Kit and method for quantitative detection of mutations in the npm1 gene

Abstract

The application belongs to the technical field of gene mutation detection, and specifically discloses a kit and a detection method for quantitatively detecting gene mutation NPM1 The method provides an IC-crRNA which can quantitatively detect the fluorescence signal corresponding to 100% mutation rate in equal amounts of DNA. A double-channel detection system of specific MT-crRNA and internal quality control IC-crRNA is constructed, and a rate correction coefficient is introduced k The fluorescence signal of the non-nuclease water control system is established, a quantitative mathematical model is established, and the quantitative accuracy is improved. The method only needs 5 μL of patient blood, and can achieve a detection limit as low as 1% in about 40 minutes without nucleic acid extraction NPM1 Gene mutation can be quantitatively detected. The method has the advantages of simple operation, rapid detection, high sensitivity, high specificity and low cost.

Description

Technical Field

[0001] This invention belongs to the field of gene mutation detection technology, specifically relating to a method for... NPM1 Kits and methods for quantitative detection of gene mutations. Background Technology

[0002] CRISPR / Cpf1-based nucleic acid detection technology is increasingly being used to diagnose various diseases. The principle is that, guided by crRNA, the Cpf1 protein specifically binds to and cleaves target DNA paired with the crRNA sequence, while simultaneously activating its paracleavage activity to non-specifically cleave surrounding single-stranded DNA. When the single-stranded DNA has fluorescent and quenching groups at both ends, this non-specific cleavage reaction releases a fluorescent signal. Currently, there are various engineered variants of the Cpf1 protein, each with its own advantages in terms of activity, specificity, and PAM motif recognition range.

[0003] NPM1 Gene-encoded nucleolar phosphatase proteins are involved in regulating cell proliferation and the cell cycle. NPM1 Gene mutations are the most common gene mutations in patients with acute myeloid leukemia (AML), occurring in approximately 30% of AML patients. More than 97% of these mutations occur in AML patients. NPM1 The gene mutation results in a c.863_864 tetrabase insertion, with over one hundred reported subtypes. The most common subtypes are type A (c.863_864insTCTG), type B (c.863_864insCATG), and type D (c.863_864insCCTG), accounting for approximately 74%, 9%, and 7% respectively. In the NCCN guidelines, NPM1 Gene mutations are listed as molecular biological indicators of AML, and have important reference value in the diagnosis, classification, treatment, prognosis and monitoring of residual lesions of AML.

[0004] at present NPM1Methods for detecting gene mutations include first-generation sequencing, second-generation sequencing, qPCR, and digital PCR. While each of these technologies has its advantages in precision medicine, they also have limitations: first-generation sequencing struggles to detect samples with mutation abundance below 10% and lacks sufficient quantitative detection capability for insertion and deletion mutations; second-generation sequencing is currently the recognized gold standard, but its report time is approximately one week, and it relies on expensive sequencers and specialized personnel, resulting in high costs; while real-time quantitative PCR and droplet digital PCR can achieve rapid quantification, nucleic acid extraction is required before detection, and the associated equipment is expensive, hindering widespread adoption at the grassroots level. Previously, we researched and developed a one-pot insertion / deletion detection method based on CRISPR, utilizing an engineered AsCas12a protein variant to detect multiple mutations using a single crRNA. NPM1 The c.863_864 gene has a tetrabase insertion mutation, but this method can only perform qualitative detection and cannot achieve quantitative detection, which cannot fully meet the clinical needs for quantitative follow-up of AML patients and monitoring of residual lesions.

[0005] Therefore, there is an urgent need to develop a fast, accurate, and convenient method. NPM1 Quantitative detection methods for gene mutations, to achieve faster and more economical results. NPM1 Gene mutation detection, and can be used for diagnosed cases. NPM1 Quantitative detection and dynamic follow-up monitoring of mutated leukemia patients. Summary of the Invention

[0006] The purpose of this invention is to address the aforementioned shortcomings of the prior art by providing a method for... NPM1 A kit and detection method for quantitative detection of gene mutations, which can detect... NPM1 Multiple mutant subtypes of the c.863_864 gene with tetrabase insertion can be detected, and only 5 μl of whole blood from the patient is needed to achieve a detection limit as low as 1% within 40 minutes. Furthermore, no nucleic acid extraction is required; it can directly detect the gene in whole blood. NPM1 This method enables quantitative detection of gene mutations. It offers advantages such as ease of operation, rapid detection, high sensitivity, high specificity, and low cost.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: The first objective of this invention is to provide a method for NPM1 A kit for quantitative detection of gene mutations, the kit comprising amplification reagents and cleavage reaction reagents; The amplification reagents include those used for PCR amplification. NPM1 Primer pairs for the mutated gene, the NPM1 The mutation region of the gene is NPM1 A tetrabase insertion mutation between nucleotides 863 and 864 in the coding region of a gene. The shearing reaction reagent includes: The AsCpf1 mutant protein has the amino acid sequence shown in SEQ ID NO: 1; MT-crRNA, whose nucleotide sequence is shown in SEQ ID NO: 2, is used for specific targeting and recognition. NPM1 The sequence of gene mutation sites; IC-crRNA, whose nucleotide sequence is shown in SEQ ID NO:3, is used for targeting NPM1 Non-mutated conserved regions of genes are used as standard internal controls with an equal amount of 100% mutation. A single-stranded DNA fluorescent probe, wherein a fluorescent group is attached to the 5' end and a quenching group is attached to the 3' end of the single-stranded DNA, and the nucleotide sequence of the single-stranded DNA is 5-15 random bases.

[0008] Furthermore, the primer pair includes a forward primer with a sequence as shown in SEQ ID NO:4 and a reverse primer with a sequence as shown in SEQ ID NO:5.

[0009] Furthermore, the fluorescent group is one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE, and Texas Red, and the quenching group is one of TAMRA, DABCYL, MGB, BHQ-1, BHQ-2, and BHQ-3.

[0010] Furthermore, the working concentrations of both the forward primer and the reverse primer are 10 μM to 20 μM.

[0011] Furthermore, the working concentration of the MT-crRNA is 10 μmol to 50 μmol; the working concentration of the IC-crRNA is 10 μmol to 50 μmol; the working concentration of the AsCpf1 mutant protein is 5 ng / μL to 25 ng / μL; and the working concentration of the single-stranded DNA fluorescent probe is 10 pmol to 30 pmol.

[0012] Furthermore, the kit also includes a 100% mutation-positive control, which is used in... NPM1 The nucleic acid fragment TCTG containing the four-base insertion mutation is located between positions 863 and 864 of the gene coding region.

[0013] The second object of the present invention is to provide the aforementioned detection. NPM1 Application of gene mutation kits in the preparation of products for detecting leukemia.

[0014] A third objective of this invention is to provide a method for detecting [a specific substance] in a test sample using the aforementioned kit. NPM1The method for determining the tetrabase insertion mutation rate at the c.863_864 site of the gene includes the following steps: The sample to be tested is subjected to an RCR amplification reaction to obtain the amplification product; The amplification product was mixed with the cleavage reaction reagent and subjected to a CRISPR cleavage reaction. The fluorescence signal released by the single-stranded DNA fluorescent probe was collected. At the same time, a negative control was set up, which was a CRISPR cleavage reaction system in which nuclease-free water was used to replace crRNA. By selecting a predetermined time point at which the CRISPR cleavage reaction enters the linear rise phase, the intensity of the first fluorescence signal mediated by the MT-crRNA is obtained. The intensity of the second fluorescence signal mediated by the IC-crRNA and the intensity of the system substrate background fluorescence signal released by the negative control at the preset time point. ; The absolute mutation rate of gene A at this locus in the sample to be tested is calculated using the following formula: ; in, The value is a correction factor, ranging from 0.82 to 1.17, with an average value of 1.01.

[0015] Furthermore, the thermal cycling conditions for the RCR amplification include: During the pre-deformation stage, the temperature is 93℃~95℃, and the duration is 2min~5min; The cyclic phase consists of 28 to 32 cycles, each cycle including a denaturation temperature of 93°C to 95°C for 8 to 12 seconds; an annealing temperature of 58°C to 62°C for 15 to 22 seconds; and an extension temperature of 70°C to 74°C for 1 to 5 seconds. During the final extension stage, the temperature is 70℃~74℃ and the duration is 1min~3min.

[0016] Furthermore, the preset time point is selected from the 5th to the 15th minute after the start of the CRISPR shearing reaction.

[0017] Compared with the prior art, the beneficial effects of the technical solution provided by the present invention are as follows: (1) In actual clinical testing or liquid biopsy, due to the slight fluctuations in the degree of genomic degradation of the patient's ex vivo sample, the initial sample volume, and the enzyme activity in the reaction well, the absolute fluorescence intensity of the mutation channel is the only reliable indicator. This can easily lead to distorted quantitative results. This invention constructs a dual-channel detection system for specific MT-crRNA (SEQ ID NO:1) and internal quality control IC-crRNA (SEQ ID NO:2), by introducing a rate correction coefficient. k Background fluorescence signal compared to the crRNA-free water control system A quantitative mathematical model was established. Regardless of the variation in the amount of the original DNA template in the patient sample, the denominator term All values ​​can be converted in real-time and dynamically through internal quality control to "the full theoretical fluorescence value under the same 100% mutation state at this concentration". Through self-calibration of the ratio of numerator and denominator, quantitative deviations caused by sample loading errors and uneven template concentrations are completely eliminated. The unstable absolute fluorescence physical quantity is adaptively calibrated and normalized to the pure relative mutation ratio determined by the genotype, which greatly improves the absolute quantitative accuracy of ultra-low abundance trace frameshift insertion mutations and achieves truly high-precision absolute quantitative analysis.

[0018] (2) The present invention provides NPM1 Compared with other existing technologies, the mutation quantitative detection method has high subtype coverage and can detect multiple types in a single tube. NPM1 Mutant subtypes; low equipment requirements, only a simple temperature control device and fluorescence detector are needed; simple operation, requiring only 5 μL of the patient's whole blood; it can obtain accurate quantitative results directly, both qualitatively and directly; the reaction is rapid, with quantitative results obtained in about 40 minutes; it has high sensitivity and good specificity, achieving a sensitivity of 1% for common mutant subtypes. Furthermore, it does not require nucleic acid extraction and can directly detect mutations in whole blood. NPM1 Gene mutations can be quantitatively detected.

[0019] (3) The AsCpf1 mutant protein used in this invention has high activity and mismatch tolerance, as well as a unique and broad PAM motif recognition range (NNCV and TTTV preference), which is beneficial for solving problems similar to NPM1 The single-tube method for detecting multiple gene mutation subtypes presents challenges, but its wide range of applications is due to its broad PAM (Polymerase-Oriented Acid) coverage.

[0020] (4) The quantitative detection method provided by this invention has significant advantages in point-of-care testing applications, including cancer subtyping, efficacy evaluation, drug resistance mutation early warning, and dynamic follow-up monitoring. We firmly believe that this quantitative gene mutation detection method can serve as an important tool for rapidly and accurately quantifying cancer-related pathogenic gene mutations. Attached Figure Description

[0021] Figure 1 The quantitative detection flowchart provided by the present invention.

[0022] Figure 2To verify the linear relationship between the real-time fluorescence values ​​and mutation rate at different concentrations of DNA fragments, different concentrations of single-stranded DNA fluorescent reporter molecules, and different fluorescence values ​​at different times.

[0023] Figure 3 for NPM1 -IC-crRNA screening results diagram.

[0024] Figure 4 The K value was calculated to detect DNA fragments with different concentrations and 100% mutation rates. Figure AE shows the results of setting gradient DNA loading amounts (10 ng, 25 ng, 50 ng, 100 ng, 200 ng), different detection time points (5 min, 10 min), and halved FAM-ssDNA-BHQ1 reporter probe concentrations (12.5 pmol, 25 pmol).

[0025] Figure 5a To conduct quantitative detection on a series of DNA samples with gradient mutation rates (10%, 30%, 50%, 70%, 90%, 100%).

[0026] Figure 5b To conduct quantitative detection on a series of DNA samples with gradient mutation rates (1%, 3%, 5%, 7%, 9%).

[0027] Figure 6 To obtain fresh whole blood samples from 8 different patients, 100% homozygous mutant DNA fragments were added. After direct amplification PCR in whole blood, the supernatant was collected by centrifugation, and the correction coefficient was determined. k The experimental results of the value.

[0028] Figure 7 To select four whole blood samples with different white blood cell counts, a direct amplification PCR experiment was conducted, and the results were analyzed at different amplification cycle numbers.

[0029] Figure 8 This study describes the detection of PCR products with different loading volumes.

[0030] Figure 9a shows the results obtained by using DNA fragments with mutation rates ranging from 10% to 90% at a rate of 0.1 ng as PCR templates.

[0031] Figure 9b shows the results obtained by using DNA fragments with mutation rates ranging from 0.5% to 9% at a rate of 0.1 ng as PCR templates.

[0032] Figure 10 To utilize the present invention NPM1 The results of gene mutation quantitative detection kit analysis on 10 AML patient samples were compared with those of NGS and ddPCR detection. In the figure, AE represents... NPM1 Quantitative detection results of bone marrow genomic DNA mutation rate in mutation-positive clinical AML patients; FJ is NPM1 Quantitative detection results of bone marrow genomic DNA mutation rate in mutation-negative clinical AML patients; K represents the WT detection result; L represents the comparison of three detection results with three WT detection results for patient B in the figure (p = 0.0095); M represents the comparison of detection results of 5 positive patients with NGS and ddPCR results. P<0.05, P<0.005; P < 0.0005, ns, no statistical significance, t-test.

[0033] Figure 11 The results represent positive findings from a general screening of 100 clinical samples. Figure A shows the detection flowchart: 5 μL of patient blood was collected for high-efficiency direct amplification PCR, followed by quantitative detection; positive samples were purified for nucleic acid and then subjected to TA cloning, with 30–50 single-clone colonies randomly selected for subsequent Sanger sequencing verification. Figure B shows the Sanger sequencing results, indicating three genotypes detected in the c.863_864 fragment: wild-type (WT), mutant type 1 (c.863_864insTCTG), and mutant type 2 (c.863_864insCCTG). Figure CH shows the results of this method and the control method used on 6 cases. NPM1 Results of quantitative detection in mutation-positive patient samples; Figure I shows the detection results of wild-type samples; Figure J compares the correlation between the quantitative results of the two detection methods (p=0.9947); Notes: p < 0.05 p < 0.005 p < 0.0005; ns: no statistical significance; t-test was used for statistical analysis.

[0034] Figure 12a , Figure 12b and Figure 12c The results were negative in a general screening of 100 clinical samples.

[0035] Figure 13Figure A shows the linear correlation between fluorescence intensity and mutation rate in the Cas12a reaction over a wide detection range when using MT-crRNA; Figure A is the fluorescence signal of Cas12a in vitro enzyme digestion detection of 10 ng of DNA fragments with different mutation rates using TCTG-cr; the negative control group (NC) used nuclease-free water instead of crRNA; Figure B is the linear correlation fitting curve between fluorescence intensity and mutation rate at 5 min in Figure A. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the specific embodiments and accompanying drawings are described in further detail below. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0037] Definitions and explanations of terms in this invention: In this invention NPM1 The c.863_864 frameshift four-base insertion mutation refers to a gene variation state in which four consecutive arbitrary bases (such as insNNNN) are introduced or added out of nowhere between the 863rd and 864th nucleotides counting from the start codon in the coding region of the NPM1 gene, thereby changing the reading frame of all triplet codons downstream of that site.

[0038] In this invention, the CRISPR trans-cleavage reaction refers to the activation of a non-specific endonuclease activity in the Cas12a protein's spatial conformation after MT-crRNA or IC-crRNA guides the Cas12a protein to recognize and specifically bind to the target DNA, forming a ternary complex (R-loop). This activity then initiates the rapid degradation of free single-stranded DNA fluorescent probes in the system. In this invention, the Cas12a protein is designated as the AsCpf1 mutant protein, and its amino acid sequence is shown in SEQ ID NO: 1.

[0039] In this invention, MT-crRNA, which refers to MT-crRNA that detects the c.863_864 tetrabase insertion mutation in the NPM1 gene, is denoted as TCTG-cr, i.e., the TCTG mutation in the NPM1 gene, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0040] All blood samples used in this invention were collected at the Department of Hematology, Zhongnan Hospital of Wuhan University, and have been approved by the Institutional Review Board. All patients signed informed consent forms before donating samples, meeting ethical standards. Each participant received nutritional supplements as compensation for participation.

[0041] The patient samples used in this invention were 112 blood samples and 10 bone marrow genomic DNA samples collected from patients in the Department of Hematology, Zhongnan Hospital of Wuhan University. The bone marrow genomic DNA from these patients was extracted using a genomic DNA extraction kit (Tiangen Biotech, Beijing, China).

[0042] Regarding the preparation of DNA fragments and plasmids in this invention: NPM1 Using genomic DNA from mutation-positive patients as templates, PCR amplification was performed using primers P1 and P2 (Table 1), yielding... NPM1 Wild-type (WT), c.863_864insTCTG, c.863_864insCATG, c.863_864insCCTG, and c.863_864insCCAG mutant DNA fragments were collected. Recombinant plasmids carrying these fragments were constructed using the Hieff Clone® Zero TOPO-TA cloning kit from Shanghai Yisheng Biotechnology Co., Ltd. via TA cloning technology. Homozygous mutant DNA fragments were then amplified by PCR using the recombinant plasmids as templates.

[0043] Table 1. PCR primer sequences

[0044] The expression and purification of the Cas12a protein in this invention involves transforming a plasmid containing the Cas12a gene into BL21(DE3) competent cells. Single colonies are screened and cultured with shaking in LB medium at 37°C for 14-16 hours. The culture is then inoculated into 1 liter of LB medium for amplification until OD (Organic Demand). 600 The concentration was increased to 0.6-0.8. 1 mM IPTG was added, and protein expression was induced at 16℃ for 18 hours. Cells were collected by centrifugation, and bacterial cells were collected by centrifugation. Cas12a protein was extracted from the bacterial cells using a Nanjing GenScript nickel ion magnetic bead purification kit according to the product instructions. Protein purity was identified by SDS-PAGE electrophoresis combined with Coomassie brilliant blue staining; protein concentration was determined using a Thermo Fisher Scientific BCA protein quantification kit. The amino acid sequence of the Cas12a protein (AsCpf1 mutant protein) in this invention is shown in SEQ ID NO: 1.

[0045] The whole blood direct amplification PCR process in this invention is as follows: The whole blood direct amplification PCR reaction was performed using the high-efficiency direct amplification PCR kit from Shanghai Yisheng Biotechnology Co., Ltd. The 50 μL PCR reaction system consisted of: 25 μL 2× Hieff Blood Advanced PCR buffer, 10 μM each of forward and reverse primers, 1 μL Hieff Advanced High-Fidelity DNA Polymerase Mix, 5 μL whole blood sample, with the remaining volume made up with nuclease-free water. The thermal cycling program was set as follows: 94℃ pre-denaturation for 3 min; followed by 30 amplification cycles: 94℃ denaturation for 10 s, 60℃ annealing for 15 s, and 72℃ extension for 2 s; a final extension at 72℃ for 1 min after the last cycle. After amplification, the PCR reaction tube was briefly centrifuged, and the supernatant was used for subsequent CRISPR / Cas12a in vitro enzyme digestion detection.

[0046] The in vitro cleavage process of CRISPR / Cas12a in this invention: The Cas12a-mediated quantitative detection experiment was performed in a 20 μL reaction system containing 200 ng AsCpf1 mutant protein, 10 μmol MT-crRNA or 10 μmol IC-crRNA, 2 μL 10× Cutone buffer, 12.5 pmol FAM-ssDNA (TTTATTT)-BHQ1 fluorescent reporter probe (Suzhou Jinsheng Biotechnology Co., Ltd.), the substrate to be tested, and nuclease-free water. After incubation at 37°C, the cleavage results were observed by fluorescence under 485 nm blue light (Shanghai Sangon Biotech Co., Ltd.). The system was incubated at 37°C, and the fluorescence kinetic signal was acquired in real time using a portable fluorescence detector (Suzhou Gedian Biotechnology Co., Ltd.), with an excitation wavelength of 485 nm and an emission wavelength of 520 nm. For quantitative detection, equal volumes of PCR supernatant were aliquoted into two reaction tubes, and MT-crRNA and IC-crRNA were added to each tube for simultaneous detection. After incubation at 37℃ for 5 min, fluorescence values ​​were read, and the mutation rate was calculated using the following formula. The target-specific crRNA was designed based on the target sequence and synthesized by Nanjing GenScript Biotech Co., Ltd.

[0047] The nucleotide sequence of MT-crRNA is shown in SEQ ID NO: 2. UAAUUUCUACUAAGUGUAGAUUCCACUGCCAGACAGAGAUCU; The nucleotide sequence of IC-crRNA is shown in SEQ ID NO:3. UAAUUUCUACUAAGUGUAGAUUGUAACAGUUGAUAUCUGGCU.

[0048] The AsCpf1 mutant protein used in this invention can be found in the following reference: Yin Liu, Xinyi Liu, et al. CoHIT: One-pot ultrasensitive ERA-CRISPR system for simultaneous detection of multiple cancer gene variants[J]. Nature Communications, 2024. refer to Figure 1 The present invention provides for NPM1 The flowchart illustrates a method for quantitative detection of gene mutations. Only 5 μL of peripheral whole blood is collected from the patient and directly added to an advanced blood-based direct PCR system for PCR reaction. After amplification, the mixture is centrifuged, and 0.6 μL of the supernatant is transferred to the quantitative detection system. Subsequently, a portable fluorescence detector is used to record the real-time fluorescence signal at a constant temperature of 37°C, and the mutation rate of each sample is determined accordingly (e.g., mutation rate of 5 μL). Figure 1 The Cas12a / crRNA complex recognizes multiple insertion mutations, triggering its cleavage activity on single-stranded DNA and generating a green fluorescent signal. Due to the significant sequence differences between wild-type DNA and the crRNA target site, wild-type DNA cannot induce a fluorescent signal, thus ensuring the high specificity of this detection method. PCR products from clinical samples may vary. For a given amount of amplified DNA from a mutation-positive patient, if the fluorescence value of an equal amount of 100% mutant DNA is known, the actual mutation rate can be deduced from the observed fluorescence intensity.

[0049] ; in, The correction coefficient, which can be experimentally determined, is numerically stable, correlates only with the mutation type, and is minimally affected by the total amount of amplified products. Therefore, this method does not require nucleic acid purification or precise control of DNA loading. This was calculated experimentally. The values ​​ranged from 0.82 to 1.17, with an average of 1.01. IC-crRNA targets conserved sequences near mutation sites; the coefficients were used to determine the target sequence. k After calibration, the fluorescence intensity of the internal reference detection tube with the same substrate dosage can be equivalent to the fluorescence signal of a homozygous mutation.

[0050] The quantitative detection method provided by this invention requires only 5 μL of patient blood, eliminates the need for nucleic acid extraction, and achieves a detection limit as low as 1% within approximately 40 minutes. It boasts advantages such as ease of operation, rapid detection, high sensitivity, high specificity, and low cost. By simply replacing the primers and crRNA, this strategy can be used to quantify various cancer-related gene mutations, demonstrating broad clinical application potential.

[0051] Example 1 For NPM1 Development of methods for quantitative detection of gene mutations.

[0052] The core principle of this method is that when using MT-crRNA, the fluorescence intensity of the Cas12a reaction is linearly correlated with the mutation rate over a relatively wide detection range. To verify this relationship, this study selected the most common mutations in patients with acute myeloid leukemia (AML). NPM1 The c.863_864insTCTG gene mutation was used as a research model for validation experiments. First, a synthetic... NPM1 The mutant DNA fragments were tested. First, wild-type (WT) and mutant (MT) DNA fragments were mixed in different proportions to prepare gradient mutation rate simulation samples: pure wild-type (0%), 20%, 40%, 60%, 80%, and 100%. 10 ng of the above mixed DNA was used for Cas12a in vitro enzyme digestion fluorescence detection using NPM1-insTCTG-specific crRNA (abbreviated TCTG-cr). The negative control group (NC) used nuclease-free water instead of crRNA. Results showed that real-time fluorescence intensity increased with increasing mutation rate, and the signal differences among groups were significant after 5 min of incubation. Fluorescence readings were collected for 5 min and a curve was fitted, confirming a strong linear correlation between fluorescence intensity (Y) and mutation rate (X) (fitting equation: Y = 40.26X + 828.3, correlation coefficient R). 2 =0.9971, such as Figure 13 The ordinate intercept of 828.3 was basically consistent with the fluorescence value of the negative control group. Furthermore, through three parallel experiments using gradient DNA loading amounts (10 ng, 25 ng, 50 ng, 100 ng, 200 ng), fluorescence data at different time points, and a halved concentration of the reporter probe FAM-ssDNA-BHQ1, the stability and reliability of this linear relationship were further confirmed. Figure 2 From this, we can derive the following relation: (Y) x% -Y NC ) / (Y 100% -Y NC The formula is: ) = X / 100. This formula indicates that if the fluorescence intensity of a homozygous mutant substrate with the same DNA load can be obtained, the mutation rate of the sample to be tested can be calculated. However, in actual testing, it is difficult to obtain a homozygous mutant reference sample that perfectly matches the reaction conditions, making direct substitution into the calculation difficult. Therefore, IC-crRNA is introduced to establish an alternative correction scheme to solve this problem.

[0053] 1.1 NPM1 Design and screening of IC-crRNA NPM1-IC-crRNA was selected from 18 crRNAs (as shown in Table 2) designed based on the PAM characteristics of the AsCpf1 mutant protein. Equal amounts of 100% homozygous mutant DNA were analyzed and compared with the fluorescence signal of TCTG-cr. The results showed that the fluorescence intensity of IC-cr16 group was closest to that of TCTG-cr. Figure 3 ).

[0054] Table 2. crRNA sequences.

[0055]

[0056] 1.2 k Determining the value Based on this, a coefficient correction formula is constructed: F (TCTG-cr) – F NC = k (F (IC-cr16) - F NC The correction factor was determined using gradient homozygous mutant DNA samples (10 ng, 25 ng, 50 ng, 100 ng, 200 ng). k The results confirmed k The effect of DNA loading amount is minimal, and it remains stable in the range of 0.82~1.17. Figure 4 Considering the existence of minor systematic errors in actual clinical testing, k The value range was set at 0.82–1.17, with a mean of 1.01, to enhance the clinical reference value of this method. The final mutation rate calculation formula is as follows: ; The intensity of the first fluorescence signal mediated by MT-crRNA, The intensity of the second fluorescence signal mediated by IC-crRNA, The background fluorescence signal intensity of the negative control substrate was determined by replacing crRNA with nuclease-free water.

[0057] 1.3 Effect of direct detection of NPM1 mutant DNA substrate Subsequently, we used a quantitative detection system to detect... NPM1 The most common mutation in the gene c.863_864, involving a tetrabase insertion, is found in the DNA fragment (c.863_864insTCTG). The results are as follows... Figure 5a and Figure 5b As shown, the detected mutation rate is basically consistent with the actual mutation rate, and the detection limit is 1%.

[0058] 1.4 Establishment and optimization of the quantitative detection reaction procedure In order to develop a simple and fast NPM1 The mutation quantification detection kit combines a fluorescent reporter system based on the AsCpf1 mutant protein with direct amplification PCR technology using whole blood. This is to verify the effectiveness of adding patient serum... k The value will not change. In this invention, when quantitatively detecting 100% TCTG mutant amplified DNA fragment supernatant, serum from 8 randomly selected clinical patients was added. Figure 6 As shown, the results indicate that k The values ​​are still fluctuating within the range obtained previously. Basic information on the 8 patients is shown in Table 3.

[0059] Table 3 Patient Information from Peripheral Blood Samples

[0060] Whole blood direct amplification PCR reagent was purchased from YEASEN, Shanghai, China. The PCR reaction mixture (50 μL) contained the following components: 2X Hieff Blood Advanced PCR buffer 25 μL, 10 μM forward primer, 10 μM reverse primer, Hieff Advanced High-Fidelity DNA Polymerase Mix 1 μL, 5 μL whole blood sample or an appropriate amount of target DNA fragment, and nuclease-free water. The thermal cycling conditions were as follows: pre-denaturation at 94°C for 3 minutes, followed by 30 cycles (denaturation at 94°C for 10 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 2 seconds), and a final extension at 72°C for 1 minute. The 30 cycles represent the optimal number of amplification cycles determined using samples from patients with different white blood cell counts (e.g.,...). Figure 7 (As shown).

[0061] To determine the optimal loading volume, this study used PCR products from 30 cycles to set up multiple groups with different loading volumes for detection. The results showed that the fluorescence intensity initially increased and then decreased with increasing loading volume, reaching a peak at 0.6 μL, suggesting that excessive blood components may inhibit the Cas12a enzymatic reaction (e.g., Figure 8 (As shown).

[0062] The optimized quantitative detection method was used to detect the quantification effect of the NPM1 mutant DNA substrate after direct amplification PCR in whole blood. Figure 9a and Figure 9b As shown, no nucleic acid extraction is required, and the mutation rate of the target gene can be obtained in about 40 minutes. The detection limit is 1%, which has the advantages of being more convenient, faster, more sensitive, more specific and lower in cost.

[0063] Example 2 The results of testing 10 AML patient samples using the kit of this invention were compared with those of NGS and ddPCR.

[0064] To demonstrate the clinical feasibility of the method of this invention, bone marrow genomic DNA was collected from 10 AML patients at the Department of Hematology, Zhongnan Hospital of Wuhan University. Using 10-100 ng of genomic DNA as the detection sample, the optimized quantitative detection procedure described above was used for detection, and fluorescence values ​​were read in real time on a isothermal fluorescence detector. The results are as follows: Figure 10 As shown, the method of the present invention can accurately distinguish between wild-type and mutant samples, and the results are consistent with, or even better than, those of dd PCR detection and next-generation sequencing.

[0065] Example 3 To evaluate the clinical application value of this quantitative detection method, this study collected whole blood samples from 100 patients with acute myeloid leukemia (AML) (including newly diagnosed and relapsed patients) at the Department of Hematology, Zhongnan Hospital of Wuhan University. 5 μL of patient blood was collected for high-performance direct amplification PCR, followed by quantitative detection. Positive samples were purified for TA cloning, and 30–50 single colonies were randomly selected for Sanger sequencing verification. Figure 11 (A in the middle).

[0066] Of the 100 samples tested, 6 were NPM1 mutation-positive. The low positive rate may be due to the relatively high proportion of patients undergoing follow-up examinations. Sanger sequencing results showed that three genotypes were detected in the c.863_864 fragment: wild-type (WT), mutation type 1 (c.863_864insTCTG), and mutation type 2 (c.863_864insCCTG). Figure 11 (B in the middle).

[0067] The mutation abundances in the 6 NPM1 mutation-positive patients were as follows: C in Figure 11 (TCTG insertion mutation, 10.4%), D in Figure 11 (CCTG insertion mutation, 46.1%), E in Figure 11 (TCTG insertion mutation, 35.2%), F in Figure 11 (TCTG insertion mutation, 28.4%), G in Figure 11 (TCTG insertion mutation, 12.4%), and H in Figure 11 (TCTG insertion mutation, 3.4%). Each patient's sample was tested at least three times. I in Figure 11 represents the results of the wild-type sample. Figure 11 J in the figure represents the comparison between the quantitative results of this method and the control detection method; there was no statistically significant difference between the two (p=0.9947). The detection results for other mutation-negative patient samples are shown below. Figures 12a-12cThe above results further confirm that this quantitative detection method possesses good accuracy and precision. It is worth noting that this method can simultaneously detect multiple... NPM1 It can identify mutant subtypes and accurately identify low-abundance mutations with a mutation abundance of less than 5%.

[0068] In summary, the detection method provided by this invention can identify... NPM1 This method detects several common 4-base insertion mutations at the c.863_864 site of the gene. No nucleic acid extraction is required; only 5 μL of patient blood sample is needed to achieve a low LoD (LoD) of as low as 1% within approximately 40 minutes, without interference from cross-signaling of wild-type sequences. Validation in 10 clinical bone marrow genomic DNA samples showed that the quantitative results were consistent with those of NGS and ddPCR, while offering advantages such as simpler operation, faster speed, higher sensitivity, stronger specificity, and lower cost. Further testing on human blood samples validated the effectiveness of this quantitative detection method in patients with acute myeloid leukemia (AML). NPM1 Reliability and practicality in mutation detection.

[0069] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for NPM1 A kit for quantitative detection of gene mutations, characterized in that, The kit includes amplification reagents and shearing reaction reagents; The amplification reagents include those used for PCR amplification. NPM1 Primer pairs for the mutated gene, the NPM1 The mutation region of the gene is NPM1 A tetrabase insertion mutation between nucleotides 863 and 864 in the coding region of a gene. The shearing reaction reagent includes: The AsCpf1 mutant protein has the amino acid sequence shown in SEQ ID NO: 1; MT-crRNA, whose nucleotide sequence is shown in SEQ ID NO: 2, is used for specific targeting and recognition. NPM1 The sequence of gene mutation sites; IC-crRNA, whose nucleotide sequence is shown in SEQ ID NO:3, is used to target the non-mutated conserved region of the NPM1 gene as a standard internal control with an equal amount of 100% mutation; A single-stranded DNA fluorescent probe, wherein a fluorescent group is attached to the 5' end and a quenching group is attached to the 3' end of the single-stranded DNA, and the nucleotide sequence of the single-stranded DNA is 5-15 random bases.

2. The reagent kit according to claim 1, characterized in that, The primer pair includes a forward primer with the sequence shown in SEQ ID NO:4 and a reverse primer with the sequence shown in SEQ ID NO:

5.

3. The reagent kit according to claim 1, characterized in that, The fluorescent group is one of FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE and Texas Red, and the quenching group is one of TAMRA, DABCYL, MGB, BHQ-1, BHQ-2 and BHQ-3.

4. The kit according to any one of claims 2-3, characterized in that, The working concentrations of both the forward and reverse primers are 10 μM to 20 μM.

5. The reagent kit according to any one of claims 1-3, characterized in that, The final concentration of the MT-crRNA is 10 μmol to 50 μmol; the final concentration of the IC-crRNA is 10 μmol to 50 μmol; the final concentration of the AsCpf1 mutant protein is 5 ng / μL to 25 ng / μL; and the final concentration of the single-stranded DNA fluorescent probe is 10 pmol to 30 pmol.

6. The reagent kit according to any one of claims 1-3, characterized in that, The kit also includes a 100% mutation-positive control, which is used in... NPM1 The nucleic acid fragment TCTG containing the four-base insertion mutation is located between positions 863 and 864 of the gene coding region.

7. The use of the kit for detecting NPM1 gene mutations according to any one of claims 1-6 in the preparation of products for detecting leukemia.

8. A method for detecting the tetrabase insertion mutation rate at the c.863-864 site of the NPM1 gene in a test sample using the kit described in any one of claims 1-6, characterized in that, Includes the following steps: The sample to be tested is subjected to RCR amplification reaction to obtain amplification products; The amplification product was mixed with the cleavage reaction reagent and subjected to a CRISPR cleavage reaction. The fluorescence signal released by the single-stranded DNA fluorescent probe was collected. At the same time, a negative control was set up, which was a CRISPR cleavage reaction system in which nuclease-free water was used to replace crRNA. By selecting a predetermined time point at which the CRISPR cleavage reaction enters the linear rise phase, the intensity of the first fluorescence signal mediated by the MT-crRNA was obtained. The intensity of the second fluorescence signal mediated by the IC-crRNA and the intensity of the system substrate background fluorescence signal released by the negative control at the preset time point. ; The absolute mutation rate of the NPM1 gene at this site in the sample to be tested was calculated using the following formula: ； in, The value is a correction factor, ranging from 0.82 to 1.17, with an average value of 1.

01.

9. The method according to claim 8, characterized in that, The thermal cycling conditions for RCR amplification include: During the pre-deformation stage, the temperature is 93℃~95℃, and the duration is 2min~5min; During the cyclic phase, 28 to 32 cycles are performed. Each cycle includes a denaturation temperature of 93°C to 95°C for 8 to 12 seconds; an annealing temperature of 58°C to 62°C for 15 to 22 seconds; and an extension temperature of 70°C to 74°C for 1 to 5 minutes. During the final extension stage, the temperature is 70℃~74℃ and the duration is 1min~3min.

10. The method according to claim 8, characterized in that, The preset time point is selected from 5 minutes to 15 minutes after the start of the CRISPR shearing reaction.

Images