Use of ZFP36 in preparation of small cell lung cancer metastasis risk assessment product and therapeutic drug

CN122811372APending Publication Date: 2026-09-25YUNNAN CANCER HOSPITAL (THE THIRD AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611310157.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-27
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

现有技术也未检索到 ZFP36与小细胞肺癌的关联的研究

Benefits of technology

本发明首次通过单细胞RNA测序发现ZFP36在小细胞肺癌肝转移灶肿瘤细胞中的表达较原发灶显著降低,且在多例患者中具有一致性。ZFP36低表达促进小细胞肺癌细胞增殖、DNA合成、克隆形成、迁移、侵袭,加速细胞周期进程、远处转移,而恢复ZFP36表达可显著抑制上述恶性表型。体内皮下成瘤实验显示,敲低ZFP36显著加速肿瘤生长;免疫组化结果显示,敲低ZFP36后肿瘤组织中Ki67增殖指数显著升高,E-cadherin表达降低,N-cadherin表达升高,表明ZFP36缺失促进肿瘤细胞增殖并诱导上皮-间充质转化。体内尾静脉转移模型显示,敲低ZFP36显著增加肝转移灶数量、提高转移信号强度,并缩短荷瘤小鼠总生存期,说明ZFP36具有抑制小细胞肺癌远处转移的作用。本发明为小细胞肺癌抗生长和转移治疗提供了新的思路,具有重要的临床应用价值和经济价值。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811372A_ABST
    Figure CN122811372A_ABST
Patent Text Reader

Abstract

The application discloses application of ZFP36 in preparation of small cell lung cancer metastasis risk assessment products and therapeutic drugs, and belongs to the field of biological medicine. Experiments prove that the expression of ZFP36 in tumor cells of a liver metastasis focus of small cell lung cancer is significantly lower than that in a primary focus, and the expression level is related to the prognosis of a patient. Overexpression of ZFP36 significantly inhibits the proliferation, DNA synthesis, clone formation, migration and invasion ability of small cell lung cancer cells, and induces G0 / G1 phase arrest of the cell cycle; and knockdown of ZFP36 promotes the above-mentioned malignant phenotypes. Knockdown of ZFP36 significantly enhances the subcutaneous tumorigenicity of small cell lung cancer cells and accelerates tumor growth; and knockdown of ZFP36 significantly increases liver metastasis load and shortens the overall survival of tumor-bearing mice. Therefore, ZFP36 can be used for preparing reagents for small cell lung cancer metastasis risk assessment and prognosis judgment, can be used as a therapeutic target for developing drugs for inhibiting the growth and metastasis of small cell lung cancer, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of ZFP36 in the preparation of small cell lung cancer metastasis risk assessment products and therapeutic drugs. Background Technology

[0002] Small cell lung cancer (SCLC) is a highly aggressive neuroendocrine tumor of the lung, accounting for approximately 15% of all lung cancers. SCLC is characterized by high heterogeneity, rapid growth, early metastasis, and refractory nature, making it one of the most malignant subtypes of lung cancer. About 70% of SCLC patients have distant metastases at initial diagnosis, rendering them ineligible for surgery. The liver is the organ with the highest rate of metastasis in SCLC, accounting for 40%. The prognosis of SCLC patients is closely related to the metastatic status; patients with distant metastases have a poor prognosis, with a median survival of less than one year even with systemic therapy, and a 2-year relative survival rate of only about 7%–8%.

[0003] For patients with extensive-stage SCLC, EP regimen chemotherapy combined with immune checkpoint inhibitors (such as atezolizumab, durvalumab, and slulimab) has become the first-line treatment. However, the survival benefit of immunotherapy combined with chemotherapy remains limited, with many patients developing resistance and rapidly progressing within months of first-line treatment, resulting in limited second-line and subsequent-line treatment options. Therefore, there is an urgent need to conduct in-depth molecular research on the growth and metastasis mechanisms of SCLC, and to identify new diagnostic biomarkers and therapeutic targets to improve patient prognosis.

[0004] Currently, research on the molecular mechanisms related to the transition of SCLC from the limited stage to the extensive stage, especially the occurrence of liver metastasis, is still insufficient, and there is a lack of effective early diagnostic biomarkers and specific therapeutic targets that can reflect the metastatic process.

[0005] The inventors performed single-cell RNA sequencing analysis on 5 pairs of SCLC primary lesion-liver metastasis samples and found that the expression of ZFP36 in the tumor cells of SCLC liver metastases was significantly lower than that in the primary lesion, and this expression change was consistent in ≥4 patients, suggesting that the downregulation of ZFP36 expression may be a key molecular event in the development of liver metastasis in small cell lung cancer.

[0006] Zinc finger protein 36 (ZFP36), also known as tristetraprolin (TP), is an RNA-binding protein containing a C3H1-type zinc finger domain. It primarily regulates gene expression at the posttranscriptional level by recognizing and binding to AU-rich elements (AREs) in the 3'-UTR of mRNA, promoting the degradation of target mRNA. Previous studies have shown that abnormal expression or function of ZFP36 can affect multiple tumor-related signaling pathways and is associated with malignant phenotypes such as cell proliferation, cell cycle regulation, anti-apoptosis, angiogenesis, EMT, invasion and metastasis, and metabolic reprogramming. ZFP36 plays different roles in different tumors: it has anti-cancer effects in various tumors such as prostate cancer, gastric cancer, breast cancer, colon cancer, malignant melanoma, hepatocellular carcinoma and glioma. Its downregulation is closely related to accelerated tumor cell proliferation, promoted angiogenesis, disordered cellular energy metabolism and poor prognosis. It is applicable to most epithelial solid tumors, but there are no related studies for small cell neuroendocrine carcinoma.

[0007] Although some studies have reported that ZFP36 affects the proliferation of NSCLC tumor cells, with overexpression of ZFP36 significantly inhibiting NSCLC migration and invasion, and knockdown leading to a significant increase in metastatic ability; and patients with low ZFP36 expression having higher lymph node metastasis rates and shorter progression-free survival, these studies only focused on NSCLC. NSCLC and SCLC are two completely different lung tumors with many fundamental differences: in terms of genetic background, NSCLC is more commonly associated with KRAS and EGFR driver mutations, while SCLC is typically characterized by RB1 and TP53 gene inactivation; in terms of pathological classification, SCLC is a high-grade pulmonary neuroendocrine tumor, while NSCLC is a non-neuroendocrine tumor such as adenocarcinoma and squamous cell carcinoma; in terms of biological characteristics, SCLC grows rapidly, metastasizes early, and is more aggressive; and in terms of clinical treatment, the two have completely different protocols and no common treatment logic, and existing literature makes no indication that this gene can regulate the invasion of neuroendocrine tumors. NSCLC often involves local lymph node metastasis, with distant metastasis occurring late. At diagnosis, over 70% of SCLC cases are already in the extensive stage, making early hematogenous metastasis to the brain and adrenal glands highly likely. The metastasis driving mechanisms and clinical stratification criteria (limited-stage / extensive-stage) differ from those of NSCLC, and NSCLC biomarkers cannot be directly applied. Neuroendocrine tumors have specific zinc finger protein biomarkers such as ZNF367 and ASCL1. Routine SCLC biomarker screening prioritizes neuroendocrine-related zinc finger families.

[0008] Although ZFP36 and ZFP36L1 both belong to the ZFP36 / TIS11 family of RNA-binding proteins, they are not interchangeable functional molecules. ZFP36L1, also known as TIS11B or BRF1, has been reported to participate in the maintenance of neuroendocrine differentiation phenotypes in small cell lung cancer by regulating the stability of SOX2 and INSM1 mRNA. However, ZFP36 and ZFP36L1 differ in their N- and C-terminal sequences, protein regulatory regions, and potential interacting proteins, and their target mRNA profiles and downstream biological effects are cell type and tumor background dependent. Existing reports on ZFP36L1 in small cell lung cancer mainly focus on the regulation of neuroendocrine differentiation or lineage status, i.e., the maintenance of tumor cell differentiation phenotypes and lineage identity. The technical problem addressed by this invention is the regulation of solid tumor growth, cell proliferation, migration, invasion, and distant metastasis in small cell lung cancer, especially liver metastasis. There is no necessary correspondence between neuroendocrine differentiation status and the proliferation, invasion, and distant metastasis capabilities of tumor cells; they belong to different levels of tumor biological characteristics. No studies linking ZFP36 to small cell lung cancer have been found using existing technologies. Summary of the Invention

[0009] To address the shortcomings of existing technologies, this invention relates to the application of ZFP36 in the preparation of small cell lung cancer metastasis risk assessment products and therapeutic drugs. The specific technical solution is as follows: This invention protects the use of ZFP36 in the preparation of diagnostic reagents for assessing the risk of metastasis in small cell lung cancer and / or determining patient prognosis.

[0010] Furthermore, the detection reagent is used to detect the expression level of ZFP36 in biological samples.

[0011] Furthermore, the reagent for detecting ZFP36 expression level is a reagent for detecting ZFP36 protein expression level and / or a reagent for detecting ZFP36 mRNA expression level.

[0012] Furthermore, the detection reagent is used to detect primary or metastatic small cell lung cancer tumor tissue. The expression level of ZFP36 is used to determine the risk of tumor metastasis in small cell lung cancer and to assess the survival time of patients. Specifically, low ZFP36 expression indicates an increased risk of metastasis and a poor prognosis, while high ZFP36 expression indicates a decreased risk of metastasis and a longer survival time.

[0013] This invention also protects a detection kit for assessing the risk of metastasis and / or predicting the prognosis of small cell lung cancer, the kit comprising at least one of the following active components: amplification primers that specifically recognize the ZFP36 gene, an antibody that specifically binds to the ZFP36 protein, a ZFP36 overexpression vector, a viral vector carrying the ZFP36 coding sequence, ZFP36 mRNA, recombinant ZFP36 protein, a nucleic acid molecule that promotes the expression of endogenous ZFP36, and a small molecule compound that promotes the expression of endogenous ZFP36.

[0014] This invention also protects the use of substances that upregulate ZFP36 expression and / or enhance ZFP36 protein function in the preparation of pharmaceuticals for the prevention and / or treatment of small cell lung cancer; and / or inhibition of small cell lung cancer cell proliferation, colony formation, migration, invasion and distant metastasis.

[0015] Furthermore, the substance that upregulates ZFP36 expression and enhances ZFP36 protein function inhibits AKT protein phosphorylation and downregulates the activation of the PI3K-AKT signaling pathway, thereby arresting the G0 / G1 cell cycle of small cell lung cancer cells and inhibiting the malignant biological behavior of the tumor; and the total AKT protein expression level of the cells did not change significantly after the treatment.

[0016] This invention also protects the application of inhibitors that inhibit ZFP36 expression and / or block ZFP36 protein function in constructing models, such as highly metastatic small cell lung cancer cell models or tumor-bearing animal models; knocking down or inhibiting ZFP36 can enhance the proliferation, migration, invasion and distant liver metastasis of small cell lung cancer cells in vivo, accelerate the growth of subcutaneous tumors in nude mice, and shorten the survival time of tumor-bearing mice.

[0017] The present invention also protects a pharmaceutical composition for treating small cell lung cancer and inhibiting tumor proliferation and distant metastasis, wherein the active ingredient of the pharmaceutical composition is a substance capable of upregulating intracellular ZFP36 expression and / or enhancing ZFP36 protein activity; the pharmaceutical composition exerts its anti-tumor effect by reducing intracellular p-AKT protein levels and inhibiting PI3K-AKT signaling pathway activation.

[0018] Furthermore, the dosage form of the pharmaceutical composition is any one of an injection, an oral formulation, or a topical formulation. Compared with the prior art, the present invention has the following beneficial effects: This invention is the first to discover, through single-cell RNA sequencing, that ZFP36 expression in liver metastases of small cell lung cancer (SCLC) was significantly lower than in the primary tumor, and this was consistent across multiple patients. Low ZFP36 expression promotes SCLC cell proliferation, DNA synthesis, colony formation, migration, and invasion, accelerates cell cycle progression, and promotes distant metastasis, while restoring ZFP36 expression significantly inhibits these malignant phenotypes. In vivo subcutaneous tumorigenesis experiments showed that ZFP36 knockdown significantly accelerated tumor growth; immunohistochemical results showed that after ZFP36 knockdown, the Ki67 proliferation index in tumor tissue was significantly increased, E-cadherin expression was decreased, and N-cadherin expression was increased, indicating that ZFP36 deficiency promotes tumor cell proliferation and induces epithelial-mesenchymal transition. In an in vivo tail vein metastasis model, ZFP36 knockdown significantly increased the number of liver metastases, enhanced metastasis signal intensity, and shortened the overall survival of tumor-bearing mice, demonstrating that ZFP36 has an inhibitory effect on distant metastasis of SCLC. This invention provides a new approach for anti-growth and metastatic therapy of SCLC, and has significant clinical and economic value.

[0019] This invention demonstrates that ZFP36 can be used to prepare reagents for assessing the metastatic risk of small cell lung cancer (SCLC) patients. By detecting its expression level, the risk of distant metastasis, especially liver metastasis, can be predicted, guiding individualized treatment decisions and follow-up monitoring strategies for SCLC patients. Interventions targeting ZFP36, such as upregulating ZFP36 expression or enhancing its activity, can serve as a novel strategy for anti-metastatic therapy in SCLC, reducing the risk of distant metastasis in SCLC patients. Reagents capable of upregulating ZFP36 expression or enhancing its activity can be used alone or in combination with chemotherapy drugs and immune checkpoint inhibitors for the treatment of SCLC. This invention provides new targets and strategies for predicting metastatic risk, assessing prognosis, and targeted therapy in SCLC. Attached Figure Description

[0020] Figure 1 This is a graph showing the differential expression analysis of ZFP36 in primary and metastatic liver cancer lesions. Figure 1A shows a heatmap of differentially expressed genes between liver metastases and the primary tumor. Figure 1 Bar chart B shows the average expression changes of the top 10 differentially expressed genes; Figure 1 C represents the UMAP dimensionality reduction clustering diagram of the tumor cell subset; Figure 1 D represents the UMAP map showing the expression distribution of ZFP36 in tumor cells; Figure 1 Middle E is a violin diagram of ZFP36 expression in tumor cells of the primary lesion and liver metastases; Figure 1 The middle F figure shows a comparison of ZFP36 expression in primary and metastatic cell lines in the CCLE database; Figure 1 The graph in G represents the correlation analysis between ZFP36 expression and patient survival based on a public database. Figure 2 This is a graph showing the effect of ZFP36 on the proliferation ability of tumor cells. Figure 2 Image A shows the qPCR validation image, Western blot validation image, and CCK-8 proliferation curve of NCI-H446 cells overexpressing ZFP36. Figure 2 Figure B shows the qPCR validation diagram, Western blot validation diagram, and CCK-8 proliferation curve of SW1271 cells overexpressing ZFP36. Figure 2 In the middle C, there are qPCR verification images, Western blot verification images, and CCK-8 proliferation curves for SHP-77 cells knocking down ZFP36. Figure 2 The middle D figure shows the qPCR validation diagram, Western blot validation diagram, and CCK-8 proliferation curve of SW1271 cells knocking down ZFP36. Figure 3 This is a graph showing the effect of ZFP36 on the DNA synthesis capacity of tumor cells. Figure 3 Image A shows the EdU staining and statistical analysis of NCI-H446 cells overexpressing ZFP36; Figure 3 Figure B shows the EdU staining image and statistical analysis of ZFP36 overexpression in SW1271 cells. Figure 3 The middle section (C) shows the EdU staining image and statistical analysis of SW1271 cells with ZFP36 knockdown; Figure 3 The middle section (D) shows the EdU staining image and statistical analysis of SHP-77 cells with ZFP36 knockdown. Figure 4 This is a graph showing the effect of ZFP36 on the clonogenic ability of tumor cells. Figure 4 Figure A shows the colony formation experiment and statistical analysis of NCI-H446 cells overexpressing ZFP36. Figure 4 Figure B shows the colony formation experiment and statistical analysis of SW1271 cells overexpressing ZFP36. Figure 4 The middle section (C) shows the colony formation experiment and statistical analysis of DMS114 cells with ZFP36 knockdown. Figure 4 The diagram in D shows the colony formation experiment and statistical analysis of ZFP36 knockdown in SW1271 cells. Figure 5 This is a graph showing the effect of ZFP36 on tumor cell migration ability. Figure 5 Figure A shows the scratch healing experiment and statistical analysis of SW1271 cells overexpressing ZFP36; Figure 5 Figure B shows the scratch healing experiment and statistical analysis of NCI-H446 cells overexpressing ZFP36; Figure 5 The figure in C is a scratch healing experiment and statistical analysis of SW1271 cells with ZFP36 knockdown; Figure 5 Figure D in the middle is a diagram of the scratch healing experiment and statistical analysis of DMS114 cells with ZFP36 knockdown; Figure 6 This is a graph showing the effect of ZFP36 on the invasive ability of tumor cells. Figure 6 Figure A in the diagram shows the Transwell invasion assay and statistical analysis of SW1271 cells overexpressing ZFP36. Figure 6 Figure B shows the Transwell invasion assay and statistical analysis of NCI-H446 cells overexpressing ZFP36; Figure 6 The middle C represents the Transwell invasion experiment and statistical analysis of NCI-H446 cells with ZFP36 knockdown; Figure 6 The figure in D is a Transwell invasion experiment and statistical analysis of SW1271 cells with ZFP36 knockdown; Figure 7 This is a graph showing the effect of ZFP36 on tumor cell cycle distribution. Figure 7 Figure A shows the flow cytometry cell cycle detection and statistical analysis of SW1271 cells overexpressing ZFP36; Figure 7 Figure B shows the flow cytometry cell cycle detection and statistical analysis of NCI-H446 cells overexpressing ZFP36; Figure 7 The graph in C represents the flow cytometry cell cycle detection and statistical analysis of DMS114 cells with ZFP36 knockdown. Figure 7 The middle D figure shows the flow cytometry cell cycle detection and statistical analysis of SW1271 cells with ZFP36 knockdown; Figure 8 The figure shows the effect of ZFP36 knockdown on subcutaneous tumorigenesis in nude mice. Figure 8 Image A shows a representative photograph of a subcutaneous xenograft in nude mice after ZFP36 knockdown in DMS53 cells. Figure 8 Figure B shows the growth curves of tumor volume changes over time in nude mice from different experimental groups. Figure 8 The graph in the middle (C) represents the statistical analysis of the tumor weight of each group at the experimental endpoint. Figure 8 Image D shows the immunohistochemical staining of ZFP36, Ki67, E-cadherin and N-cadherin expression in subcutaneous xenograft tissue of nude mice after ZFP36 knockdown. Figure 9 This is a graph showing the effect of ZFP36 on an in vivo tail vein liver metastasis model. Figure 9 Image A shows representative in vivo GFP images of mice in each group after tail vein injection, illustrating the tumor metastasis burden. Figure 9 Figure B shows the overall survival curves of mice in each group, comparing the differences in overall survival between the ZFP36 knockdown group and the control group; Figure 9The graph in C represents the statistical analysis of the number of liver metastases in each group of mice; Figure 10 The effects of altered ZFP36 expression on the transcriptome and AKT signaling pathway activation in small cell lung cancer cells, among which... Figure 10 Image A shows a heatmap of differentially expressed genes from RNA sequencing in the SW1271 NC group and the SW1271 sh-ZFP36#1 group. Figure 10 B represents the KEGG pathway enrichment analysis of differentially expressed genes in the SW1271 NC group and the SW1271 sh-ZFP36#1 group. Figure 10 In the middle (C), Western blot analysis was performed on the p-AKT, total AKT, and β-actin protein levels in the NCI-H446 Vector group, NCI-H446 OE-ZFP36 group, SW1271 Vector group, SW1271OE-ZFP36 group, SHP-77 Ctrl group, SHP-77 sh-ZFP36 #1 group, and SHP-77 sh-ZFP36 #2 group. Detailed Implementation

[0021] The technical solutions of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but the present invention is not limited to the following technical solutions.

[0022] Example 1: Single-cell RNA sequencing identifies ZFP36 as a key inhibitory factor associated with liver metastasis in SCLC. 1.1 Clinical Sample Collection and Processing The inventors' team collected primary lung tumor tissue and corresponding liver metastasis tissue from 5 patients with SCLC (splenic leukocytoma) from the Department of Internal Medicine II of the Third Affiliated Hospital of Kunming Medical University, totaling 10 paired samples (all samples were pathologically confirmed as SCLC), and performed single-cell RNA sequencing analysis. The specific sample collection method is as follows: (1) Sampling size: 50-100 mg of fresh tissue, about the size of a soybean; (2) Sample processing: The sample was processed on ice. Non-study tissues such as fat, connective tissue, and capsule were removed, and necrotic and thermally damaged parts were removed. (3) Sample cleaning: Rinse with pre-cooled sterile PBS (or physiological saline) to remove blood residue and mucus from the tissue surface, and blot dry the surface liquid; (4) Sample preservation: If the tissue is large, cut it into small pieces and immediately put it into a 15 mL centrifuge tube containing 4℃ pre-cooled tissue preservation solution to ensure that the tissue pieces are fully submerged in the tissue preservation solution; (5) Sample transportation: Place on a 4℃ crushed ice box and transport to the laboratory within 2 hours.

[0023] 1.2 Single-cell RNA sequencing Single-cell suspensions were prepared using a combination of mechanical dissociation and enzymatic digestion. Tissue was cut into pieces approximately 1-2 mm in size. 3 Small pieces of cells were added to a digestion solution containing Collagenase IV (2 mg / mL) and DNase I (100 μg / mL), and digested at 37°C for 30-45 minutes, gently pipetting to mix every 10 minutes. After digestion, the cells were filtered through a 70 μm cell filter to collect the single-cell suspension. After treatment with erythrocyte lysis buffer (ACK buffer), the cells were washed twice with PBS, resuspended in PBS containing 0.04% BSA, and the cell concentration was adjusted to 700-1200 cells / μL. Cell viability assays showed that the cell viability of all samples was >85%, and the cell number was >1×10⁻⁶. 6 .

[0024] Single-cell transcriptome sequencing was performed using the 10×Genomics Chromium platform. TM The Single Cell 3' Reagent Kits v3 were used for single-cell capture and library construction, aiming to capture approximately 8,000-10,000 cells / sample. After library construction, sequencing was performed using the Illumina NovaSeq 6000 platform, with a sequencing depth of approximately 50,000 reads / cell. Data alignment and gene expression matrix generation were performed using Cell Ranger software (v6.1.2), with the GRCh38 genome as the reference genome.

[0025] 1.3 Single-cell sequencing data analysis Data analysis was performed using the Seurat package (v4.3.0). Quality control criteria were: 200-6000 genes detected per cell, total UMI >500, and mitochondrial gene proportion <20%. Data were normalized using the LogNormalize method, identifying 2,000 hypervariable genes. The Harmony algorithm was used to integrate data from 10 samples to eliminate batch effects. Principal component analysis (PCA) was performed on the hypervariable genes, and the top 30 principal components were selected for UMAP dimensionality reduction visualization. Cell clustering was performed using the Louvain clustering algorithm. Cell subpopulations were annotated based on classic marker genes, and tumor epithelial cell subpopulations were extracted from the overall single-cell data. Figure 1 (C), a total of 29,986 tumor cells were obtained for subsequent differential analysis.

[0026] 1.4 Screening of differentially expressed genes and identification of ZFP36 After analyzing paired samples from 5 pairs of SCLC patients' primary tumors and liver metastases using single-cell RNA sequencing technology, differentially expressed genes in tumor cells were screened. The pairwise test was used to compare gene expression differences between tumor cells from primary and liver metastases. The screening criteria were: |log2FC| > 0.5, adjusted P < 0.05, and consistent expression trends in ≥4 patients. The results showed that 69 differentially expressed genes were identified. A heatmap illustrates the expression patterns of these 69 differentially expressed genes in primary and metastatic lesions. Figure 1 (See Figure A). It is evident that ZFP36 expression was significantly downregulated in liver metastases. The bar chart shows the average expression changes of the Top 10 differentially expressed genes. Figure 1 ZFP36 is among the top downregulated genes (B in the Chinese B group).

[0027] The UMAP plot shows the expression distribution of ZFP36 in tumor cells. Figure 1 (D) It can be seen that ZFP36 is highly expressed in primary tumor cells, but its expression is significantly reduced in liver metastasis tumor cells. Quantitative analysis of the violin plot shows ( Figure 1 In the primary tumor cells, the mean expression level of ZFP36 was significantly higher than that in the liver metastases (P < 0.001).

[0028] 1.5 Public Database Validation To further verify the relationship between ZFP36 expression and SCLC metastasis, this study downloaded gene expression profiling data from the Cancer Cell Line Encyclopedia (CCLE) database. CCLE is currently maintained by the DepMap project at the Broad Institute. The specific download version is DepMap Public 25Q2, downloaded on July 11, 2025, at https: / / depmap.org / portal / download / all / . This dataset was analyzed using RNA-seq technology, and gene expression values ​​were standardized to log2(TPM+1). Cell lines with a lineage of "Lung" and a primary disease of "Lung Neuroendocrine Tumor" were selected from this dataset. After further confirmation by cell line name and literature, lung carcinoids and large cell neuroendocrine carcinomas were excluded, and small cell lung cancer (SCLC) cell lines were included. The "Tumor" information in the DepMap annotation file (sample_info.csv) was used to further define the cell lines. The "Type" field categorized cell lines into primary tumor-derived and metastatic tumor-derived groups. The expression levels of the ZFP36 gene (Ensembl ID: ENSG00000134812) were extracted in each SCLC cell line. Statistical analysis was performed using R language (https: / / www.r-project.org / ). After assessing data normality using the Shapiro-Wilk test, the differences in ZFP36 expression levels between groups were compared using the Mann-Whitney U test. A p-value < 0.05 was considered statistically significant. The results showed that the ZFP36 expression level in SCLC cell lines derived from primary tumors was significantly higher than that in SCLC cell lines derived from metastatic tumors (p < 0.05). Figure 1 (F), this result is consistent with the single-cell sequencing data of this invention, suggesting that downregulation of ZFP36 expression may be related to the metastatic potential of SCLC.

[0029] To further explore the relationship between ZFP36 expression and the prognosis of SCLC patients, this study used the small cell lung cancer dataset from the cBioPortal database (https: / / www.cbioportal.org / ) for survival analysis. This dataset is based on research published by a team from the University of Cologne, Germany (Small Cell Lung Cancer, U Cologne, Nature 2015; George J et al., Nature, 2015, 524 (7563): 47-53, doi: 10.1038 / nature14664). It included whole-genome sequencing and clinical follow-up data from tumor samples of 120 SCLC patients, of which 81 samples had RNA sequencing expression data and complete survival information, and were included in subsequent analysis. Based on ZFP36 gene expression levels, the optimal cutoff value was determined using the maximally selected rank statistics method, and patients were divided into a high-expression group and a low-expression group. Kaplan-Meier analysis was then performed. Overall survival (OS) curves were plotted for the two groups of patients. The differences in survival between the groups were compared using the Log-rank test. All statistical analyses were performed using R language (survival and survminer packages), and P < 0.05 was considered statistically significant. The results showed that the OS of patients in the high ZFP36 expression group was significantly longer than that in the low expression group (Log-rank test, P = 0.02) (G in Figure 1). These results fully demonstrate that downregulation of ZFP36 expression is closely related to SCLC liver metastasis and can serve as a potential biomarker and therapeutic target for SCLC liver metastasis.

[0030] The above results fully demonstrate that the downregulation of ZFP36 expression is closely related to SCLC liver metastasis, and can serve as a potential biomarker and therapeutic target for SCLC liver metastasis.

[0031] Example 2: Effect of ZFP36 on the proliferation capacity of SCLC cells To verify the biological function of ZFP36 in SCLC cells, the inventors examined its effect on cell proliferation by overexpressing and knocking down ZFP36.

[0032] 2.1 Cell Culture Human SCLC cell lines NCI-H446, SW1271, and SHP-77 were purchased from the Cell Bank of the Chinese Academy of Sciences. NCI-H446 and SHP-77 cells were cultured in RPMI-1640 medium (Gibco), while SW1271 cells were cultured in DMEM medium (Gibco). All media were supplemented with 10% FBS (Gibco) and 1% penicillin-streptomycin (Gibco). All cells were cultured at 37°C in a 5% CO2 incubator and passaged every 2-3 days.

[0033] 2.2 Construction of stable ZFP36 overexpression and knockdown cell lines SCLC cell lines with stable ZFP36 overexpression and knockdown were constructed using lentiviral infection, as detailed below: (1) Lentiviral viruses carrying ZFP36 overexpression and ZFP36 knockdown elements were purchased from Shanghai Gemma Pharmaceutical Technology Co., Ltd. The ZFP36 overexpression lentivirus (OE-ZFP36) used an LV5 (EF-1a / GFP&Puro) lentiviral vector backbone, which is a commercially available lentiviral vector in the field. The full-length coding sequence of human ZFP36, fused to a 3×Flag tag at the C-terminus, was inserted into the vector; an empty lentiviral vector was used as a negative control for overexpression.

[0034] After the recombinant OE-ZFP36 plasmid was constructed, Sanger sequencing confirmed that the inserted ZFP36-3×Flag fusion coding sequence was completely identical to the publicly available reference coding sequence of human ZFP36 and the theoretical sequence of the 3×Flag tag, with no base mutations, deletions, or frameshift mutations. Following infection of target cells with OE-ZFP36 lentivirus, the ZFP36-3×Flag fusion protein was stably produced intracellularly. Specific expression of this fusion protein could be detected by Western blot using a Flag-tagged antibody, confirming the correct translation and expression of the inserted fragment in the cells.

[0035] The ZFP36 knockdown lentivirus uses an LV3(H1 / GFP&Puro) lentiviral vector backbone (8.0 kb plasmid size), which is a commercially available lentiviral vector in the field. This vector utilizes the H1 promoter to drive transcription of the inserted fragment to produce shRNA; the CMV promoter drives the expression of the GFP-T2A-Puromycin fusion protein, enabling green fluorescent tracking and puromycin drug screening; the vector carries ampicillin resistance for prokaryotic plasmid amplification and also contains HIV-1 LTR, ψ packaging signal, RRE, and WPRE lentiviral core functional elements.

[0036] The ZFP36 overexpression lentiviral vector (named OE-ZFP36) contains the full-length coding sequence of the human ZFP36 gene, with an empty vector (named Vector) as a control. The ZFP36 knockdown lentiviral vector contains two different shRNA sequences (named Sh-ZFP36#1 and Sh-ZFP36#2), with a scrambled shRNA as a control (named Sh-ZFP36-Ctrl, whose target mRNA recognition sequence is: 5′-TTCTCCGAACGTGTCACGT-3′, (SEQ ID NO: 1). This sequence shows no homology with any known human gene and will not specifically silence human genes, serving as a negative control for the shRNA interference experiment). The target mRNA sequence corresponding to Sh-ZFP36#1 is: CAAGACGGAACTCTGTCACAA (SEQ ID NO: 2); the target mRNA sequence corresponding to Sh-ZFP36#2 is: CTTCAATCGCATCTCTGTTTC (SEQ ID NO: 3). Sh-ZFP36-Ctrl is a negative control lentivirus for the knockdown experiment, prepared by Shanghai Jima Pharmaceutical Technology Co., Ltd. Its vector inserts a scramble shRNA sequence that does not target any human gene, which is used to eliminate the non-specific interference effect brought about by the shRNA vector itself.

[0037] (2) Prepare the cells to be infected. Seed the target cells evenly in a 6-well plate (50-60% density) and incubate overnight.

[0038] (3) Remove the cell culture medium, add 1 mL of ordinary cell culture medium and 1 mL of virus solution to each well, and add 4 μg / mL polybrene (Sigma) to promote infection efficiency.

[0039] (4) Repeat step (3) for secondary infection 24 hours later. 48 hours after infection, use puromycin (2 μg / mL) to screen for stable transfected cell lines, and continue screening for 7-10 days. The stable transfected cells obtained from the screening can be used for subsequent experiments.

[0040] In this invention, NCI-H446 and SW1271 cells were selected to construct a cell line that stably overexpresses ZFP36, and SHP-77 and SW1271 cells were selected to construct a cell line that stably knocks down ZFP36.

[0041] 2.3 qPCR and Western blot validation The effects of stable ZFP36 overexpression and knockdown were verified using qPCR and Western blot. qPCR results showed that, compared to the control group (Vector), the expression level of ZFP36 mRNA in NCI-H446 and SW1271 cells was significantly increased. Figure 2 China A and Figure 2 (Left side of B in the middle). The knockdown results showed that, compared with the control group (Sh-ZFP36-Ctrl), the expression level of ZFP36 mRNA in SHP-77 and SW1271 cells was significantly reduced ( Figure 2 C and Figure 2 (Left side of D in the middle)

[0042] Western blot results showed that ZFP36 protein was significantly overexpressed in NCI-H446 and SW1271 cells. Figure 2 China A and Figure 2 (Middle B); ZFP36 protein knockdown was significant in SHP-77 and SW1271 cells ( Figure 2 C and Figure 2 (Middle D). The above results verify the effectiveness of the constructed stable cell line.

[0043] 2.4 CCK-8 cell proliferation experiment Cell proliferation was assessed using the CCK-8 assay (Cell Counting Kit-8, Dojindo). Cells in logarithmic growth phase were seeded at 2000 cells / well in 96-well plates, with 6 replicates per group. On days 1, 2, 3, 4, and 5 post-seeding, 10 μL of CCK-8 solution was added to each well. After incubation at 37°C for 2 hours, the absorbance (OD) at 450 nm was measured using a BioTek microplate reader. 450 ).like Figure 2 A and Figure 2 As shown in Figure B, compared with the control group (Vector), overexpression of ZFP36 significantly inhibited the proliferation of NCI-H446 and SW1271 cells; Figure 2 C and Figure 2 As shown in Figure D, compared with the control group (Sh-ZFP36-Ctrl), knockdown of ZFP36 significantly promoted the proliferation of SHP-77 and SW1271 cells.

[0044] This study investigated the effect of ZFP36 on the proliferation of SCLC cells by overexpressing ZFP36 in NCI-H446 and SW1271 cells and knocking down ZFP36 in SHP-77 and SW1271 cells. The results showed that ZFP36 overexpression significantly inhibited cell proliferation, while ZFP36 knockdown significantly promoted cell proliferation, suggesting that reduced ZFP36 expression may accelerate the metastasis process of SCLC by promoting cell proliferation.

[0045] Example 3: Effect of ZFP36 on DNA Synthesis Capacity of SCLC Cells To further verify the effect of ZFP36 on SCLC cell proliferation, the inventors used an EdU staining experiment to detect the cell's DNA synthesis capacity.

[0046] EdU staining experiments were performed using BeyoClick. TM The EdU-594 Cell Proliferation Detection Kit (C0078S, Beyotime Biotechnology Co., Ltd.) is used to detect cellular DNA synthesis capacity. The specific operation is as follows: (1) EdU labeling: Cells stably overexpressing or knocking down ZFP36 as constructed in Example 2 were used at a concentration of 2 × 10⁻⁶. 4 Cells / well were seeded in 24-well plates, with 3 replicates per group, and cultured for 24 hours. Prepare 2X EdU working solution: Dilute EdU stock solution (10 mM) 1:1000 with cell culture medium to obtain 20 μM 2X working solution. Add an equal volume of 2X EdU working solution to the culture wells to bring the final EdU concentration to 10 μM, and continue culturing for 2 hours.

[0047] (2) Fixation and permeabilization: Remove the culture medium containing EdU, add 0.5 mL of immunostaining fixative (P0098, Beyotime) to each well, and fix for 15 minutes at room temperature. Wash twice with PBS. Add 0.5 mL of PBS containing 0.3% Triton X-100 and incubate at room temperature for 10-15 minutes. Wash once with PBS.

[0048] (3) Click reaction: Prepare the Click reaction solution. Prepare the solution strictly according to the following order: Use 100 μL of reaction solution for each 24-well plate sample, including 86 μL Click Reaction Buffer, 4 μL CuSO4, 0.2 μL Azide 594, and 10 μL Click Additive Solution, for a total volume of 100 μL. After mixing, add 100 μL of Click reaction solution to each well and incubate at room temperature in the dark for 30 minutes.

[0049] (4) Nuclear staining: Aspirate the Click reaction solution and wash 2-3 times with PBS. Dilute Hoechst 33342 (1000X) with PBS at a ratio of 1:1000, add 0.5 mL of 1X Hoechst 33342 solution to each well, and incubate at room temperature in the dark for 10 minutes. Aspirate the staining solution and wash 2-3 times with PBS.

[0050] (5) Fluorescence detection: Observe and photograph under a fluorescence microscope (Olympus). EdU-positive cells show red fluorescence (excitation wavelength 587 nm, emission wavelength 612 nm), and the cell nucleus shows blue fluorescence (Hoechst 33342). Three fields of view were randomly selected from each group, and the proportion of EdU-positive cells was counted using ImageJ software (number of EdU-positive cells / total number of Hoechst-positive cells × 100%).

[0051] like Figure 3 China A and Figure 3 As shown in Figure B, compared with the control group (Vector), overexpression of ZFP36 significantly inhibited the DNA synthesis capacity of NCI-H446 and SW1271 cells; Figure 3 C and Figure 3 As shown in Figure D, compared with the control group (Sh-ZFP36-Ctrl), knockdown of ZFP36 significantly promoted the DNA synthesis capacity of SW1271 and SHP-77 cells.

[0052] This example further validated the effect of ZFP36 on SCLC cell proliferation using EdU staining experiments. The results showed that ZFP36 overexpression significantly inhibited cellular DNA synthesis, while ZFP36 knockdown significantly promoted cellular DNA synthesis. This result is consistent with the CCK-8 proliferation assay results in Example 2, further confirming that ZFP36 plays an inhibitory role in SCLC cell proliferation.

[0053] Example 4: Effect of ZFP36 on the colony-forming ability of SCLC cells To investigate the effect of ZFP36 on the long-term proliferation and colony formation ability of SCLC cells, the inventors used a plate colony formation assay to assess the cell's colony formation ability. The specific procedures are as follows: (1) Cell seeding: After digestion and counting, the cells stably overexpressing or knocking down ZFP36 constructed in Example 2 were seeded at 1000 cells / well in a 6-well plate, with 3 replicates per group. The culture plate was gently shaken to disperse the cells evenly.

[0054] (2) Culture: Place the cells in a 37℃, 5% CO2 incubator for 10-14 days, and replace the culture medium with fresh medium every 3 days.

[0055] (3) Fixation and staining: When visible colony formation (cell colonies are visible to the naked eye), discard the culture medium and wash twice with PBS. Add 2 mL of tissue fixative to each well and fix at room temperature for 15 minutes. Discard the tissue fixative, allow to air dry, and then add 1 mL of 0.1% crystal violet staining solution to each well and stain at room temperature for 20 minutes.

[0056] (4) Washing and photographing: Rinse the dyeing board slowly with running tap water to remove excess dye, and take photos after air drying.

[0057] (5) Clone Count: The number of clones was counted using ImageJ software. like Figure 4 China A and Figure 4 As shown in Figure B, compared with the control group (Vector), overexpression of ZFP36 significantly inhibited the clonogenic ability of NCI-H446 and SW1271 cells; Figure 4 C and Figure 4 As shown in Figure D, compared with the control group (Sh-ZFP36-Ctrl), knockdown of ZFP36 significantly promoted the clonogenic ability of SHP-77 and SW1271 cells.

[0058] This embodiment uses a colony formation assay to verify the effect of ZFP36 on the long-term proliferation and colony formation ability of SCLC cells. The following groups of stable SCLC cells were used: Vector overexpression control group, OE-ZFP36 overexpression group, Sh-ZFP36-Ctrl knockdown control group, Sh-ZFP36#1 and Sh-ZFP36#2 knockdown groups. Cells from each group were seeded at the same density in cell culture plates and continuously cultured at 37°C in a 5% CO2 incubator. Once visible cell colonies appeared in the culture system, the culture medium was discarded, and the cells were fixed, stained, and the number of colonies was counted under a microscope. A cell cluster with more than 50 cells was considered one valid colony. The experimental results showed that, compared with the Vector control group, the number of cell clones formed in the ZFP36 overexpression group OE-ZFP36 was significantly reduced; compared with the Sh-ZFP36-Ctrl control group, the number of cell clones formed in the ZFP36 knockdown groups Sh-ZFP36#1 and Sh-ZFP36#2 was significantly increased.

[0059] The above experimental results corroborate the results of the CCK-8 cell proliferation experiment in Example 2 and the EdU staining experiment in Example 3, further confirming that ZFP36 has an inhibitory effect on the proliferation and colony formation ability of SCLC cells, suggesting that downregulation of ZFP36 expression can enhance the proliferation and colony formation ability of SCLC cells, thereby promoting the metastasis process of SCLC.

[0060] Example 5: Effect of ZFP36 on the lateral migration ability of SCLC cells To verify the effect of ZFP36 on the migration ability of SCLC cells, the inventors used a scratch healing assay to detect the lateral migration ability of cells. The specific procedure is as follows: (1) Cell seeding: The constructed cells that stably overexpress or knock down ZFP36 were seeded at a rate of 5 × 10⁶ cells / year. 5 Cells were seeded per well in 6-well plates, with 3 replicates per group. Cells were incubated at 37°C in a 5% CO2 incubator until they reached 90-95% confluence.

[0061] (2) Scratching: Using a 200μL sterile pipette tip, perpendicular to the bottom of the 6-well plate, apply even pressure along a ruler to make a straight scratch. Gently wash with PBS 2-3 times to remove the scratched suspended cells.

[0062] (3) Change the culture medium: Add 2 mL of culture medium containing low concentration of serum (1% FBS) to reduce the impact of cell proliferation on migration results.

[0063] (4) Photograph recording: The initial width of the scratch was recorded by taking a photograph under an inverted microscope at 0 hours. The culture plate was placed back in the incubator and cultured for another 24 hours and 48 hours. The healing of the scratch was recorded by taking photographs at the same location.

[0064] (5) Data analysis: The area of ​​the scratch was measured using ImageJ software.

[0065] like Figure 5 China A and Figure 5 As shown in Figure B, compared with the control group (Vector), overexpression of ZFP36 significantly inhibited the lateral migration ability of SW1271 and NCI-H446 cells: like Figure 5 C and Figure 5 As shown in Figure D, compared with the control group (Sh-ZFP36-Ctrl), knockdown of ZFP36 significantly promoted the lateral migration ability of SW1271 and DMS114 cells. This example verified the effect of ZFP36 on the lateral migration ability of SCLC cells using a scratch wound healing assay. The results showed that ZFP36 overexpression significantly inhibited the lateral migration ability of cells, while ZFP36 knockdown significantly promoted it. This result is consistent with the finding in Example 1 that ZFP36 expression was downregulated in liver metastases, suggesting that reduced ZFP36 expression may promote the metastatic process of SCLC by enhancing cell migration ability.

[0066] Example 6: Effect of ZFP36 on the migration ability of SCLC cells To further verify the effect of ZFP36 on the migration ability of SCLC cells, the inventors used a Transwell migration assay. The specific procedure is as follows: (1) Transwell chamber preparation: 24-well Transwell chambers (8 μm pore size, Corning) were used, with a polycarbonate microporous membrane at the bottom of the upper chamber. The chambers were pretreated with serum-free culture medium for 30 minutes before the experiment.

[0067] (2) Cell seeding: After digesting the constructed stable ZFP36 overexpressing or knockdown cells, resuspend them in serum-free medium and count them. Take 5 × 10⁶ cells. 4 One cell was suspended in 200 μL of serum-free medium and added to the upper chamber of a Transwell. 600 μL of complete medium containing 20% ​​FBS was added to the lower chamber as a chemical inducer.

[0068] (3) Incubation: Place the Transwell chamber in a 37°C, 5% CO2 incubator and incubate for 24 hours.

[0069] (4) Fixation and staining: After culture, gently wipe away the unmigrated cells on the upper side of the upper chamber (upper surface of the membrane) with a cotton swab. Fix the migrating cells on the lower surface of the membrane with 4% paraformaldehyde for 20 minutes. After washing with PBS, stain with 0.1% crystal violet for 20 minutes. Wash with PBS to remove excess dye and air dry.

[0070] (5) Photographing and counting: Three fields of view were randomly selected under an inverted microscope to take pictures, and the number of cells that migrated to the subsurface membrane was counted using ImageJ software.

[0071] like Figure 6 China A and Figure 6 As shown in Figure B, compared with the overexpression control group (Vector), overexpression of ZFP36 significantly inhibited the migration ability of SW1271 and NCI-H446 cells; Figure 6 C and Figure 6 As shown in Figure D, compared with the knockdown control group (Sh-ZFP36-Ctrl), knockdown of ZFP36 significantly promoted the migration ability of NCI-H446 and SW1271 cells.

[0072] This embodiment further validated the effect of ZFP36 on the longitudinal migration ability of SCLC cells using a Transwell migration assay. The results showed that ZFP36 overexpression significantly inhibited cell longitudinal migration, while ZFP36 knockdown significantly promoted it. This result is consistent with the scratch healing assay results of Example 5, further confirming that ZFP36 plays an inhibitory role in SCLC cell migration, suggesting that reduced ZFP36 expression may promote the liver metastasis process of SCLC by enhancing cell migration ability.

[0073] Example 7: Effect of ZFP36 on the cell cycle distribution of SCLC To investigate the molecular mechanism by which ZFP36 inhibits the proliferation of SCLC cells, the inventors used flow cytometry to detect the effect of ZFP36 on cell cycle distribution. The specific procedures are as follows: (1) Cell collection: The constructed cells that stably overexpress or knock down ZFP36 were collected at a rate of 2×10⁶ cells per cell line. 5 Cells were seeded per well in 6-well plates and cultured for 48 hours. Cells in the logarithmic growth phase were collected, trypsinized, centrifuged at 1000 rpm for 5 minutes, and the supernatant was discarded.

[0074] (2) PBS washing: Wash cells 1-2 times with pre-cooled PBS, centrifuge at 1500 rpm for 5 minutes, and adjust the cell concentration to 1×10⁻⁶. 6 / mL, take 1 mL of single-cell suspension.

[0075] (3) Cell fixation: Slowly add the cell suspension to 500 μL of pre-cooled 70% ethanol (using a DNA content detection kit, catalog number CA1510, Beijing Solarbio Science & Technology Co., Ltd.), mixing while adding, and fix at 4°C for at least 2 hours or overnight. Wash the fixative solution twice with PBS before staining.

[0076] (4) PI staining: Add 100 μL of RNase A solution to the cell pellet, resuspend the cells, and incubate at 37°C for 30 minutes; then add 400 μL of PI staining solution and incubate at room temperature in the dark for 30 minutes.

[0077] (5) Flow cytometry: Cell cycle distribution was detected using a flow cytometer (BD FACSCalibur), with at least 10,000 cells analyzed per sample.

[0078] (6) Data analysis: The proportion of cells in each phase of the cell cycle (G0 / G1 phase, S phase, G2 / M phase) was analyzed using FlowJo software.

[0079] like Figure 7 China A and Figure 7 As shown in Figure B, compared with the control group (Vector), SW1271 cells ( Figure 7 (A) and NCI-H446 cells ( Figure 7 The proportion of cells in G0 / G1 phase was significantly increased and the proportion of cells in S phase was significantly decreased in the B)OE ZFP36 group.

[0080] like Figure 7 C and Figure 7 As shown in Figure D, compared with the knockdown control group (Sh ZFP36 Ctrl), DMS114 cells ( Figure 7(C) and SW1271 cells ( Figure 7 (D): Flow cytometry cell cycle analysis showed that the proportion of G0 / G1 phase cells was significantly reduced and the proportion of S phase cells was significantly increased in the knockdown groups Sh ZFP36#1 and Sh ZFP36#2.

[0081] This embodiment reveals the mechanism by which ZFP36 inhibits SCLC cell proliferation using flow cytometry. ZFP36 overexpression leads to cell cycle arrest at the G0 / G1 phase, inhibiting cell entry into the S phase and thus suppressing cell proliferation; conversely, ZFP36 knockdown promotes cell entry from the G0 / G1 phase into the S phase, accelerating cell cycle progression. These results are consistent with the CCK-8 proliferation assay in Example 2 and the EdU staining assay in Example 3, further confirming that ZFP36 inhibits SCLC cell proliferation by regulating cell cycle progression, suggesting that ZFP36 may exert its effect by regulating the expression of G0 / G1-S phase checkpoint-related proteins.

[0082] Example 8: Effect of ZFP36 knockdown on subcutaneous tumorigenesis in nude mice To further verify the inhibitory effect of ZFP36 on SCLC cell proliferation in vivo, the inventors constructed a nude mouse subcutaneous xenograft model to evaluate the effect of ZFP36 knockdown on tumor growth. The specific procedures are as follows: (1) Experimental animals: 4-6 week old female nude mice were selected and housed in an SPF-grade animal room.

[0083] (2) Cell preparation: The constructed stable ZFP36 knockdown DMS53 cells (Sh-ZFP36#1, Sh-ZFP36#2) and control cells (Sh-ZFP36-Ctrl) were cultured to the logarithmic growth phase. Cells were collected by trypsin digestion, washed twice with PBS, and resuspended in serum-free RPMI-1640 medium to adjust the cell concentration to 1×10⁻⁶. 8 per mL.

[0084] (3) Cell inoculation: Nude mice were randomly divided into 3 groups, with 5 mice in each group. 0.1 mL of cell suspension (containing 1×10⁻⁶ cells) was inoculated into each group. 7 (100 cells) were mixed with an equal volume of Matrigel (Corning) and then inoculated subcutaneously into the right axilla of nude mice.

[0085] (4) Tumor growth monitoring: Starting from the 9th day after inoculation, the long diameter (L) and short diameter (W) of the tumor were measured every 3 days using calipers, and the tumor volume was calculated according to the formula: V (mm) 3 = L×W 2 / 2. Record the weight changes of nude mice.

[0086] (5) Tumor collection: On day 26 post-inoculation, nude mice were euthanized by cervical dislocation, and the subcutaneous transplanted tumor was completely dissected and photographed. The tumor weight was measured, and the tumor tissue was fixed with 4% paraformaldehyde for subsequent pathological analysis.

[0087] like Figure 8 As shown in Figure A, representative images of subcutaneous xenografts in nude mice at the end of the experiment show that the tumor volume of the knockdown groups Sh-ZFP36#1 and Sh-ZFP36#2 was significantly larger than that of the knockdown control group (Sh-ZFP36-Ctrl).

[0088] like Figure 8 As shown in Figure B, the growth curves of the transplanted tumor volume over time show that the tumor growth in the control group (Sh-ZFP36-Ctrl) was relatively slow, while the tumor growth in the Sh-ZFP36#1 and Sh-ZFP36#2 groups was significantly faster. Statistical analysis showed that the tumor volume after ZFP36 knockdown was significantly larger than that in the control group.

[0089] like Figure 8 As shown in Figure C, statistical analysis of the tumor weight at the experimental endpoint showed that the average tumor weight of the Sh-ZFP36#1 and Sh-ZFP36#2 groups was significantly higher than that of the control group (Sh-ZFP36-Ctrl).

[0090] like Figure 8 As shown in Figure D, immunohistochemical staining results showed that, compared with the control group (Sh-ZFP36-Ctrl), the expression level of ZFP36 in the transplanted tumor tissues of the Sh-ZFP36#1 and Sh-ZFP36#2 groups was significantly reduced, confirming that the knockdown effect was stable; the proportion of Ki67 positive cells was significantly increased, indicating enhanced tumor proliferation capacity; E-cadherin expression was decreased, and N-cadherin expression was increased, indicating that the tumor cells underwent epithelial-mesenchymal transition.

[0091] There was no significant difference in body weight among the groups of nude mice during the experiment, and no obvious toxic side effects were observed, suggesting that ZFP36 knockdown has no significant effect on the general condition of nude mice.

[0092] This embodiment validates the inhibitory effect of ZFP36 on SCLC tumor growth in vivo using a nude mouse subcutaneous xenograft model. The results show that knockdown of ZFP36 significantly promotes the tumorigenicity of DMS53 cells in nude mice, accelerates tumor growth, and significantly increases the volume and weight of the xenograft. This result is consistent with the findings of in vitro experiments (Examples 2-7), further confirming that ZFP36 plays the role of a tumor suppressor in the development and progression of SCLC, and that its reduced expression can promote tumor growth.

[0093] Example 9: Effect of ZFP36 knockdown on nude mouse tail vein liver metastasis model To further verify the effect of ZFP36 on the metastatic ability of SCLC cells in vivo, the inventors constructed a nude mouse tail vein liver metastasis model to evaluate the impact of ZFP36 knockdown on distant metastasis and survival. The specific procedures are as follows: (1) Experimental animals: 4-6 week old female nude mice were selected and housed in an SPF-grade animal room.

[0094] (2) Cell preparation: The constructed stable ZFP36 knockdown SHP-77 cells (Sh-ZFP36#1, Sh-ZFP36#2) and control cells (Sh-ZFP36-Ctrl) were cultured to the logarithmic growth phase. Cells were collected by trypsin digestion, washed twice with PBS, and resuspended in serum-free RPMI-1640 medium to adjust the cell concentration to 5×10⁻⁶. 7 per mL.

[0095] (3) Tail vein injection: Nude mice were randomly assigned to the Sh-ZFP36-Ctrl group, Sh-ZFP36#1 group, and Sh-ZFP36#2 group, with 7 mice in each group. Each nude mouse was injected with 0.1 mL of cell suspension containing 5 × 10⁻⁶ cells via the tail vein. 6 Each cell.

[0096] (4) In vivo imaging monitoring: On day 45 after cell injection, GFP fluorescence imaging was performed on mice in each group using a small animal in vivo imaging system to assess tumor metastasis and distribution in vivo.

[0097] (5) Survival observation: The general condition of the mice was observed daily after injection, and the survival status of the mice was recorded. When the mice exhibited ethical endpoints such as arched back, weight loss, and lethargy, they were determined to be the death endpoint. The Kaplan-Meier method was used to plot survival curves and compare the differences in total survival time among the groups of mice.

[0098] (6) Tissue sampling and HE staining: After reaching the ethical endpoint, mice were euthanized by cervical dislocation, and liver tissue was dissected and fixed with 4% paraformaldehyde. The fixed liver tissue was embedded in paraffin, sectioned, stained with hematoxylin and eosin (HE), and the number of liver metastases was observed and counted under a microscope.

[0099] like Figure 9 As shown in Figure A, GFP in vivo imaging on day 45 revealed only weak fluorescence signals in the knockdown control group (Sh-ZFP36-Ctrl) mice, while significantly enhanced fluorescence signals were observed in the abdomens of the knockdown groups Sh-ZFP36#1 and Sh-ZFP36#2, suggesting a significant increase in tumor metastasis burden in the ZFP36 knockdown group.

[0100] like Figure 9As shown in Figure B, survival curve analysis showed that the median survival of mice in the Sh-ZFP36-Ctrl group was significantly longer than that in the Sh-ZFP36#1 and Sh-ZFP36#2 groups; mice in the ZFP36 knockdown group showed ethical endpoints such as arched back and weight loss earlier after injection, and their overall survival was significantly shortened.

[0101] like Figure 9 As shown in Figure C, the results of liver HE staining and metastatic lesion counting showed that the number of liver metastases in the Sh-ZFP36-Ctrl group was less; while the Sh-ZFP36#1 and Sh-ZFP36#2 groups of mice had a large number of liver metastases, and the number of metastases was significantly greater than that in the control group (Sh-ZFP36-Ctrl).

[0102] There was no significant difference in body weight among the groups of nude mice during the experiment, and no obvious toxic side effects were observed, suggesting that ZFP36 knockdown has no significant effect on the general condition of nude mice.

[0103] This embodiment validated the inhibitory effect of ZFP36 on SCLC tumor metastasis in vivo using a nude mouse tail vein liver metastasis model. The results showed that knockdown of ZFP36 significantly promoted the distant metastasis ability of SHP-77 cells in nude mice, increased the number of liver metastases, and significantly shortened the overall survival of tumor-bearing nude mice. These results are consistent with the in vitro migration and invasion experiments (Examples 5-6), further confirming that ZFP36 acts as a tumor suppressor in SCLC metastasis, and its reduced expression can promote distant tumor metastasis.

[0104] Example 10: Effects of altered ZFP36 expression on the transcriptome and AKT signaling pathway activation in small cell lung cancer cells To further analyze the molecular basis of ZFP36 regulation of malignant phenotype in small cell lung cancer, this embodiment, based on the previously constructed ZFP36 overexpression and knockdown cell models, detected transcriptomic changes, candidate downstream gene expression changes, and AKT-related signal activation status in small cell lung cancer cells after altered ZFP36 expression.

[0105] 1. RNA sequencing and pathway enrichment analysis RNA sequencing analysis was performed on the SW1271 knockdown control group (Sh-ZFP36-Ctrl) cells and the SW1271 knockdown group sh-ZFP36#1 cells constructed above.

[0106] The results showed that the expression of multiple genes was significantly altered in the SW1271 knockdown group cells compared with the SW1271 knockdown control group. The differentially expressed gene heatmap revealed a significant difference in expression profiles between the SW1271 knockdown control group and the SW1271 knockdown group, indicating that ZFP36 knockdown can alter the cellular transcriptome expression profile in SW1271 small cell lung cancer cells.

[0107] Further KEGG pathway enrichment analysis of differentially expressed genes revealed that these genes were enriched in multiple tumor-related signaling pathways, including the PI3K-Akt signaling pathway, cytokine-cytokine receptor interaction, focal adhesion, ECM-receptor interaction, inflammatory mediator regulation, and cAMP signaling pathway. Among these, the PI3K-Akt signaling pathway is closely related to malignant biological behaviors of tumor cells, such as proliferation, survival, migration, invasion, and metastasis, suggesting that altered ZFP36 expression may affect the activation status of AKT-related signaling in small cell lung cancer cells.

[0108] 2. Western blot analysis of the effect of ZFP36 on AKT phosphorylation level To further investigate whether changes in ZFP36 expression affect the activation state of AKT-related signals, Western blot was used to detect the levels of p-AKT and total AKT proteins.

[0109] Cell detection and grouping include: NCI-H446 Vector group and NCI-H446 OE-ZFP36 group; SW1271 Vector group and SW1271 OE-ZFP36 group; SHP-77 Ctrl group, SHP-77 sh-ZFP36#1 group and SHP-77 sh-ZFP36#2 group.

[0110] The results showed that, compared with the corresponding Vector groups, the p-AKT protein level was reduced in the NCI-H446 OE-ZFP36 group and the SW1271 OE-ZFP36 group, while the total AKT protein level did not change significantly.

[0111] Compared with the SHP-77 Ctrl group, the p-AKT protein level was increased in the SHP-77 sh-ZFP36#1 group and the SHP-77 sh-ZFP36#2 group, while the total AKT protein level did not change significantly.

[0112] The above results indicate that altered ZFP36 expression primarily affects AKT phosphorylation levels in small cell lung cancer cells, thus influencing the activation state of AKT-related signals, without significantly altering total AKT protein expression levels. Western blot results showed no significant difference in total AKT protein expression levels among the treatment groups, but phosphorylated p-AKT protein expression was significantly downregulated. This suggests that the regulatory molecule (ZFP36) does not affect total AKT protein synthesis, but it can inhibit AKT protein phosphorylation activation, downregulate PI3K / AKT pathway activity, and thereby inhibit the proliferation and metastasis of small cell lung cancer cells.

[0113] The results of this embodiment indicate that ZFP36 knockdown alters the transcriptome expression profile of SW1271 small cell lung cancer cells, with differentially expressed genes enriched in tumor-related pathways such as the PI3K-Akt signaling pathway. Further Western blot results showed that ZFP36 overexpression reduced AKT phosphorylation levels in small cell lung cancer cells, while ZFP36 knockdown increased AKT phosphorylation levels, with no significant change in total AKT protein levels. Therefore, ZFP36 upregulation can reduce AKT phosphorylation levels in small cell lung cancer cells, suggesting that it can inhibit the activation of AKT-related signaling, providing a molecular basis for ZFP36 upregulators to inhibit the proliferation, migration, invasion, and distant metastasis of small cell lung cancer.

[0114] In summary, this invention, through single-cell RNA sequencing, in vitro functional experiments, and in vivo animal experiments, has demonstrated the biological function of ZFP36 in small cell lung cancer (SCLC) and its application value as a biomarker for metastasis risk and a therapeutic target. This invention also found that ZFP36 expression in SCLC liver metastases was significantly lower than in the primary tumor, and its expression level was correlated with patient survival, suggesting that ZFP36 can serve as a potential biomarker for SCLC metastasis risk assessment and prognosis, and that assessment reagents can be prepared accordingly.

[0115] In vitro functional studies showed that ZFP36 overexpression significantly inhibited the proliferation, DNA synthesis, colony formation, migration, and invasion of SCLC cells, and induced cell cycle G0 / G1 phase arrest; ZFP36 knockdown produced the opposite effect, promoting the above malignant phenotypes. In vivo experiments further showed that ZFP36 knockdown significantly promoted the subcutaneous tumorigenesis of SCLC cells in nude mice, accelerated tumor growth, and was accompanied by changes in migration / invasion / EMT-related markers such as increased Ki67 expression, decreased E-cadherin expression, and increased N-cadherin expression; in the tail vein metastasis model, ZFP36 knockdown significantly enhanced the distant metastasis ability of SCLC cells, increased the number of liver metastases, and shortened the overall survival of tumor-bearing nude mice.

[0116] Further molecular analysis revealed that differentially expressed genes in small cell lung cancer cells after ZFP36 knockdown were enriched in tumor-related pathways such as the PI3K-Akt signaling pathway. ZFP36 overexpression reduced AKT phosphorylation levels, while ZFP36 knockdown increased AKT phosphorylation levels, with no significant change in total AKT protein levels. These results suggest that altered ZFP36 expression can affect the activation state of AKT-related signaling and provide a molecular basis for ZFP36's regulation of the malignant biological behavior of small cell lung cancer.

[0117] Therefore, ZFP36 can be used to prepare diagnostic kits for assessing the risk of metastasis and / or predicting the prognosis of small cell lung cancer (SCLC); by upregulating ZFP36 expression or enhancing ZFP36 function, drugs for preventing and / or treating small cell lung cancer, and inhibiting its growth and / or metastasis can be prepared. This invention provides a new strategy for anti-growth and anti-metastasis therapy of SCLC.

Claims

1. Application of ZFP36 in the preparation of diagnostic reagents for assessing the risk of metastasis and / or predicting the prognosis of patients with small cell lung cancer.

2. The application according to claim 1, characterized in that, The detection reagent is used to detect the expression level of ZFP36 in biological samples.

3. The application according to claim 2, characterized in that, The reagents used to detect ZFP36 expression levels are reagents for detecting ZFP36 protein expression levels and / or reagents for detecting ZFP36 mRNA expression levels.

4. The application according to claim 1, characterized in that, The test reagent is used to detect primary or metastatic small cell lung cancer tissue.

5. A diagnostic kit for assessing the risk of metastasis and / or determining the prognosis of small cell lung cancer, characterized in that, The kit contains at least one of the following active components: amplification primers that specifically recognize the ZFP36 gene, an antibody that specifically binds to the ZFP36 protein, a ZFP36 overexpression vector, a viral vector carrying the ZFP36 coding sequence, ZFP36 mRNA, recombinant ZFP36 protein, a nucleic acid molecule that promotes the expression of endogenous ZFP36, and a small molecule compound that promotes the expression of endogenous ZFP36.

6. The application of substances that upregulate ZFP36 expression and / or enhance ZFP36 protein function in the preparation of drugs, characterized in that, The drug is used to prevent and / or treat small cell lung cancer; and / or inhibit small cell lung cancer cell proliferation, colony formation, migration, invasion and distant metastasis.

7. The application according to claim 6, characterized in that, The substance that upregulates ZFP36 expression and enhances ZFP36 protein function inhibits AKT protein phosphorylation and downregulates the activation of the PI3K-AKT signaling pathway, thereby arresting the G0 / G1 cell cycle of small cell lung cancer cells and inhibiting the malignant biological behavior of the tumor; and the total AKT protein expression level of the cells did not change significantly after the treatment.

8. The application of inhibitors that inhibit ZFP36 expression and / or block ZFP36 protein function in model construction, characterized in that, The model is a highly metastatic small cell lung cancer cell model or a tumor-bearing animal model; knocking down or inhibiting ZFP36 can enhance the proliferation, migration, invasion and distant liver metastasis of small cell lung cancer cells in vivo, accelerate the growth of subcutaneous tumors in nude mice, and shorten the survival time of tumor-bearing mice.

9. A pharmaceutical composition for treating small cell lung cancer and inhibiting tumor proliferation and distant metastasis, characterized in that, The active ingredient of the pharmaceutical composition is a substance that can upregulate intracellular ZFP36 expression and / or enhance ZFP36 protein activity; The pharmaceutical composition exerts its anti-tumor effect by reducing intracellular p-AKT protein levels and inhibiting the activation of the PI3K-AKT signaling pathway.

10. The pharmaceutical composition according to claim 9, characterized in that, The dosage form of the pharmaceutical composition is any one of injection, oral preparation or topical preparation.