Primer probe combination and its use in the preparation of a product for detecting and assessing central sensitization type chronic pain associated with osteoarthritis patients
Patent Information
- Application Number
- CN202611290618.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-08-25
- Publication Date
- 2026-09-25
AI Technical Summary
[0006]然而,常规的基因测序方法成本高、周期长,不适合大规模临床筛查;而传统的染料法定量PCR特异性差,难以精准区分单核苷酸多态性的杂合与纯合状态
[0060](1)特定探针杂交边界和长度组合显著提高分型可判读性
Smart Images

Figure CN122811358A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological detection, and more particularly to primer-probe combinations and their application in the preparation of products for detecting and evaluating centrally sensitized chronic pain in patients with osteoarthritis. Background Technology
[0002] Osteoarthritis is the most common degenerative joint disease worldwide and a leading cause of chronic pain and long-term disability in adults. Its impact extends beyond physical impairment and psychological distress, imposing a heavy economic burden through medical expenses and lost productivity. Despite extensive research, there is currently no cure for osteoarthritis. Therefore, clinical management primarily focuses on symptom relief and functional recovery. Characteristic symptoms typically include activity-induced joint pain, transient morning stiffness or stiffness after rest, activity-related discomfort, and limited mobility. Among all symptoms, osteoarthritis pain is the most clinically significant feature, making it a leading cause of pain in the elderly. Therefore, as a globally recognized chronic disease, a systematic analysis of the clinical characteristics of chronic pain in osteoarthritis is of significant clinical importance. In clinical practice, many osteoarthritis patients complain of poorly localized pain that is not highly correlated with imaging-identified joint structural abnormalities, and routine use of nonsteroidal anti-inflammatory drugs (NSAIDs) is often ineffective. This has led the applicant to consider whether osteoarthritis is also accompanied by abnormalities in the sensory input center. However, previous research on the existence of a central sensitization phenotype in osteoarthritis and its precise mechanisms is almost entirely lacking.
[0003] Clinical evidence suggests that approximately 30-40% of osteoarthritis patients also have fibromyalgia syndrome, characterized by chronic, widespread pain and central sensitization. These patients often present with fibromyalgia-like central sensitization. Currently, clinical assessment relies primarily on subjective scales such as the Central Sensitization Index (CSI), the Widespread Pain Index (WPI), and the Symptom Severity Scale (SSS). Therefore, the applicant hypothesizes that chronic pain in osteoarthritis patients, inconsistent with objective evidence, may be related to chronic, widespread pain and central sensitization. However, clinical practice severely lacks molecular biological tools for early objective screening.
[0004] Subsequently, based on previous research, the applicant identified a shared genetic structure between osteoarthritis and fibromyalgia syndrome. The shared genetic loci were significantly enriched in the ferroptosis pathway, and the applicant mapped and identified the high-confidence novel locus rs13107325 (SLC39A8 gene) as a key shared genetic hub at the gene level. Previous research also indicated that rs13107325 is a high-confidence colocalization site for osteoarthritis driving fibromyalgia syndrome. Therefore, this provides a scientific basis and development potential for identifying an objective, early molecular biological screening tool for the subtype of osteoarthritis accompanied by severe central sensitization pain.
[0005] The SLC39A8 gene encodes a transmembrane metal ion transporter (ZIP8) responsible for the uptake of ions such as zinc and iron by cells. Studies have shown that the missense mutation (C>T, Ala391Thr) in exon 8 of the SLC39A8 gene at rs13107325 alters the structure and ion transport function of the ZIP8 protein, thereby inducing ferroptosis and the abnormal release of neuroinflammatory factors (such as IL-6 and IL-17). This plays a crucial role in the pathogenesis of central sensitization pain associated with osteoarthritis. Therefore, the rs13107325 site can serve as an independent predictive target for assessing the risk of central sensitization in patients with osteoarthritis.
[0006] However, conventional gene sequencing methods are costly and time-consuming, making them unsuitable for large-scale clinical screening; while traditional dye-based quantitative PCR has poor specificity and struggles to accurately distinguish between heterozygous and homozygous states of single nucleotide polymorphisms. Currently, there are no commercially available in vitro diagnostic kits specifically designed for rapid and accurate genotyping of mutations at this site, and applicable to the prediction of the risk of severe central sensitization associated with osteoarthritis. Summary of the Invention
[0007] In view of this, the present invention provides a primer-probe combination and its application in the preparation of products for detecting and evaluating centrally sensitized chronic pain in patients with osteoarthritis. Addressing the issue that existing detection methods for detecting the C / T polymorphism at the rs13107325 locus of the human SLC39A8 gene still have room for improvement in terms of operational procedures, detection cycle, and standardized result interpretation, this invention provides a single-tube detection technique based on allele-specific dual-color TaqMan-MGB probes. This technique determines the CC, CT, and TT genotypes at the rs13107325 locus by detecting the C and T alleles separately in the same reaction system. It also provides corresponding amplification primers, dual-color probe combinations, detection kits, quality control conditions, and result interpretation methods, thus providing a technical means for rapid, closed-tube, and standardized genotyping of this locus in clinical samples. The obtained genotyping information can also be combined with clinical phenotypic indicators such as CSI scores, WPI scores, and SSS scores for the auxiliary assessment and stratification of central sensitization-related phenotypes in patients with osteoarthritis.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0009] This invention provides a primer-probe combination, including: an upstream primer (forward primer), a downstream primer (reverse primer), probe 1 (probe A2), and probe 2 (probe B2).
[0010] The nucleotide sequence of the upstream primer is shown in SEQ ID NO:1;
[0011] The nucleotide sequence of the downstream primer is shown in SEQ ID NO:2;
[0012] The nucleotide sequence of probe 1 is shown in SEQ ID NO:3;
[0013] The nucleotide sequence of probe 2 is shown in SEQ ID NO:4.
[0014] In some embodiments of the present invention, in the above primer-probe combination, the 5' end of the nucleotide sequence of probe 1 is connected to a first fluorescent reporter group, and the 3' end is connected to a quencher group and a minor groove conjugate; and
[0015] The nucleotide sequence of probe 2 has a second fluorescent reporter group attached to the 5' end and a quencher group and minor groove conjugate attached to the 3' end.
[0016] In some embodiments of the present invention, in the above primer-probe combination, the first fluorescent reporter group includes a VIC fluorescent reporter group; and the second fluorescent reporter group includes a FAM fluorescent reporter group.
[0017] In some embodiments of the present invention, the quenching group in the above primer-probe combination includes the NFQ group.
[0018] In some embodiments of the present invention, in the above primer-probe combination, probe 1 is a C allele-specific probe; probe 2 is a T allele-specific probe.
[0019] This invention also provides the application of the above primer-probe combination in any of the following:
[0020] (a) Prepare products for detecting and / or assessing phenotypes of central sensitization in patients with osteoarthritis; and / or
[0021] (b) Prepare products for the detection of fibromyalgia syndrome; and / or
[0022] (c) Preparing products for the detection of osteoarthritis; and / or
[0023] (d) Prepare products for detecting and / or assessing centrally sensitized chronic pain in patients with osteoarthritis.
[0024] In some embodiments of the present invention, the detection in the above applications includes the following steps: amplifying the template using the primer-probe combination, and determining the relevant phenotype based on the amplification curve.
[0025] In some embodiments of the present invention, the criteria for judgment in the above applications include:
[0026] When a specific amplification curve appears in the detection channel of the first fluorescent reporter group, but no specific amplification curve appears in the detection channel of the second fluorescent reporter group, the phenotype is CC type.
[0027] When a specific amplification curve appears in the detection channel of the second fluorescent reporter group, but no specific amplification curve appears in the detection channel of the first fluorescent reporter group, the phenotype is TT type.
[0028] When specific amplification curves appear in the detection channels of both the first and second fluorescent reporter groups, the phenotype is CT type.
[0029] The result is invalid if no specific amplification curve or abnormal amplification curve appears in the detection channels of both the first and second fluorescent reporter groups.
[0030] In some embodiments of the present invention, the criteria for judgment in the above applications also include: CSI score, WPI score, and SSS score.
[0031] In some embodiments of the present invention, the detection in the above applications includes the following steps:
[0032] S1: RNA was extracted from peripheral blood mononuclear cells of the subject, reverse transcribed into cDNA, and after the concentration and purity of cDNA were detected, it was added to a reaction system containing the above primer and probe set.
[0033] S2: Amplification was performed on a real-time quantitative PCR instrument capable of simultaneously acquiring FAM and VIC fluorescence signals; the amplification signals of the two channels were acquired in real time under a validated cyclic program, and quality control was performed in combination with the amplification curve morphology, Ct value and positive and negative control results;
[0034] S3: Provided that the positive control results of this test meet expectations and the negative control shows no effective amplification within the pre-established valid interpretation interval, genotyping shall be performed according to the following rules:
[0035] S3-1: The VIC channel showed effective amplification while the FAM channel did not, indicating a CC type;
[0036] S3-2: Both IC and FAM channels showed effective amplification, indicating a CT type;
[0037] S3-3: The FAM channel showed effective amplification while the VIC channel did not, indicating a TT type.
[0038] S3-4: If there is no effective amplification in both channels, the amplification curve is abnormal, or the result is at the preset interpretation boundary, it is judged as an invalid or uncertain result, and DNA should be extracted again or retested.
[0039] Effective amplification refers to the appearance of an amplification curve that meets the requirements within the threshold range determined through methodological validation in advance; specific Ct thresholds, signal ratios, or allele cluster boundaries should be established in advance based on positive controls, negative controls, and repeatability validation results.
[0040] The present invention also provides detection reagents, including: the above-described primer-probe combination and acceptable adjuvants.
[0041] In some embodiments of the present invention, the concentrations of the upstream primer and the downstream primer in the above-mentioned detection reagent are 0.1~0.5 μM; the concentrations of probe 1 and probe 2 are 0.1~0.5 μM.
[0042] In some embodiments of the present invention, the concentrations of the upstream primer and the downstream primer in the above-mentioned detection reagent are 0.4 μM; and the concentrations of probe 1 and probe 2 are 0.2 μM.
[0043] The present invention also provides a detection kit, comprising: the above-described primer-probe set and / or the above-described detection reagent.
[0044] The present invention also provides a gene typing method for non-diagnostic purposes, comprising: after obtaining a nucleic acid template, using the above-mentioned primer-probe combination, the above-mentioned detection reagent and / or the above-mentioned detection kit to amplify the nucleic acid template, collecting fluorescence signals, and obtaining gene typing results based on the amplification curve.
[0045] In some embodiments of the present invention, the criteria for judging the classification result in the above-described classification method include:
[0046] When a specific amplification curve appears in the detection channel of the first fluorescent reporter group, but no specific amplification curve appears in the detection channel of the second fluorescent reporter group, the phenotype is CC type.
[0047] When a specific amplification curve appears in the detection channel of the second fluorescent reporter group, but no specific amplification curve appears in the detection channel of the first fluorescent reporter group, the phenotype is TT type.
[0048] When specific amplification curves appear in the detection channels of both the first and second fluorescent reporter groups, the phenotype is CT type.
[0049] The result is invalid if no specific amplification curve or abnormal amplification curve appears in the detection channels of both the first and second fluorescent reporter groups.
[0050] In some embodiments of the present invention, the above-described classification method includes the following steps:
[0051] S1: RNA is extracted from peripheral blood mononuclear cells of the subject, reverse transcribed into cDNA, and after the concentration and purity of cDNA are detected, it is added to a reaction system containing the above primer and probe set, the above detection reagent or the above detection kit.
[0052] S2: Amplification was performed on a real-time quantitative PCR instrument capable of simultaneously acquiring FAM and VIC fluorescence signals; the amplification signals of the two channels were acquired in real time under a validated cyclic program, and quality control was performed in combination with the amplification curve morphology, Ct value and positive and negative control results;
[0053] S3: Provided that the positive control results of this test meet expectations and the negative control shows no effective amplification within the pre-established valid interpretation interval, genotyping shall be performed according to the following rules:
[0054] S3-1: The VIC channel showed effective amplification while the FAM channel did not, indicating a CC type;
[0055] S3-2: Both VIC and FAM channels showed effective amplification, indicating a CT type;
[0056] S3-3: The FAM channel showed effective amplification while the VIC channel did not, indicating a TT type.
[0057] S3-4: If there is no effective amplification in both channels, the amplification curve is abnormal, or the result is at the preset interpretation boundary, it is judged as an invalid or uncertain result, and DNA should be extracted again or retested.
[0058] Effective amplification refers to the appearance of an amplification curve that meets the requirements within the threshold range determined through methodological validation in advance; specific Ct thresholds, signal ratios, or allele cluster boundaries should be established in advance based on positive controls, negative controls, and repeatability validation results.
[0059] Compared with comparative examples and conventional testing procedures, the present invention has the following advantages:
[0060] (1) Specific probe hybridization boundary and length combinations significantly improve the interpretability of genotyping.
[0061] Using the same 8 clinical samples, primers, and reaction system, the unoptimized probe combination A1 / B1 failed to yield reliable genotyping results (0 / 8). The probes A2 / B2 of this invention enabled interpretable channel combinations in all 8 samples. The paired exact McNemar test showed a two-sided P=0.0078.
[0062] (2) Specific probe hybridization boundaries and length combinations significantly altered auxiliary channel levels.
[0063] In 8 paired clinical samples, each containing two detection channels (FAM and VIC), a total of 16 potential sample-channel pairs were formed. However, due to some channels not being detected in the comparative sample, only 10 sample-channel pairs obtained numerical Ct values under both schemes. The median Ct values for the comparative sample and the present invention in the aforementioned 10 comparable channels were 36.57 and 26.40, respectively. Calculating the Ct difference (comparative sample Ct - present invention Ct) using the same sample and the same channel, the median was 10.43 cycles, and the Ct decreased in all 10 / 10 channels. As an auxiliary channel-level analysis, the exact pair Wilcoxon signed-rank test (two-sided P=0.00195) was used. The Ct values for the FAM and VIC channels in the positive plasmid control decreased by 19.73 and 20.03 cycles, respectively.
[0064] (3) Improvement is not achieved by increasing the amount of template or changing the amplification primers.
[0065] Both protocols maintained the same amplification primers, 161 bp amplification fragment, fluorescent labeling, MGB modification, and reaction system, only changing the probe hybridization start and end positions and length. The detection results changed from unreliable to interpretable for all samples, which is a qualitative change in detection performance rather than a minor parameter adjustment.
[0066] (4) It achieves accurate typing of single-tube dual-color samples and has extremely high anti-interference ability for clinical specimens.
[0067] Using MGB probes labeled with FAM and VIC respectively, the C and T alleles at the rs13107325 locus can be accurately distinguished in the same reaction system. In a blinded test of peripheral blood samples from 26 real-world patients with osteoarthritis, the kit demonstrated an extremely wide dynamic detection range: it not only performed rapid and clear typing of high-quality samples (Ct values between 18 and 28), but more importantly, it could still stably acquire fluorescence signals and accurately provide allele typing results for difficult samples commonly extracted in clinical practice, such as low-abundance marginal samples with FAM Ct values >35 or even close to 38. This fully demonstrates the strong robustness and broad applicability of this approach in complex and variable real-world clinical environments.
[0068] (5) To draw a complete disease phenotypic spectrum, providing an objective tool for early warning and precise stratification of central sensitization.
[0069] This invention successfully cross-validated the molecular subtyping results of a 26-case cohort with clinical phenotypes (CSI, WPI, SSS). The validation cohort comprehensively covered the complete trajectory of osteoarthritis evolving into central sensitization: it not only accurately identified all three mutation-positive cases exhibiting typical severe central sensitization and confirmed fibromyalgia (CSI scores as high as 37-55, and strict WPI / SSS targets); but also astutely detected several "subclinical low-risk" mutation carriers with extremely low current clinical scale scores, such as a CSI score of only 3, who had not yet shown typical symptoms. This strongly demonstrates that this patent can not only be used for the auxiliary diagnosis of mid-to-late stage comorbidities, but also achieve prospective risk warning for "prevention of disease" in the early stages of disease (even in the early stages of structural damage).
[0070] (6) This invention is easy to operate and suitable for clinical application.
[0071] This invention's reagent kit uses closed-tube amplification detection, eliminating the need for cumbersome subsequent steps such as electrophoresis. It is compatible with mainstream real-time PCR instruments in major hospitals and takes less than 2 hours from sample extraction to generating a typing report. Attached Figure Description
[0072] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0073] Figure 1 The TaqMan probe amplification curves (FAM channel) of comparative examples A1 / B1 are shown.
[0074] Figure 2The TaqMan probe amplification curves (VIC channel) of comparative examples A1 / B1 are shown.
[0075] Figure 3 The image shows an agarose gel electrophoresis image of the PCR product (the PCR product is a single band, and the fragment size matches the expected amplicon (161 bp));
[0076] Figure 4 The TaqMan probe amplification curves (FAM channel) of the A2 / B2 of this invention are shown.
[0077] Figure 5 The TaqMan probe amplification curves (VIC channel) of the A2 / B2 of this invention are shown.
[0078] Figure 6 The figure shows a comparison of the pairing Ct and reliable typing success rate of the two probe combinations (A1 / B1 and A2 / B2 of the present invention);
[0079] Figure 7 The image shows the allele-specific two-color TaqMan qPCR Ct results of peripheral blood mononuclear cell (PBMC) samples from 26 patients with clinical osteoarthritis.
[0080] Figure 8 This paper presents a correlation mapping between the rs13107325 genotype and clinical phenotype (CSI score, WPI-SSS combined distribution) of 26 clinical samples with osteoarthritis. Detailed Implementation
[0081] This invention discloses primer-probe combinations and their application in the preparation of products for detecting and evaluating centrally sensitized chronic pain in patients with osteoarthritis.
[0082] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.
[0083] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.
[0084] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.
[0085] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.
[0086] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.
[0087] This invention provides an amplification primer pair, an allele-specific two-color TaqMan-MGB probe combination, a detection kit, and a detection method for detecting the C / T polymorphism at the rs13107325 site of the human SLC39A8 gene and performing genotyping.
[0088] (1) Combination of amplification primers and allele-specific probes
[0089] 1. Amplification primer pair: including a forward primer and a reverse primer, used to amplify the target nucleic acid fragment containing the rs13107325 site; forward primer (SEQ ID NO:1): tctgcatgttcctgctatgt; reverse primer (SEQ ID NO:2): ccagttaccttttctctcagc. This primer pair amplifies a 161 bp target fragment containing the rs13107325 site.
[0090] 2. C allele-specific probe (probe A2): Its hybridization region covers the rs13107325 site and is complementary to the C allele. The 5′ end is labeled with a VIC fluorescent reporter group, and the 3′ end is connected with a non-fluorescent quencher group (NFQ) and a minor groove binder (MGB). The nucleotide sequence is shown in SEQ ID NO:3: tggtgggcaacaatttcgctccaaatattatatttgcac.
[0091] 3. T allele-specific probe (probe B2): Its hybridization region covers the rs13107325 site and is complementary to the T allele. The 5′ end is labeled with the FAM fluorescent reporter group, and the 3′ end is linked to NFQ and MGB. The nucleotide sequence is shown in SEQ ID NO:4: caacaatttcActccaaatattat.
[0092] During amplification, the probe specifically hybridizes with the corresponding allele template and is hydrolyzed by the 5′→3′ exonuclease activity of Taq DNA polymerase, causing the fluorescent reporter group and quencher group to separate, thereby generating detectable fluorescent signals in the VIC and FAM channels, respectively.
[0093] (2) Test kit
[0094] The detection kit comprises: a 2×Probe qPCR Master Mix containing hot-start Taq DNA polymerase, the aforementioned forward and reverse primers, the aforementioned VIC and FAM-labeled TaqMan-MGB probes, a positive control, a negative control, and nuclease-free water. The positive control contains a nucleic acid template capable of generating the expected C and T allele detection signals; the negative control is preferably nuclease-free water. The kit may also include instructions for use and result interpretation rules for sample genotyping.
[0095] (3) Optimize the reaction system
[0096] In a preferred embodiment, the total volume of the real-time PCR reaction is 20 μL, including 10 μL of 2×Probe qPCR Master Mix, a final concentration of 0.4 μM each for the forward and reverse primers, a final concentration of 0.2 μM each for the VIC and FAM probes, 2 μL of cDNA from the sample to be tested, and nuclease-free water to bring the volume to 20 μL. The above concentrations can be adjusted within a validated range based on the instrument used, the Master Mix, and the quality of the sample cDNA.
[0097] (4) Detection and genotyping methods
[0098] 1. RNA was extracted from peripheral blood mononuclear cells of the subject, reverse transcribed into cDNA, and the concentration and purity of cDNA were detected before being added to the reaction system.
[0099] 2. Amplification was performed on a real-time quantitative PCR instrument capable of simultaneously acquiring FAM and VIC fluorescence signals; the amplification signals of the two channels were acquired in real time under a validated cyclic program, and quality control was performed in conjunction with the amplification curve morphology, Ct value, and positive and negative control results.
[0100] 3. Provided that the positive control results in this test meet expectations and the negative control shows no effective amplification within the pre-established valid interpretation interval, genotyping shall be performed according to the following rules:
[0101] ① The VIC channel showed effective amplification while the FAM channel did not, indicating a CC type;
[0102] ② Both VIC and FAM channels showed effective amplification, indicating a CT type;
[0103] ③ The FAM channel showed effective amplification while the VIC channel did not, indicating a TT type;
[0104] ④ If there is no effective amplification in either channel, the amplification curve is abnormal, or the result is at the preset interpretation boundary, it is determined to be an invalid or uncertain result, and DNA should be extracted again or retested.
[0105] "Effective amplification" refers to the appearance of an amplification curve that meets the requirements within a threshold range determined through methodological validation in advance; specific Ct thresholds, signal ratios, or allele cluster boundaries should be established in advance based on positive controls, negative controls, and repeatability validation results.
[0106] (5) Uses
[0107] The primer and probe combination, detection kit, and detection method are used to obtain the CC, CT, or TT genotype information of the SLC39A8 gene rs13107325 locus in the subject. The obtained genotyping results can be combined with clinical phenotypic indicators such as CSI score, WPI score, and SSS score for auxiliary assessment and stratification of central sensitization-related phenotypes in osteoarthritis patients.
[0108] In Examples 1 to 5 and Comparative Example 1 of this invention, all raw materials and reagents used can be purchased from the market.
[0109] The present invention will be further illustrated below with reference to the embodiments:
[0110] Example 1: Design and synthesis of primers and A2 / B2 dual-color probe combination of the present invention
[0111] Specific amplification primers and probes were designed targeting the human SLC39A8 gene sequence. The wild-type probe is labeled with VIC at the 5' end and binds MGB and a non-fluorescent quencher (NFQ) at the 3' end; the mutant probe is labeled with FAM at the 5' end and binds both MGB and NFQ at the 3' end. MGB modification significantly improves the hybridization stability of short probes in regions rich in AT or low in GC, achieving extremely high resolution for single nucleotide polymorphisms. The sequence and reaction system of this invention are detailed in the technical solution description and Table 1.
[0112] Table 1 Probe design of the present invention (A2 / B2)
[0113]
[0114] Comparative Example 1: Unoptimized probe combination A1 / B1
[0115] The same amplification primers and reaction system were used in the initial screening, but 42 nt wild-type probe A1 and 32 nt mutant probe B1 were employed (Table 2). The unoptimized probe combination showed no peak amplification curve (e.g., Figure 1 and Figure 2 (As shown).
[0116] Table 2. Unoptimized probe designs in the early stages (A1 / B1)
[0117]
[0118] Example 2: Preparation and Analytical Performance Verification of the Detection Kit
[0119] 1. The kit contains 10 μL of 2×Probe qPCR Master Mix, primer and probe mixture (0.4 μM each for forward and reverse primers, and 0.2 μM each for VIC and FAM probes), plasmid standards, and 2 μL of DNA template.
[0120] 2. Analytical performance was validated using the constructed wild-type and mutant plasmids as templates. Results showed that when the template was a wild-type plasmid, only the VIC channel showed a peak; when the template was a mutant plasmid, only the FAM channel showed a peak, with no cross-reaction between the two channels. A 10-fold serial dilution test of the standard showed that the limit of detection (LOD) remained consistently below 50 copies / reaction, demonstrating extremely high analytical sensitivity (e.g., ...). Figures 3-5 (As shown).
[0121] Example 3: Pairing verification of two probe combinations
[0122] Paired comparisons were performed on clinical samples S1-S8 from the same batch. A1 / B1 did not yield reliable genotyping results, while A2 / B2 resulted in interpretable channel combinations for all 8 samples. The exact McNemar test showed a two-sided P=0.0078; the median decrease in the common value Ct for paired comparisons was 10.43 cycles, and the exact paired Wilcoxon test showed a P=0.00195 (e.g., ...). Figure 6 (As shown).
[0123] Example 4: Validation of the detection kit in the combined assessment of genotyping and central sensitization phenotypes in a cohort of 26 clinical samples.
[0124] (1) Sample source and clinical phenotype assessment
[0125] Twenty-six clinically diagnosed PBMC samples (numbered S1-S26) of osteoarthritis were selected. All patients underwent standardized clinical phenotypic assessment, and their CSI, WPI, and SSS scores were recorded. Patients were phenotypically classified according to the ACR diagnostic criteria for fibromyalgia syndrome.
[0126] (2) Kit detection
[0127] Genomic DNA was extracted from the above samples and amplified by real-time quantitative PCR using the detection kit prepared in Example 2. The clinical sample results in this example were obtained using an SDS7500 real-time quantitative PCR system; a TaqMan chemical system; and a ROX passive reference.
[0128] (3) Verification of genotyping and anti-interference ability of clinical specimens
[0129] 1. The FAM channel of sample S4 was undetermined, and the VIC channel was amplified normally (Ct=24.41). According to the preset interpretation rules, it was determined to be a wild-type homozygote (CC).
[0130] 2. The remaining 25 samples obtained valid Ct values in both the FAM and VIC channels, identifying them as heterozygous mutation carriers (CT). The detection data showed excellent gradient inclusiveness: it included both high-abundance amplified samples (e.g., Ct values of 18.82 and 23.60) and successfully detected a large number of low-abundance, difficult samples (many Ct values were in the 34-38 range). This demonstrates that the probe combination has extremely high specific binding ability to single-base differences and a very wide linear detection range (as shown in Table 3). Figure 7 As shown, the FAM channel is used to detect the mutant T allele, and the VIC channel is used to detect the wild-type C allele. The figure shows that the kit can effectively distinguish between mutation carriers (FAM / VIC double positive) and completely wild-type individuals (VIC single positive) at a wide range of concentration gradients (Ct values 18-38).
[0131] Table 3. Summary of qPCR typing and clinical scales of PBMC samples from 26 patients with clinical osteoarthritis
[0132]
[0133] Note: FAM Ct "Not Detected" indicates that the channel is undetermined. CSI: Central Sensitization Scale; WPI: Generalized Pain Index; SSS: Symptom Severity Scale.
[0134] Example 5: Full-spectrum association analysis of genotype and clinical phenotype
[0135] Cross-referencing the molecular subtyping results of 26 cases with three major clinical pain scales revealed that the kit can accurately map the complete trajectory of osteoarthritis evolving into severe central sensitization.
[0136] (1) Precise identification of severe extreme cases
[0137] Three typical and severe cases of fibromyalgia syndrome were diagnosed in the cohort. Their clinical phenotypes were extremely extreme (Case A: CSI=55, WPI=3, SSS=10; Case B: CSI=42, WPI=7, SSS=7; Case C: CSI=37, WPI=8, SSS=7). This kit accurately identified all three severe cases as carriers of the rs13107325 mutation (CT type), and also detected one high-risk mutation patient meeting the expert consensus CSI diagnostic cutoff value (CSI=40). This strongly confirms the high-risk driving role of this mutation in the severe pain sensitization phenotype.
[0138] (2) Early warning of asymptomatic high-risk groups
[0139] Among the detected mutation carriers were several patients with early to mid-stage osteoarthritis who currently have extremely low CSI scores (e.g., CSI scores of only 3, 6, and 7) and whose clinical presentations do not meet the diagnostic criteria for fibromyalgia syndrome. The kit can identify genetic susceptibility in the subclinical stage, providing an early screening basis for future targeted interventions to prevent disease.
[0140] (3) Wild-type reference observation
[0141] The completely wild-type samples (CC type) detected in the cohort had a CSI score of 27, did not exhibit severe central sensitization or fibromyalgia characteristics, and belonged to the typical peripheral nociceptive pain safe zone. Figure 8 As shown in the figure, the patient population carrying the mutated allele (CT type) was effectively identified, and several cases of severe sensitization meeting the positive diagnostic criteria for fibromyalgia syndrome were effectively identified, establishing the independent predictive value of this molecular marker in clinical phenotypic stratification.
[0142] Conclusion: Under the condition of maintaining consistent primers and reaction system, the A2 / B2 specific probe combination of this invention significantly improves effective amplification and result interpretability compared to the comparative A1 / B1. Furthermore, the embodiments of this invention were validated using 26 real clinical samples spanning high and low concentrations, demonstrating not only the high detection success rate and strong robustness of the two-color TaqMan genotyping kit in complex clinical environments, but more importantly, the mutation results detected by this technology successfully cover the complete disease spectrum from subclinical low-risk stages to confirmed severe central sensitization, and even confirmed fibromyalgia syndrome. These results establish the significant clinical translational application value of this detection kit in early risk warning, patient stratification, and personalized precision analgesia management for osteoarthritis complicated by central sensitization pain.
[0143] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A primer-probe combination, characterized in that, include: Upstream primer, downstream primer, probe 1, and probe 2; The nucleotide sequence of the upstream primer is shown in SEQ ID NO:1; The nucleotide sequence of the downstream primer is shown in SEQ ID NO:2; The nucleotide sequence of probe 1 is shown in SEQ ID NO:3; The nucleotide sequence of probe 2 is shown in SEQ ID NO:
4.
2. The primer-probe combination as described in claim 1, characterized in that, The nucleotide sequence of probe 1 has a first fluorescent reporter group attached to its 5' end and a quencher group and a minor groove conjugate attached to its 3' end; and The nucleotide sequence of probe 2 has a second fluorescent reporter group attached to the 5' end and a quencher group and minor groove conjugate attached to the 3' end.
3. The application of the primer-probe combination as described in claim 1 or 2 in any of the following: (a) To prepare products for the detection and / or assessment of centrally sensitized chronic pain in patients with osteoarthritis; and / or (b) Prepare products for detecting and / or assessing the risk level of fibromyalgia syndrome in osteoarthritis subject samples; and / or (c) Prepare products for the detection and / or evaluation of osteoarthritis complicated with fibromyalgia syndrome.
4. The application as described in claim 3, characterized in that, The detection includes the following steps: amplifying the template using the primer and probe set, and determining the relevant phenotype based on the amplification curve.
5. The application as described in claim 4, characterized in that, The criteria for judgment include: When a specific amplification curve appears in the detection channel of the first fluorescent reporter group, but no specific amplification curve appears in the detection channel of the second fluorescent reporter group, the phenotype is CC type. When a specific amplification curve appears in the detection channel of the second fluorescent reporter group, but no specific amplification curve appears in the detection channel of the first fluorescent reporter group, the phenotype is TT type. When specific amplification curves appear in the detection channels of both the first and second fluorescent reporter groups, the phenotype is CT type. The result is invalid if no specific amplification curve or abnormal amplification curve appears in the detection channels of both the first and second fluorescent reporter groups.
6. A detection reagent, characterized in that, include: The primer-probe combination as described in claim 1 or 2, and acceptable auxiliaries.
7. The detection reagent as described in claim 6, characterized in that, The concentrations of the upstream and downstream primers are 0.1–0.5 μM; the concentrations of probe 1 and probe 2 are 0.1–0.5 μM.
8. A test kit, characterized in that, include: The primer-probe combination as described in claim 1 or 2 and / or the detection reagent as described in claim 6 or 7.
9. A gene typing method for non-diagnostic purposes, characterized in that, include: After obtaining the nucleic acid template, the nucleic acid template is amplified using the primer and probe combination as described in claim 1 or 2, the detection reagent as described in claim 6 or 7, and / or the detection kit as described in claim 8. Fluorescence signals are collected, and the gene typing results are obtained based on the amplification curve.
10. The classification method as described in claim 9, characterized in that, The criteria for judging the classification results include: When a specific amplification curve appears in the detection channel of the first fluorescent reporter group, but no specific amplification curve appears in the detection channel of the second fluorescent reporter group, the phenotype is CC type. When a specific amplification curve appears in the detection channel of the second fluorescent reporter group, but no specific amplification curve appears in the detection channel of the first fluorescent reporter group, the phenotype is TT type. When specific amplification curves appear in the detection channels of both the first and second fluorescent reporter groups, the phenotype is CT type. The result is invalid if no specific amplification curve or abnormal amplification curve appears in the detection channels of both the first and second fluorescent reporter groups.