of ID1 mRNA and protein in the control and S100A1-overexpressing HK-2 cells using real-time PCR and Western blot analysis. F shows the KIM-1 protein expression level in HK-2 cells after ID1 knockdown under HG conditions. G shows the real-time PCR results of IL-1β, IL-6, TNF-α, and MCP-1 under ID1 knockdown conditions. H shows the Western blot results of IL-1β, IL-6, and TNF-α under ID1 knockdown conditions. I represents the expression levels of Collagen I, Collagen IV, and Fibronectin in HK-2 cells after ID1 knockdown under HG conditions. J represents the expression levels of KIM-1, IL-1β, IL-6, Collagen I, Collagen IV, and Fibronectin proteins in HK-2 cells after co-transfection with S100A1 overexpression plasmid and ID1 small interference. Data are expressed as mean ± standard deviation, n=3; **P < 0.01, ***P < 0.001.

[0025] Figure 5The diagram shows the results of S100A1 regulating ID1 expression by affecting KLF15 protein stability. A shows the effect of KLF15 overexpression on ID1 promoter activity as shown by dual-luciferase reporter gene assay. B shows the ChIP-qPCR analysis of KLF15 enrichment in the ID1 promoter region in HK-2 cells, with IgG as a negative control. C shows real-time PCR and Western blot analysis of ID1 expression in HK-2 cells after KLF15 knockdown. D shows real-time PCR and Western blot analysis of ID1 expression in HK-2 cells after KLF15 overexpression. E shows real-time PCR analysis of KLF15 mRNA expression in HK-2 cells after S100A1 overexpression or knockdown. F shows Western blot analysis of KLF15 protein expression in HK-2 cells after S100A1 overexpression or knockdown. G represents the KLF15 protein level in HK-2 cells transfected with the S100A1 overexpression plasmid or as a control, treated with actinomycin (CHX, 50 μg / mL) at 0, 3, 6, and 9 hours, assessed for stability using Western blot. H represents the KLF15 protein expression in S100A1 overexpression and control HK-2 cells treated with MG132 (20 μM), chloroquine (10 μM), or calpeptin (10 μM) for 6 hours, as well as in control HK-2 cells, as shown by Western blot analysis. DMSO was used as a solvent control. Data are expressed as mean ± standard deviation. n=3, *P < 0.05, **P < 0.01, ***P < 0.001; ns indicates no significant difference.

[0026] Figure 6 To demonstrate that S100A1 promotes MDM2-mediated ubiquitination of KLF15 at the K48 site. A: Ubiquitination assay showing the effect of S100A1 overexpression on KLF15 ubiquitination. B: Ubiquitination analysis showing that S100A1 primarily promotes KLF15 ubiquitination at the K48 site. C: UbiBrowser analysis identifying MDM2 as a candidate E3 ubiquitin ligase for KLF15. D: Immunoprecipitation assay detecting the interaction between MDM2 and KLF15 in control and S100A1-overexpressing HK-2 cells. E: Ubiquitination assay showing that knockdown of MDM2 attenuates S100A1-induced KLF15 ubiquitination. Data are presented as mean ± standard deviation, n=3.

[0027] Figure 7Knockdown of S100A1 in the proximal tubule alleviated STZ-induced kidney injury in STZ-induced diabetic mice. A shows the knockdown efficiency of S100A1 in mouse kidney tissue as shown by Western blot results. B shows the colocalization of S100A1 with the proximal tubule marker LTL in the kidneys of control and STZ-treated mice. Scale bar = 50 μm; n = 6 per group. C shows the blood glucose levels in control and STZ-treated mice treated with AAV9-NC or AAV9-shS100A1. D shows the urinary albumin / creatinine ratio (UACR) in control and STZ-treated mice treated with AAV9-NC or AAV9-shS100A1. E shows the histopathological changes and collagen deposition in kidney sections from different groups of mice stained with HE, PAS, and Masson staining. Scale bar = 50 μm; n = 6 per group. F shows the tubulointerstitial injury score. n = 6 per group. Data are expressed as mean ± standard deviation. ***P < 0.001. Detailed Implementation

[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. The described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention. Unless otherwise specified, the reagents, antibodies, cells, experimental animals, and kits used in the following embodiments are all commercially available products, and the routine molecular biology, cell biology, and histological operations involved are performed in accordance with the instructions of the corresponding products or kits or experimental protocols generally accepted in the art. The clinical sample collection involved in this invention has been approved by the Ethics Committee of the Shandong Provincial Hospital Affiliated to Shandong First Medical University.

[0029] Example 1: Expression of S100A1 in renal tissue of patients with diabetic nephropathy and its correlation with clinical indicators

[0030] Our research group previously performed single-cell sequencing on renal biopsies from 3 patients with DKD and normal tissue samples from 3 nephrectomy patients. The results, combined with analysis of the KIT and Nephroseq databases, revealed elevated expression of S100A1 in the proximal tubules of DKD patients.

[0031] Twenty kidney tissue specimens were collected from DKD patients and 20 from healthy controls. Kidney tissue from DKD patients was obtained from kidney tissue of patients diagnosed with DKD by renal biopsy at the Department of Nephrology, Shandong Provincial Hospital Affiliated to Shandong First Medical University. The healthy control group consisted of healthy kidney tissue adjacent to the tumor of patients who underwent nephrectomy for tumors. Immunohistochemical staining was used to detect the expression level and localization of S100A1 in the kidney tissues of healthy controls and DKD patients, and Spearman analysis was used to analyze its correlation with eGFR, Scr, and 24-hour urinary protein. Immunofluorescence staining was used to observe the co-localization of S100A1 with the proximal tubule-specific marker protein LTL.

[0032] The specific steps for immunohistochemical staining are as follows: Paraffin tissue sections are placed flat on a slide baking machine and baked at 65°C for 1 hour to fully melt the paraffin surrounding the tissue. After baking, the sections are sequentially immersed in xylene solutions I and II for dewaxing, each for 15 minutes. After dewaxing, they are transferred to a gradient ethanol hydration sequence: immersion in anhydrous ethanol I and II for 8 minutes each, followed by treatment with 95%, 80%, and 70% ethanol solutions for 5 minutes each, to fully replace any residual xylene in the tissue. The hydrated sections are rinsed three times with double-distilled water for 5 minutes each to remove residual organic reagents; then, they are immersed in PBS buffer for 5 minutes. The sections are preheated and then completely immersed in the prepared antigen retrieval working solution (sodium citrate buffer for acidic epitope retrieval and EDTA buffer for basic epitope retrieval). The retrieval solution and sections are placed in an autoclave and heated. Once the exhaust valve is stable and steam is rising, the timer is started for 3-5 minutes. After the timer finishes, heating is stopped, and the sections are removed after the retrieval solution has cooled naturally to room temperature. After cooling, the sections were rinsed three times with PBS buffer, 5 minutes each time. Endogenous peroxidase inhibitor was added to the target area of ​​the tissue, ensuring complete coverage. The sections were incubated at 37°C in the dark for 30 minutes to eliminate background interference from endogenous enzymes. After incubation, the sections were rinsed three times with PBS buffer, 5 minutes each time. 0.5% Triton working solution was added to completely cover the tissue, and the sections were permeabilized at room temperature for 5 minutes to increase cell membrane permeability and facilitate antibody entry. After permeabilization, the sections were rinsed three times with PBS buffer, 5 minutes each time. 5% bovine serum albumin (BSA) blocking solution was added to cover the tissue sample, and the sections were blocked at 37°C for 30 minutes to reduce non-specific antibody binding. Using 5% BSA as the diluent, the S100A1 antibody (Abclonal, catalog number A23494) was diluted according to the recommended ratio in the antibody manufacturer's instructions. The diluted primary antibody working solution was added to the sections, ensuring complete coverage, and incubated overnight at 4°C. After primary antibody incubation, the sections were placed in a 37°C incubator for 1 hour to warm again. Then, the sections were rinsed three times with PBS buffer at room temperature for 5 minutes each time. Reaction enhancement solution was added to cover the tissue area, and the sections were incubated at 37°C for 20 minutes. After incubation, the sections were rinsed three times with PBS buffer for 5 minutes each time. Biotin-labeled goat anti-rabbit IgG polymer reagent was added to fully cover the tissue sample, and the sections were incubated at 37°C for 30 minutes. After secondary antibody incubation, the sections were rinsed three times with PBS buffer for 5 minutes each time. DAB chromogenic working solution was prepared according to the reagent instructions, added to the tissue sections, and completely covered. The chromogenic process was monitored under a microscope in real time. Once the positive signal was fully developed, the sections were immediately rinsed with tap water to terminate the chromogenic reaction. The sections were placed in hematoxylin staining solution to stain the nuclei for 3 minutes. After staining, the sections were slowly rinsed with tap water for 10 minutes. The sections were transferred to 1% hydrochloric acid ethanol differentiation solution for 3-5 seconds to remove non-specific staining outside the nucleus. Then, the sections were slowly rinsed with tap water for 5 minutes to allow the nuclei to fully return to blue.The tissue sections were dehydrated using a gradient of ethanol: 95% ethanol for 30 seconds, anhydrous ethanol I for 30 seconds, and anhydrous ethanol II for 1 minute. Finally, the sections were cleared in xylene I and II for 2 minutes each. Neutral resin was then applied to the tissue sections, and a coverslip was placed on top to complete the mounting.

[0033] The specific steps for immunofluorescence staining are as follows: The baking, dewaxing, gradient hydration, rinsing, and antigen retrieval steps for paraffin tissue sections are the same as those for immunohistochemical staining described above. After cooling, the sections are transferred to PBS buffer and rinsed three times, 5 minutes each time. 0.5% Triton working solution is added to completely cover the tissue, and the sections are permeated at room temperature for 5 minutes to improve the antibody's penetration efficiency against intracellular targets. After permeation, the sections are rinsed three times with PBS buffer, 5 minutes each time. 5% BSA blocking solution is added to cover the tissue, and the sections are blocked at 37°C for 30 minutes to block non-specific binding sites. S100A1 antibody (Abclonal, catalog number A23494) and LTL antibody (Vector Laboratories, catalog number FL-1321) are diluted separately with 5% BSA according to the manufacturer's recommended ratio, mixed well, and added to the sections to completely cover the tissue. The sections are incubated overnight at 4°C. After primary antibody incubation, the sections are placed in a 37°C incubator for 1 hour to rewarm; then rinsed three times with PBS buffer at room temperature, 5 minutes each time. Subsequent procedures were performed entirely in the dark: The corresponding species-specific fluorescent secondary antibody was diluted with PBS buffer according to the manufacturer's instructions, added to the tissue sections, and thoroughly covered. The sections were incubated at 37°C in the dark for 1 hour. After incubation, the sections were rinsed three times with PBS buffer for 5 minutes each time. DAPI staining working solution was added to cover the tissue, and the sections were stained for 5 minutes at room temperature in the dark. After staining, the sections were rinsed three times with PBS buffer for 5 minutes each time. Anti-fluorescence quenching mounting medium was added for mounting, and the sections were stored at 4°C in the dark.

[0034] Experimental results are as follows Figure 1 As shown. Immunohistochemical staining results showed that, compared with the normal control group, the protein expression level of S100A1 in the kidney tissue of DKD patients was significantly increased, with positive signals mainly distributed in the renal tubular region (see...). Figure 1 (See Figure C). Spearman correlation analysis showed that the expression level of S100A1 in the proximal tubules of DKD patients was significantly negatively correlated with eGFR (correlation coefficient r = -0.5056, P = 0.0229), significantly positively correlated with Scr level (r = 0.5591, P = 0.0104), and also significantly positively correlated with 24-hour urinary protein quantification (r = 0.5523, P = 0.0116) (see Figure C). Figure 1(D). Immunofluorescence co-staining results clearly showed that the fluorescence signals of S100A1 and LTL were significantly co-localized in the renal tubular region, further confirming that S100A1 is specifically highly expressed in the proximal renal tubular epithelial cells of DKD patients (see [reference]). Figure 1 (E). The above results suggest that S100A1 may play an important role in proximal tubular injury in DKD, and its expression level is expected to serve as a potential biomarker reflecting the degree of tubular injury in DKD.

[0035] Example 2: S100A1 participates in high glucose-induced human proximal renal tubular epithelial cell injury

[0036] To clarify the role of S100A1 in high glucose-induced injury of human proximal renal tubular epithelial cells, this embodiment used high glucose stimulation of human proximal renal tubular epithelial cells HK-2 to construct an in vitro model of diabetic nephropathy-related tubular injury. Through S100A1 knockdown and overexpression experiments, the expression changes of renal tubular injury markers, inflammatory factors, and fibrosis-related proteins were detected to clarify whether S100A1 is involved in high glucose-induced HK-2 cell injury.

[0037] First, HK-2 cells were cultured in vitro and divided into three groups: a normal glucose group (NG: 5.5 mmol / L glucose), a high glucose group (HG: 30 mmol / L glucose), and a hyperosmolar control group (HO: 5.5 mmol / L glucose + 24.5 mmol / L mannitol). The mRNA and protein expression levels of S100A1 in HK-2 cells of each group were detected by real-time PCR and Western blot to clarify the effect of high glucose stimulation on S100A1 expression.

[0038] To further clarify the function of S100A1 in high glucose-induced HK-2 cell injury, an S100A1 knockdown model was constructed. HK-2 cells were divided into a normal glucose group (NG), a high glucose group (HG), a high glucose + knockdown control group (HG + si-NC), and a high glucose + S100A1 knockdown group (HG + si-S100A1). After transfection with S100A1 small interfering RNA, the expression of renal tubular injury markers KIM-1, inflammatory factors IL-1β, IL-6, TNF-α, MCP-1, and fibrosis-related proteins Collagen I, Collagen IV, and Fibronectin was detected.

[0039] To observe whether elevated S100A1 expression induces damage in HK-2 cells, an S100A1 overexpression model was constructed. HK-2 cells were divided into four groups: normal glucose group (NG), high glucose group (HG), normal glucose + overexpression control group (NG + Vector), and normal glucose + S100A1 overexpression group (NG + S100A1).OE The expression changes of KIM-1, IL-1β, IL-6, TNF-α, MCP-1, Collagen I, Collagen IV and Fibronectin were detected by real-time PCR and Western blot to clarify whether increased S100A1 expression can promote HK-2 cell damage, inflammation activation and fibrosis-related responses.

[0040] The siRNA sequence used in this embodiment is as follows:

[0041] S100A1 siRNA is 5'-CUGUGGACAAGGUGAUGAATT-3' (SEQ ID NO. 1);

[0042] NC siRNA is 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO. 2).

[0043] The primer sequences for the target gene and internal reference gene used are as follows:

[0044] S100A1-F is 5'- TGCTGTGGACAAGGTGATGAA -3' (SEQ ID NO.3);

[0045] S100A1-R is 5'-CCACAAGCACCACATACTCCT-3' (SEQ ID NO.4);

[0046] IL-1β-F is 5'-CAACAAGTGGTGTTCTCCATGTC-3' (SEQ ID NO.5);

[0047] IL-1β-R is 5'-ACACGCAGGACAGGTACAGA-3' (SEQ ID NO. 6);

[0048] IL-6-F is 5'- CAATGAGGAGACTTGCCTGGT -3' (SEQ ID NO. 7);

[0049] IL-6-R is 5'- GCAGGAACTGGATCAGGACT -3' (SEQ ID NO. 8);

[0050] TNF-α-F is 5'- GAGGCCAAGCCCTGGTATG -3' (SEQ ID NO.9);

[0051] TNF-α-R is 5'-CGGGCCGATTGATCTCAGC-3' (SEQ ID NO.10);

[0052] MCP-1-F is 5'- AGAATCACCAGCAGCAAGTGTCC -3' (SEQ ID NO. 11);

[0053] MCP-1-R is 5'-TCCTGAACCCACTTCTGCTTGG-3' (SEQ ID NO.12);

[0054] β-actin-F is 5'-GAAGACTACGAGCTGCCTGA -3' (SEQ ID NO. 13);

[0055] β-actin-R is 5'-CAGACAGCACTGTGTTGGCG-3' (SEQ ID NO. 14).

[0056] The primary antibodies used in Western blot and their catalog numbers are as follows: S100A1 (Abclonal, A23494), IL-6 (Abmart, TD6087S), IL-1β (Immunoway, YT5201), TNF-α (Abclonal, A11534), Fibronectin (Diagbio, db13198), Collagen I (Diagbio, db11923), Collagen IV (Abmart, TP51657), KIM-1 (Proteintech, 30948-1-AP), β-actin (Proteintech, 66009-1-Ig).

[0057] The specific steps of real-time PCR are as follows: Total RNA was extracted from HK-2 cells in each group using a centrifugal column method. After cell treatment, the culture medium in the 6-well plate was discarded, and the cells were washed twice with PBS buffer to remove residual culture medium. Then, 600 μL of RNA lysis buffer was added to each well, and the cells were repeatedly pipetted to ensure complete lysis. After the lysis buffer was incubated at room temperature for about 5 minutes, an equal volume of 70% ethanol was added, and the mixture was thoroughly mixed to ensure complete binding of RNA to the lysis system until the solution was homogeneous and free of obvious precipitation. The mixture was transferred to an RNA adsorption column, centrifuged at 12,000 rpm for 1 minute, and the filtrate was discarded. Then, 600 μL of Buffer RW1 was added to the adsorption column, centrifuged at 12,000 rpm for 1 minute, and the filtrate was discarded; then, 650 μL of Buffer RW2 was added, centrifuged at 12,000 rpm for 1 minute, and the filtrate was discarded. The Buffer RW2 washing step was repeated twice to thoroughly remove proteins, salt ions, and other impurities. After washing, the adsorption column was placed in a new collection tube and centrifuged at 12,000 rpm for 2 minutes to remove residual washing solution from the column membrane. Finally, the adsorption column was transferred to a new RNase-free EP tube, and 30 μL of DEPC water was added to the center of the adsorption membrane. The tube was incubated at room temperature for 5 minutes to allow the RNA to fully dissolve. The RNA was then eluted by centrifugation, and the collected solution was the total RNA sample. RNA concentration and purity were measured using a NanoDrop 2000 spectrophotometer. A260 and A280 absorbance values ​​were recorded, and an A260 / A280 ratio within the range of 1.9–2.1 was used as a reference standard for RNA purity meeting the requirements for subsequent reverse transcription.

[0058] The qualified total RNA sample was subjected to reverse transcription to synthesize cDNA. A 20 μL reaction system was prepared according to the reverse transcription kit instructions: 1 μg total RNA, 2 μL gDNA CleanReaction Mix, and 4 μL 5× Evo M-MLV RT Reaction Mix were added sequentially to an RNase-free PCR tube, and DEPC water was added to bring the total to 20 μL. The mixture was gently pipetted and briefly centrifuged to collect the reaction solution at the bottom of the tube. The tube was then placed in a PCR instrument for reverse transcription. The reaction program was set as follows: 37℃ for 15 minutes to reverse transcribe RNA into cDNA; followed by heating at 85℃ for 5 seconds to terminate the reaction and inactivate the reverse transcriptase; after the reaction, the tube was stored at 4℃. The obtained cDNA can be directly used for subsequent real-time PCR detection or stored at -20℃ for short-term use.

[0059] The primers used in real-time PCR were chemically synthesized lyophilized primers. Before use, the primer tubes were placed at 4°C and centrifuged at 12,000 rpm for 2 minutes to concentrate the lyophilized primer powder adhering to the tube walls and caps to the bottom of the tube. Then, according to the primer instructions, an appropriate amount of DEPC water was added, thoroughly dissolved, and mixed to prepare a primer working solution with a final concentration of 10 μM for subsequent real-time PCR amplification. The qPCR reaction system was prepared on ice according to the qPCR kit instructions. To reduce the impact of pipetting errors on the experimental results, the total volume of the actual reaction mixture can be appropriately increased. The reaction solution was added to a 96-well PCR plate according to the experimental groups, and after sealing, it was centrifuged at 3,000 rpm for 2 minutes at room temperature to concentrate the reaction solution to the bottom of the wells and remove air bubbles. Amplification and detection were then performed using a Roche 480 real-time quantitative PCR instrument. The expression level of the target gene was normalized using the internal reference gene β-actin, and the relative expression level of each gene was calculated using the 2⁻ΔΔCt method. The qPCR reaction system consisted of: 10 μL of 2×SYBR Green Pro Taq HS Premix, 0.4 μL of Primer F, 0.4 μL of Primer R, 7.2 μL of RNase-free water, 2 μL of cDNA, and 20 μL of Total.

[0060] The specific steps of Western blot are as follows: After the HK-2 cells in each group were treated, the cell growth status was first observed under an inverted microscope. After confirming that the cells adhered well, had approximately 90% confluence, and were free of significant contamination, total protein extraction was performed. Before the experiment, the centrifuge was pre-cooled to 4°C, and PBS buffer, RIPA lysis buffer, protease inhibitor, protein phosphatase inhibitor, 5× protein loading buffer, 1.5 mL EP tubes, and pipette tips were prepared. The protein lysis working solution was prepared according to a ratio of protease inhibitor: protein phosphatase inhibitor: RIPA lysis buffer = 1:1:100 and kept on ice. After discarding the cell culture medium in the 6-well plate, the cells were gently washed three times with PBS buffer to remove residual culture medium. Then, 150 μL of pre-cooled protein lysis buffer was added to each well to ensure the lysis buffer fully covered the cell surface, and the plate was placed on ice for lysis for 15 minutes. During lysis, the plate could be gently shaken to promote complete cell lysis. After lysis, collect the lysis buffer from each well into a labeled 1.5 mL EP tube and centrifuge at 4°C and 12,000 rpm for 20 minutes. After centrifugation, carefully aspirate the supernatant and transfer it to a new EP tube, avoiding aspirating any precipitate. Take approximately 120 μL of protein supernatant from each tube for subsequent protein denaturation and Western blot analysis. Add 5× protein loading buffer to the protein sample and mix thoroughly. Prepare the sample by adding 30 μL of 5× loading buffer to 120 μL of protein supernatant, vortex to mix, and then place in a metal bath and heat at 99°C for 10 minutes to fully denature the protein. The denatured protein sample can be used directly for SDS-PAGE electrophoresis or stored at -20°C for later use.

[0061] Select an appropriate concentration of SDS-PAGE gel for electrophoretic separation based on the molecular weight of the target protein. Commonly used gel concentrations include 7.5%, 10%, or 12.5%. After thoroughly mixing the prepared protein sample and briefly centrifuging, calculate the loading volume based on the protein quantification results, ensuring an equal amount of protein is added to each well. Load approximately 20 μg of total protein into each well, and add a protein molecular weight marker as a reference. During electrophoresis, initially run at a constant voltage of 80 V to allow the sample to pass through the stacking gel and into the separating gel. Once the bromophenol blue indicator line reaches the separating gel, adjust the voltage to 120 V and continue electrophoresis until the target protein is fully separated. After electrophoresis, cut the corresponding gel region according to the molecular weight of the target protein and prepare a PVDF membrane for transfer. Activate the PVDF membrane with methanol before use, and then equilibrate it in transfer buffer. Assemble the transfer clamp in the following order: sponge, filter paper, gel, PVDF membrane, filter paper, sponge, taking care to remove air bubbles between the gel and membrane and ensuring a tight fit between the membrane and gel. Place the transfer clamp into the electroporation tank, add pre-cooled transfer buffer, and set the transfer time according to the molecular weight of the target protein, generally using a constant current of 220 mA. After transfer, remove the PVDF membrane and place it in 5% skim milk, then incubate at room temperature on a shaker for 1 hour to reduce non-specific binding. After incubation, wash the membrane three times with 1×TBST, approximately 10 minutes each time. Then, prepare the primary antibody working solution according to the recommended ratio in the primary antibody instructions, place the PVDF membrane in the primary antibody solution, ensuring the protein surface is fully submerged, and incubate overnight at 4°C on a shaker. The next day, remove the PVDF membrane and wash it three times with 1×TBST, approximately 10 minutes each time. Then, add the appropriate HRP-labeled secondary antibody and incubate at room temperature on a shaker for 1 hour. After secondary antibody incubation, wash the membrane three more times with 1×TBST, approximately 10 minutes each time. Finally, add ECL chemiluminescence solution for development and use a chemiluminescence imaging system to acquire protein band images. ImageJ software was used to analyze the grayscale values ​​of the bands, and β-actin was used as an internal reference to normalize the expression level of the target protein. Each experiment was repeated three times.

[0062] The results showed that, compared with the normal glucose group, high glucose stimulation significantly upregulated the mRNA and protein expression of S100A1 in HK-2 cells. S100A1 knockdown significantly inhibited the high glucose-induced upregulation of KIM-1 expression (see [link to study]). Figure 2 (See Figure C). This suggests that knocking down S100A1 can alleviate high glucose-induced HK-2 cell damage. Simultaneously, knocking down S100A1 can reduce the expression of high glucose-induced inflammatory factors such as IL-1β, IL-6, TNF-α, and MCP-1 (see Figure C). Figure 2 It inhibits the expression of fibrosis-related proteins such as Collagen I, Collagen IV, and Fibronectin (see D and E), and suppresses the expression of these proteins. Figure 2 (F). Conversely, overexpression of S100A1 under NG conditions (NG+S100A1)OE Compared to the group transfected with an empty vector (NG+Vector group), this directly led to an increase in KIM-1 protein expression (see [link to relevant documentation]). Figure 3 (A), and significantly upregulated the expression levels of inflammatory factors and fibrosis-related proteins (see A). Figure 3 (Middle B to D). The above results suggest that S100A1 is involved in high glucose-induced human proximal renal tubular epithelial cell injury and may promote inflammation activation and fibrosis-related responses (see [reference]). Figures 2 to 3 ).

[0063] Example 3: S100A1 promotes HK-2 cell damage by upregulating ID1

[0064] To further analyze the downstream molecular mechanisms by which S100A1 affects HK-2 cell damage, this example first investigated the effects of S100A1 on HK-2 cells overexpressing S100A1 (S100A1...). OE Transcriptome sequencing was performed on HK-2 cells (S100A1 overexpression group) and empty vector control cells (Vector group). Sequencing results showed that 353 genes were differentially expressed in HK-2 cells after S100A1 overexpression, with 105 genes upregulated and 248 genes downregulated (|log2FoldChange| > 0.8, P < 0.05). Analysis of the upregulated differentially expressed genes revealed that ID1 expression was increased in the S100A1 overexpression group (see...). Figure 4 (A and B). Given that ID1 is closely related to the inflammatory response and fibrosis process, this example further verifies whether ID1 is involved in S100A1-induced HK-2 cell damage.

[0065] 1. HK-2 cells were divided into a normal glucose group (NG), a high glucose group (HG), and a hyperosmolar control group (HO). After treatment, HK-2 cells from each group were collected, and the expression level of ID1 mRNA was detected by real-time PCR, and the expression level of ID1 protein was detected by Western blot.

[0066] 2. S100A1 knockdown and overexpression models were constructed in HK-2 cells. The S100A1 knockdown experiment included NG, HG, HG+si-NC, and HG+si-S100A1 groups; the S100A1 overexpression experiment included NG+Vector and NG+S100A1 groups. OE After treatment, real-time PCR and Western blot were used to detect the mRNA and protein expression levels of ID1 in each group of cells.

[0067] 3. HK-2 cells were transfected with ID1 small interfering RNA or negative control small interfering RNA and cultured under high glucose conditions. Experimental groups included: normal glucose group (NG), high glucose group (HG), high glucose + knockdown control group (HG+si-NC), and high glucose + ID1 knockdown group (HG+si-ID1). After treatment, Western blot was used to detect the protein expression of KIM-1, IL-1β, IL-6, TNF-α, Fibronectin, Collagen I, and Collagen IV, and real-time PCR was used to detect the mRNA expression of IL-1β, IL-6, TNF-α, and MCP-1.

[0068] 4. HK-2 cells were divided into three groups: normal glucose group (NG), normal glucose + overexpression control group (NG + Vector), and normal glucose + S100A1 overexpression group (NG + S100A1). OE Normal glucose + S100A1 overexpression + knockdown control group (NG + S100A1) OE +si-NC) and normal sugar + S100A1 overexpression + ID1 knockdown group (NG + S100A1) OE +si-ID1). Western blot was used to detect the protein expression of KIM-1, IL-1β, IL-6, Fibronectin, Collagen I and Collagen IV to clarify whether S100A1 participates in HK-2 cell damage by regulating ID1.

[0069] The specific steps for Real-time PCR and Western blot are the same as in Example 2.

[0070] The siRNA sequence used in this embodiment is as follows:

[0071] ID1 siRNA is 5'-GUUGGAGCUGAACUCGGAATT -3' (SEQ ID NO. 15);

[0072] NC siRNA is 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO. 2).

[0073] The primer sequences for the target gene and internal reference gene used are as follows:

[0074] ID1-F is 5'- GTTGGAGCTGAACTCGGAATCC -3' (SEQ ID NO. 16);

[0075] ID1-R is 5'-ACACAAGATGCGATCGTCCGCA-3' (SEQ ID NO.17);

[0076] β-actin-F is 5'-GAAGACTACGAGCTGCCTGA -3' (SEQ ID NO. 13);

[0077] β-actin-R is 5'-CAGACAGCACTGTGTTGGCG-3' (SEQ ID NO. 14).

[0078] The ID1 antibody used in the Western blot was purchased from Proteintech (catalog number 18475-1-AP).

[0079] Results showed that transcriptome sequencing revealed a significant increase in ID1 expression in HK-2 cells after S100A1 overexpression. Real-time PCR and Western blot results indicated that high glucose stimulation significantly upregulated ID1 mRNA and protein expression in HK-2 cells; knockdown of S100A1 effectively reduced the high glucose-induced increase in ID1 expression, while overexpression of S100A1 under normal glucose conditions was sufficient to significantly promote an increase in ID1 expression (see [link to study]). Figure 4 (C to E). This result indicates that ID1 is a key downstream effector molecule of S100A1.

[0080] Functional experiments showed that knocking down ID1 effectively mimicked the effect of knocking down S100A1, significantly reversed the high glucose-induced upregulation of KIM-1 protein expression, and reduced the expression levels of inflammatory factors such as IL-1β, IL-6, and TNF-α, as well as fibrosis-related proteins such as Collagen I, Collagen IV, and Fibronectin (see [link to relevant documentation]). Figure 4 (From F to I), to alleviate HK-2 cell damage. In the functional recovery experiment, S100A1 (NG+S100A1) was overexpressed. OE Simultaneously, co-transfect si-ID1 (NG+S100A1) OE +si-ID1) can reverse the upregulation of proximal tubular injury markers KIM-1, cytoinflammatory cytokines IL-1β and IL-6, and fibrosis-related molecules Collagen I, Collagen IV, and Fibronectin induced by S100A1 overexpression (see [link to article]). Figure 4 (J) Reduces tubular cell damage. This result suggests that S100A1 exerts its biological function of promoting human proximal renal tubular epithelial cell damage, inflammation, and fibrosis by upregulating ID1 expression.

[0081] Example 4: S100A1 upregulates ID1 by promoting MDM2-mediated KLF15 ubiquitination degradation.

[0082] Previous results showed that S100A1 overexpression significantly upregulated ID1 expression in HK-2 cells, while knockdown of S100A1 reduced ID1 expression, suggesting that ID1 may be an important downstream molecule of S100A1 regulating renal tubular epithelial cell injury. To further clarify the molecular mechanism by which S100A1 regulates ID1 expression, this embodiment validated the mechanisms from aspects such as ID1 transcriptional regulation, KLF15 protein stability, KLF15 ubiquitination modification, and MDM2 dependence.

[0083] 1. To screen upstream transcriptional regulators of ID1, the JASPAR database was searched to predict potential transcription factors binding to the ID1 promoter region. KLF15 was found to potentially bind to the ID1 promoter region. HK-2 cells were further divided into an overexpression control group (Vector) and a KLF15 overexpression group (KLF15...). OE The activity of the ID1 promoter was detected by dual-luciferase reporter gene assay; at the same time, the enrichment of KLF15 in the ID1 promoter region was detected by ChIP-qPCR.

[0084] 2. KLF15 knockdown and overexpression models were constructed, and HK-2 cells were transfected. After assessing the transfection efficiency, the cells were divided into control group (Con), knockdown control group (si-NC), KLF15 knockdown group (si-KLF15), empty vector group (Vector), and KLF15 overexpression group (KLF15). OE The regulatory role of KLF15 on ID1 expression was clarified by detecting ID1 mRNA and protein expression using real-time PCR and Western blot.

[0085] 3. Construct S100A1 knockdown and overexpression models, transfect HK-2 cells, and after assessing efficiency, divide the cells into control group (Con), knockdown control group (si-NC), S100A1 knockdown group (si-S100A1), empty vector group (Vector), and S100A1 overexpression group (S100A1). OE The effect of S100A1 on KLF15 expression level was determined by detecting KLF15 mRNA expression using real-time PCR and KLF15 protein expression using Western blot.

[0086] 4. To clarify whether S100A1 affects KLF15 protein stability, HK-2 cells were divided into Vector and S100A1 groups. OEThe group was treated with actinomycin (CHX, 50 μg / mL), and cell proteins were collected at 0, 3, 6 and 9 hours. The changes in KLF15 protein expression were detected by Western blot, and the degradation rate of KLF15 protein was analyzed.

[0087] 5. To clarify the KLF15 protein degradation pathway, HK-2 cells were divided into Vector and S100A1 groups. OE The groups were treated with DMSO, proteasome inhibitor MG132 (20 μM), lysosome inhibitor chloroquine (10 μM), and calpeptin inhibitor (10 μM), respectively. The changes in KLF15 protein expression were detected by Western blot to identify the degradation pathway involved in the regulation of KLF15 protein stability by S100A1.

[0088] 6. Since proteasome-dependent degradation is usually closely related to ubiquitination modification, in order to further clarify whether S100A1 promotes KLF15 ubiquitination, HK-2 cells were transfected with KLF15 plasmid and S100A1 overexpression plasmid, treated with MG132, and the KLF15 ubiquitination level was detected by Western blot.

[0089] 7. To clarify the type of ubiquitin chain that S100A1 promotes for KLF15 ubiquitination, HK-2 cells were co-transfected with Flag-KLF15, S100A1 overexpression plasmids, and MYC-Ub-WT, MYC-Ub-K48, or MYC-Ub-K63 plasmids. After treatment with MG132, immunoprecipitation was performed using Flag antibody, followed by Western blot analysis using MYC antibody to determine the primary type of ubiquitination modification that S100A1 promotes in KLF15.

[0090] 8. To screen for potential E3 ubiquitin ligases mediating KLF15 ubiquitination, a search of the UbiBrowser database revealed that MDM2 may be a candidate E3 ubiquitin ligase for KLF15. Further co-immunoprecipitation (Co-IP) experiments were used to verify the interaction between MDM2 and KLF15, and the effect of S100A1 overexpression on the binding of MDM2 to KLF15 was observed.

[0091] 9. To clarify whether MDM2 is involved in S100A1-induced KLF15 ubiquitination, HK-2 cells were co-transfected with KLF15, S100A1 overexpression plasmids, and MDM2 siRNA or negative control siRNA. After treatment with MG132, KLF15 ubiquitination levels were detected by Western blot to determine whether knocking down MDM2 could reverse S100A1-induced KLF15 ubiquitination.

[0092] The siRNA sequence used in this embodiment is as follows:

[0093] S100A1 siRNA is 5'-CUGUGGACAAGGUGAUGAATT-3' (SEQ ID NO. 1);

[0094] The KLF15 siRNA is 5'-CUUUGGGUGAUCCUGAUGATT-3' (SEQ ID NO.18);

[0095] The MDM2 siRNA is 5'-GCCAGUAUAUUAUGACUAATT-3' (SEQ ID NO.19);

[0096] NC siRNA is 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO. 2).

[0097] The specific steps for Real-time PCR and Western blot are the same as those in the previous examples.

[0098] The dual-luciferase reporter gene assay procedure is as follows: HK-2 cells were evenly seeded in 6-well plates. After the cells adhered well and the cell density was appropriate, they were transfected with the ID1 promoter luciferase reporter plasmid, KLF15 overexpression plasmid, or corresponding empty vector plasmid. The cells were gently shaken to ensure even distribution in the culture medium. Forty-eight hours after transfection, the culture medium was discarded, and the cells were gently washed twice with PBS, removing as much residual liquid as possible. 300 μL of cell lysis buffer was added to each well, and the cells were gently shaken at room temperature to ensure complete lysis. The cell lysis buffer was then collected in EP tubes. Following the instructions of the dual-luciferase reporter gene assay kit, Firefly luciferase assay reagent was added first to detect firefly luciferase activity; then Renilla luciferase assay reagent was added to detect Renilla luciferase activity. The Firefly and Renilla luciferase readings for each group were recorded. The ratio of Firefly luciferase activity to Renilla luciferase activity was used to represent the relative activity of the ID1 promoter.

[0099] The ChIP-qPCR experimental steps are as follows: HK-2 cells were evenly seeded into cell culture dishes. Once the cell density was suitable, they were treated using a ChIP kit. In a fume hood, formaldehyde was added to the cell culture dishes to a concentration of 1%, and incubated at 37°C for 10 minutes to cross-link intracellular proteins and DNA. 1.1 mL of Glycine Solution (10×) was added, gently mixed, and incubated at room temperature for 5 minutes. The formaldehyde and glycine-containing culture medium in the culture dishes was aspirated, and 5 mL of PBS mixed with PMSF was added for washing the cells three times. 1 mL of PBS mixed with PMSF was added, and the cells were scraped off and collected into a centrifuge tube. The cells were centrifuged at 12000 rpm for 2 minutes at 4°C. An appropriate amount of SDS-Lysis Buffer containing PMSF was prepared, and 0.2 mL was used to resuspend the cell pellet. The cells were incubated on ice for 10 minutes to fully lyse the cells. The cells were then sonicated at 20W for 10 seconds followed by a 20-second pause, for a total of 6 cycles. Add 8 μL of 5M NaCl to 0.2 mL of the sonicated sample, mix well, and heat at 65°C for 4 hours to remove cross-links between protein and genomic DNA. Then centrifuge the sonicated sample at 12,000 rpm for 5 minutes at 4°C. Transfer the supernatant (approximately 0.2 mL) to a 2 mL centrifuge tube and place on ice. Prepare an appropriate amount of ChIP Dilution Buffer containing PMSF, and add 1.8 mL of ChIP Dilution Buffer containing PMSF to dilute the sonicated sample to a final volume of 2 mL. Take 20 μL (1%) of the sample as input for subsequent detection. Add 50 μL of Protein A / G Magnetic Beads / Salmon Sperm DNA to the remaining approximately 2 mL of sample, and mix gently by rotating or shaking at 4°C for 30 minutes. Incubate with primary antibody overnight at 4°C with gentle shaking. The next day, add 80 μL of Protein A / G Magnetic Beads / Salmon Sperm DNA and incubate at 4°C with gentle shaking for 60 minutes. Place the sample on a magnetic rack for 30 seconds to separate, then remove the supernatant, being careful not to touch the magnetic beads. Wash the sample sequentially with Low Salt Immune Complex Wash Buffer, High Salt Immune Complex Wash Buffer, LiCl Immune Complex Wash Buffer, and TE Buffer, using 1 mL of wash buffer each time, and gently shake for 3 minutes at 4°C each time. Prepare an appropriate amount of fresh Elution buffer (1% SDS, 0.1M NaHCO3). After washing the sample, add 250 μL of Elution buffer, vortex to mix, and gently shake at room temperature for 3 minutes.Centrifuge on a magnetic rack for 30 seconds, then transfer the supernatant to a new centrifuge tube. Add 250 μL of Elution buffer to the precipitate, vortex to mix, and gently shake at room temperature for 3 minutes. Centrifuge on a magnetic rack for 30 seconds, then collect the supernatant, yielding approximately 500 μL of supernatant. Add 20 μL of 5M NaCl to 500 μL of supernatant, and 1 μL of 5M NaCl to 20 μL of input, mix well, and heat at 65°C for 4 hours. Add 10 μL of 0.5M EDTA, 20 μL of 1M Tris (pH 6.5), and 2 μL of 20 mg / mL proteinase K to approximately 520 μL of sample, mix well, and incubate at 45°C for 60 minutes. Purify the DNA using a DNA purification kit, and then perform quantitative real-time PCR.

[0100] The ID1 promoter ChIP-qPCR primer sequence is as follows:

[0101] F 5'-GTCGTCTTCCACACTGCGAG-3' (SEQ ID NO. 20);

[0102] R 5'-TTATAAACACGCCACGGCCC-3' (SEQ ID NO. 21).

[0103] The Co-IP experimental procedure is as follows: HK-2 cells were seeded in cell culture dishes and treated according to the experimental design. Once the cells were in good growth condition and at a suitable density, protein extraction was performed. The culture medium was discarded, and the cells were gently washed twice with PBS, removing as much residual liquid as possible. A cell lysis working solution was prepared according to a RIPA lysis buffer: protease inhibitor: phosphatase inhibitor ratio of 100:1:1. An appropriate amount of pre-chilled lysis buffer was added to the culture dish, and the dish was placed on ice for 15 minutes for lysis. After lysis, the cell lysis buffer was collected in EP tubes and centrifuged at 4°C and 12000 rpm for 20 minutes. The supernatant was collected as the total protein sample. The protein concentration of each group was determined using the BCA method, and the protein concentration was adjusted according to the results to ensure a consistent total protein amount for subsequent immunoprecipitation. An equal amount of protein was used for immunoprecipitation in each group, and a portion of the protein sample was used as an input control. The immunoprecipitation samples were divided into an IP group and an IgG group, with the IgG group serving as a negative control. According to the antibody instructions, MDM2 antibody (Proteintech, 27883-1-AP) was added to the IP group, and IgG antibody of the same species (Proteintech, 30000-0-AP) was added to the IgG group. After thoroughly mixing the protein samples with the corresponding antibodies, the mixture was incubated overnight at 4°C to allow for complete binding of the antibodies to the target proteins. Protein A / G magnetic beads were pretreated according to the instructions, and then added to the protein-antibody mixture. Incubation was continued at 4°C to allow for complete binding of the protein-antibody complex to the magnetic beads. After incubation, the EP tubes were placed on a magnetic rack and allowed to stand until the magnetic beads were completely adsorbed, then the supernatant was discarded. An appropriate amount of lysis buffer or wash buffer was added to the magnetic beads, and the mixture was gently pipetted to mix. The tubes were then placed back on the magnetic rack, and the supernatant was discarded after the magnetic beads were adsorbed. This washing step was repeated 2–3 times to reduce non-specific binding proteins. After washing, add 50–100 μL of 1×Loading Buffer to the magnetic beads, mix thoroughly, and heat at 100°C for 10 minutes to dissociate the immune complexes and complete protein denaturation. After cooling, place the samples on a magnetic rack and allow them to stand. Then, aspirate the supernatant for Western blot analysis. Input, IgG, and IP samples were loaded simultaneously for Western blot analysis.

[0104] The results showed that dual-luciferase reporter gene assays revealed that KLF15 overexpression reduced ID1 promoter activity. ChIP-qPCR results showed significant enrichment of KLF15 in the ID1 promoter region, suggesting that KLF15 can bind to the ID1 promoter and inhibit ID1 transcription. Real-time PCR and Western blot results showed that KLF15 knockdown upregulated ID1 mRNA and protein expression, while KLF15 overexpression downregulated ID1 expression, indicating that KLF15 is an upstream negative regulator of ID1. S100A1 overexpression or knockdown had no significant effect on KLF15 mRNA expression, but S100A1 overexpression reduced KLF15 protein expression, while S100A1 knockdown increased KLF15 protein expression. CHX experiments showed that S100A1 overexpression accelerated KLF15 protein degradation. Protein degradation pathway inhibition experiments showed that MG132 reversed the KLF15 protein decrease induced by S100A1 overexpression, while CQ and calpeptin had no significant effect, suggesting that S100A1 mainly reduces KLF15 protein stability through proteasome-related pathways. Further ubiquitination experiments showed that S100A1 overexpression enhanced KLF15 ubiquitination levels and mainly promoted KLF15 ubiquitination at the K48 site. The UbiBrowser database predicted that MDM2 may be a candidate E3 ubiquitin ligase for KLF15. Co-IP results showed that MDM2 interacts with KLF15, and S100A1 overexpression enhanced the binding of MDM2 to KLF15. Further knockdown of MDM2 significantly reduced the KLF15 ubiquitination level induced by S100A1 overexpression. The above results indicate that S100A1 can enhance the interaction between MDM2 and KLF15, promote MDM2-mediated KLF15 ubiquitination at the K48 site and proteasome degradation, relieve the transcriptional repression of ID1 by KLF15, thereby upregulating ID1 expression and promoting HK-2 cell damage (see [link to relevant documentation]). Figures 5 to 6 ).

[0105] Example 5: The role of S100A1 in STZ-induced renal tubular injury in diabetic mice

[0106] To further clarify the role of S100A1 in diabetic renal tubular injury in vivo, this embodiment constructs an STZ-induced diabetic mouse model and uses AAV9-Ggt1-shS100A1 to mediate targeted knockdown of S100A1 in the proximal renal tubules to observe its effects on renal tubular injury, inflammatory cell infiltration and fibrosis in diabetic mice.

[0107] 1. Constructing an STZ-induced diabetic mouse model

[0108] Eight-week-old male C57BL / 6J mice were selected and randomly divided into groups after acclimatization. The diabetic model group was fed a high-fat diet combined with STZ (50 mg / kg, intraperitoneal injection for 5 consecutive days) to establish a diabetic mouse model, while the control group was treated with the same dose of citrate buffer via intraperitoneal injection. Blood glucose levels were monitored regularly after modeling to observe the establishment of the diabetic model.

[0109] 2. Construct a proximal renal tubule-specific S100A1 knockdown mouse model

[0110] To achieve targeted knockdown of S100A1 in proximal renal tubular epithelial cells, an AAV9-shS100A1 adeno-associated virus vector driven by the Ggt1 promoter was constructed, with AAV9-NC as a negative control. The virus was delivered to mice via tail vein injection. Experimental groups included: AAV9-NC group, AAV9-shS100A1 group, STZ+AAV9-NC group, and STZ+AAV9-shS100A1 group, with n=6 in each group.

[0111] 3. Detection of S100A1 knockdown efficiency and renal tubular localization

[0112] Kidney tissues from mice in each group were collected, and S100A1 protein expression was detected by Western blot to verify the knockdown efficiency of AAV9-shS100A1. S100A1 was co-stained with the proximal tubular marker LTL using immunofluorescence to detect its expression and localization in mouse kidney tissues. The specific steps for immunofluorescence co-staining were the same as described in Example 1.

[0113] 4. Detection of blood glucose and kidney damage indicators in mice

[0114] Blood glucose levels in each group of mice were measured using a blood glucose meter. Urine was collected from each group of mice to measure urinary albumin and creatinine levels, and the urinary albumin / creatinine ratio (UACR) was calculated to evaluate the degree of kidney damage in diabetic mice.

[0115] 5. Observe the pathological changes in kidney tissue.

[0116] Kidney tissues from mice in each group were collected, fixed, embedded, and sectioned, and then stained with HE, PAS, and Masson staining, respectively. HE staining was used to observe renal tubular epithelial cell damage, lumen dilation, and inflammatory cell infiltration; PAS staining was used to observe renal tubular and glomerular matrix deposition; and Masson staining was used to evaluate the degree of renal tubular interstitial collagen deposition and fibrosis.

[0117] 6. Detection of renal tubular injury, inflammatory factors, and fibrosis-related indicators. Total protein was extracted from the kidney tissue of mice in each group, and the expression of ID1, KIM-1, IL-1β, IL-6, Collagen I, and Fibronectin was detected by Western blot to clarify the effect of S100A1 knockdown on renal tubular injury, inflammatory response, and fibrosis.

[0118] The steps for constructing an STZ-induced diabetic mouse model are as follows: Eight-week-old male C57BL / 6J mice were selected and acclimatized in a standard feeding environment; the mice were randomly divided into a control group and an STZ model group; the STZ model group mice were fed a high-fat diet for 4 weeks; STZ (50 mg / kg) was injected intraperitoneally for 5 consecutive days at the experimental dose, while the control group mice were injected with an equal volume of sodium citrate buffer; fasting blood glucose was measured weekly after STZ injection; mice with a sustained fasting blood glucose level above 300 mg / dL were considered to have successfully established a diabetic model; 20 weeks after STZ injection, the mice were sacrificed, and blood, urine, and kidney tissue were collected for subsequent testing.

[0119] The procedure for tail vein injection of AAV9-Ggt1-shS100A1 is as follows: Four weeks prior to STZ injection, AAV9-Ggt1-shS100A1 or AAV9-NC is injected via tail vein; the dose per mouse is 1×10⁻⁶. 12 Viral genomes were analyzed; mice were fed and their general condition was observed after injection; kidney tissue was collected at the experimental endpoint, and S100A1 protein expression was detected by Western blot to verify the knockdown efficiency of AAV9-shS100A1. The experimental groups were: AAV9-NC group, AAV9-shS100A1 group, STZ+AAV9-NC group, and STZ+AAV9-shS100A1 group, with 6 mice in each group.

[0120] The steps for blood glucose and UACR detection are as follows: fasting blood glucose of mice in each group is measured regularly during the experiment; urine samples are collected from mice before the end of the experiment; urine albumin concentration and urine creatinine concentration are measured; UACR is calculated based on the results of urine albumin and urine creatinine; changes in blood glucose and UACR of mice in each group are compared to evaluate the establishment of the diabetes model and the degree of kidney damage.

[0121] The HE staining procedure is as follows: Paraffin sections of mouse kidney tissue are placed in a slide oven and baked at 65°C for 1 hour to ensure full adhesion and melt the paraffin. The sections are then dewaxed sequentially in xylene I and xylene II for 15 minutes each time; subsequently, they are hydrated in a gradient of anhydrous ethanol I, anhydrous ethanol II, 95% ethanol, 85% ethanol, and 75% ethanol for 3 minutes each. The sections are then rinsed three times in distilled water for 5 minutes each time. The sections are stained with hematoxylin for 3 minutes and then slowly rinsed with tap water. The sections are differentiated in 1% hydrochloric acid ethanol differentiation solution for 3 seconds, then immediately rinsed with tap water and stained with blueing solution or running water for 6 minutes. The sections are stained with eosin for 3 minutes and then quickly rinsed with distilled water. The sections are then dehydrated in a gradient of 75%, 85%, 95% ethanol, and anhydrous ethanol, followed by clearing in xylene I and xylene II for 5 minutes each time. A suitable amount of neutral resin was dropped onto the tissue section, covered with a coverslip, and the section was allowed to air dry naturally before being observed and images were acquired under a microscope.

[0122] The PAS staining procedure is as follows: Baking and dewaxing the slides are the same as for HE staining. Add PAS oxidizing agent to the tissue sections and incubate at room temperature for 10 minutes, then rinse with running water. Immerse the sections twice in distilled water, 5 minutes each time. Add Schiff staining solution to the tissue sections and incubate at room temperature in the dark for 15 minutes, then rinse with running water for 10 minutes to allow for full staining. Hematoxylin staining of the nuclei and dehydration / clearing are the same as for HE staining; mounting and observation are the same as for HE staining.

[0123] The Masson staining procedure is as follows: Slide preparation and dewaxing are the same as for HE staining. Following the Masson staining kit instructions, stain the slides in Weigert iron hematoxylin solution for 5 minutes, then rinse with running water. Differentiate the slides in acidic differentiation solution for 3 seconds, rinse with running water, and then perform a blueing treatment. Stain the slides in Ponceau S and Acidic Fuchsin solution for 5 minutes, then rinse quickly with distilled water. Treat the slides in phosphomolybdic acid solution for 3 minutes. Stain the slides in aniline blue solution for 3 minutes, then rinse quickly with distilled water. Treat the slides in 1% glacial acetic acid solution for 1 minute, then rinse quickly. Dehydration and clearing are the same as for HE staining; mounting and observation are the same as for HE staining.

[0124] The specific steps for Western blot are the same as in Example 2.

[0125] The results showed that Western blot analysis revealed a significant decrease in S100A1 protein expression in mouse kidney tissue after AAV9-shS100A1 treatment, indicating the successful establishment of a proximal tubule-targeted S100A1 knockdown model. Immunofluorescence co-staining results showed that S100A1 was mainly located in the LTL-positive proximal tubule region, and STZ treatment significantly increased S100A1 expression in the proximal tubules of mice. STZ treatment significantly increased blood glucose and UACR in mice, but compared with the STZ+AAV9-NC group, the UACR in the STZ+AAV9-shS100A1 group was significantly decreased. HE, PAS, and Masson staining results showed that mice in the STZ+AAV9-NC group exhibited significant renal tubular dilation, renal tubular epithelial cell damage, luminal structural disorder, increased PAS-positive matrix deposition, and increased Masson-stained collagen deposition, with an increased tubulointerstitial injury score. Compared with the STZ+AAV9-NC group, the STZ+AAV9-shS100A1 group showed significantly reduced pathological changes and a decreased tubulointerstitial injury score. Western blot results showed that STZ treatment upregulated the expression of ID1, KIM-1, IL-1β, IL-6, Collagen I, and Fibronectin proteins in mouse kidney tissue, while AAV9-shS100A1 treatment significantly reduced the expression of these proteins. The above results indicate that S100A1 expression is elevated in the proximal tubules of STZ-induced diabetic mice. Targeted knockdown of S100A1 in the proximal tubules can alleviate tubular damage and fibrosis in diabetic mice and inhibit ID1 expression, suggesting that S100A1 may participate in the development and progression of tubular damage in diabetic nephropathy by regulating ID1 (see [link to relevant documentation]). Figure 7 ).

[0126] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of reagents for detecting S100A1 in the preparation of diagnostic kits for diabetic nephropathy.

2. The application according to claim 1, characterized in that, The reagent for detecting S100A1 comprises a primer set, which includes the upstream primer for S100A1 shown in SEQ ID NO.3 and the downstream primer for S100A1 shown in SEQ ID NO.

4.

3. The application according to claim 2, characterized in that, The primer set also includes the upstream primer for β-actin shown in SEQ ID NO.13 and the downstream primer for β-actin shown in SEQ ID NO.

14.

4. A diagnostic kit for diabetic nephropathy, characterized in that, It includes a primer set comprising the upstream primer S100A1 shown in SEQ ID NO.3 and the downstream primer S100A1 shown in SEQ ID NO.

4.

5. The diagnostic kit for diabetic nephropathy according to claim 4, characterized in that, The primer set also includes the upstream primer for β-actin shown in SEQ ID NO.13 and the downstream primer for β-actin shown in SEQ ID NO.

14.

6. An interfering RNA, characterized in that, Its sequence is shown in SEQ ID NO.

1.

7. The use of the interfering RNA according to claim 6 in the preparation of a drug for treating diabetic nephropathy.

8. The application according to claim 7, characterized in that, The drug is used to reduce inflammation and fibrosis of proximal renal tubular epithelial cells in diabetic nephropathy.

9. The application according to claim 7, characterized in that, The drug treats diabetic nephropathy by inhibiting the S100A1-MDM2-KLF15-ID1 signaling pathway.

10. The application according to claim 9, characterized in that, The interference with the S100A1-MDM2-KLF15-ID1 signaling pathway refers to knocking down S100A1, weakening the binding of E3 ubiquitin ligase MDM2 to KLF15, reducing the ubiquitination and degradation of KLF15 protein, thereby restoring the transcriptional repression function of KLF15 on ID1 and downregulating ID1 expression.