A molecular marker related to shell thickness trait of eriocheir sinensis and application thereof

Abstract

The application discloses a molecular marker related to shell thickness of Eriocheir sinensis and application thereof, and the molecular marker is located in a gene region of Chr09:19627395 of the Eriocheir sinensis genome. Esine 0 2655 The site has length polymorphism: the wild type contains a 27 bp sequence, the mutant type sequence is deleted by 26 bp and only retains a single base A. The application further provides specific primer pairs for detecting the marker. The wild type product is 148 bp and the mutant type or heterozygote product is 122 bp or 122 bp and 148 bp simultaneously exist through amplification of the primer pairs. The marker detection cost is low, the accuracy is high, the mutant type individual can be significantly improved through assisted selection, the shell thickness of the Eriocheir sinensis population is improved, and the application has important breeding value.

Description

[0001] This invention belongs to the field of aquatic animal molecular biology and genetic breeding technology, specifically relating to a species of Chinese mitten crab (Eriocheir sinensis). Eriocheir sinensis Deletion molecular markers, detection primers, and their application in molecular-assisted breeding related to shell thickness traits. Background Technology

[0002] Chinese mitten crab ( Eriocheir sinensis It belongs to the phylum Arthropoda, class Malacostraca, order Decapoda, family Varunidae, and genus Eriocheir. Eriocheir They are widely distributed in rivers, lakes, reservoirs, paddy fields, and estuaries in nature, exhibiting unique reproductive migration habits and a strong ability to adapt to their environment. As large benthic crustaceans, they play a crucial role in aquatic ecosystems and are often regarded as important indicator organisms of water quality health.

[0003] In terms of nutritional value, the Chinese mitten crab has tender meat and abundant roe, which is rich in high-quality protein, highly unsaturated fatty acids and a variety of amino acids needed by the human body. It is nutritious and has an excellent flavor, making it popular among consumers.

[0004] Shell thickness is one of the important economic traits of the Chinese mitten crab. Individuals with thicker shells generally have higher survival rates, better transportability, and higher edibility (some believe that shell thickness is related to meat firmness). However, traditional breeding mainly relies on phenotypic selection, which is time-consuming and its efficiency is greatly affected by the environment.

[0005] Insertion-deletion (InDel) is a widespread form of genetic variation in the genome, referring to the insertion or deletion of a nucleotide sequence, typically ranging in length from 1 bp to 50 bp. Compared to single nucleotide polymorphisms (SNPs), InDels have the following significant advantages: Significant functional effects: InDels involve changes in sequence length. InDels located in coding regions are prone to causing reading frame shifts (frameshift mutations) or amino acid deletions / insertions, thereby drastically altering protein function; InDels located in non-coding regions may affect gene transcriptional regulation by altering motif structure. Convenient detection: Due to the significant difference in fragment length, InDel markers often do not require expensive sequencing or enzyme digestion. Low-cost, high-throughput genotyping can be achieved simply by PCR amplification and gel electrophoresis, making it very suitable for grassroots breeding applications. Good genetic stability: InDel is a codominant marker that follows Mendelian inheritance laws and can accurately distinguish between homozygotes and heterozygotes.

[0006] Currently, while technologies such as SNP chips are used in molecular breeding practices for Chinese mitten crabs, research on InDel markers with clearly defined functions and convenient detection methods is relatively limited. Therefore, identifying InDel molecular markers that contribute significantly to shell thickness traits with high accuracy and developing convenient detection techniques based on conventional PCR is of great significance for improving the efficiency of genetic improvement of Chinese mitten crab germplasm and reducing breeding costs. Summary of the Invention

[0007] To address the problems existing in the prior art, the purpose of this invention is to provide a molecular marker for identifying the shell thickness trait associated with *Eriocheir sinensis* (Chinese mitten crab) and its application. Whole-genome resequencing technology was used to sequence 182 *Eriocheir sinensis* individuals, and the shell thickness index (STI) was calculated from the data of these 182 individuals. Combined with genome-wide association analysis (GWAS), a deletion locus significantly associated with the shell thickness trait of *Eriocheir sinensis* was identified. This locus is located on chromosome 9 (Chr09:19627395) of the genome (version number: GCA_024679095.1), and is located at... Esine02655 Gene region. The polymorphism of this molecular marker is a mutation of a long sequence (SEQ ID NO:1) to 'A'. The frequency of this marker in different shell thickness populations was statistically analyzed during resequencing. It was found that in the thick-shelled population, the mutant (i.e., A) was the dominant allele; while in the thin-shelled population, the original long sequence was the dominant allele. In the thinner-shelled population, selecting individuals carrying the mutant allele can increase the shell thickness of the Chinese mitten crab.

[0008] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows: A deletion molecular marker associated with the shell thickness trait of Chinese mitten crab, the nucleotide sequence of which is shown in SEQ ID NO: 1 (wild type), is used to assist in the detection and breeding of the shell thickness trait of Chinese mitten crab by identifying the above-mentioned specific DNA sequence.

[0009] The above-mentioned method for identifying the shell thickness trait of the Chinese mitten crab includes the following steps: (1) Collect the walking leg muscle tissue of Chinese mitten crab and extract the genomic DNA of Chinese mitten crab; (2) PCR amplification was performed using genomic DNA as a template; the upstream primer for the PCR amplification was shown in SEQ ID NO: 3, and the downstream primer was shown in SEQ ID NO: 4; (3) The amplification products were detected by 5% agarose gel electrophoresis: if a specific amplification band of about 122 bp was detected or both 122 bp and 148 bp amplification bands were detected, it was determined that the product carried the thick-shell dominant gene; if a specific amplification band of about 148 bp was detected, it was determined that the product did not carry the thick-shell dominant allele.

[0010] Furthermore, the PCR amplification program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 56℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃; The PCR amplification reaction system was as follows: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water. A primer pair for identifying the shell thickness trait of the Chinese mitten crab, wherein the upstream primer of the primer pair is shown as SEQ ID NO: 3 and the downstream primer is shown as SEQ ID NO: 4; A kit for detecting the shell thickness trait of the Chinese mitten crab, the kit comprising the primer pair as described in claim 6.

[0011] Due to the adoption of the above technical solution, the advantages and positive effects of this invention are as follows: (1) This invention only requires a small amount of DNA from the walking leg muscles of the Chinese mitten crab, and genotyping can be completed by routine PCR amplification and electrophoresis. This marker is a codominant marker, which can accurately distinguish between homozygotes and heterozygotes, and has a high accuracy rate in auxiliary selection for the shell thickness trait of the Chinese mitten crab; (2) The identification method provided by this invention is simple to operate and low in cost. It can also accurately determine the size of Chinese mitten crab seedlings with small size and indistinct external characteristics. By carrying out early molecular-assisted selection in the seedling stage, it helps farmers to screen out superior individuals with high shell thickness potential earlier, shorten the breeding cycle, and increase the breeding yield and market value of the products. Attached Figure Description

[0012] Figure 1 This is a flowchart of the method for mining and detecting deletion molecular markers related to the shell thickness trait of Chinese mitten crab. Figure 2 This is a standard reference table for 20 bp DNA Ladder (Dye Plus); Figure 3This is the PCR amplification electrophoresis result of the molecular marker for the shell thickness trait of the Chinese mitten crab provided in Example 2; where lane 9 is a 20 bp DNA ladder (Dye Plus); lanes 1 to 8 correspond to thin-shelled individual samples (homozygous wild type), and the electrophoresis results all show a specific amplification band of about 148 bp; lanes 10 to 17 correspond to thick-shelled individual samples (homozygous mutant or heterozygous type), and the electrophoresis results mainly show a specific amplification band of about 122 bp (some heterozygous individuals may show both 148 bp and 122 bp double bands). Figure 4 This is the electrophoresis result of the population verification of the thick-shell trait of *Eriocheir sinensis* provided in Example 3. Lanes 6 and 12 are both 20 bp DNA ladders (Dye Plus). Lanes 1 to 5 correspond to individuals B002, B067, B103, B459, and B489, identified as homozygous wild-type individuals not carrying the thick-shell dominant allele; the electrophoresis results show only a single specific band of approximately 148 bp. Lanes 7 to 11 correspond to individuals B003, B046, B121, B463, and B466 (heterozygous), and lanes 13 to 17 correspond to individuals B027, B074, B0167, B370, and B373 (homozygous mutants), all identified as individuals carrying the thick-shell dominant allele; the electrophoresis results mainly show a specific band of approximately 122 bp, with heterozygous individuals also showing a 148 bp band. bp stripe. Detailed Implementation

[0013] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0014] The quantitative measurement standard for shell thickness of the Chinese mitten crab (Shell Thickness Index, STI) addresses the problems of large subjective error and non-reproducibility in existing technologies that rely solely on vernier calipers to measure thickness at specific sites. This invention proposes and employs the "Shell Thickness Index." STI ( ) is used as a quantitative indicator for identifying shell thickness characteristics.

[0015] The specific measurement method is as follows: Morphological data acquisition: The cephalothorax length of the Chinese mitten crab was measured using an electronic vernier caliper (accuracy 0.01 mm). L (referring to the distance from the frontal tooth depression to the posterior margin of the cephalothorax) and the width of the cephalothorax ( W The distance at the widest point of the thoracic armor is recorded in millimeters (mm).

[0016] Shell dry weight determination: Dissect the Chinese mitten crab, completely remove the carapace from its dorsal side, remove attached connective tissue, clean with deionized water, and pat dry. Place in a 60℃ oven to dry to constant weight, and weigh the dry shell using an electronic balance (accuracy 0.01 g). M ), the unit is recorded as grams (g).

[0017] Index Calculation: The shell thickness index is calculated using the following formula: , in, STI Units are g / mm² , M This is the dry weight of the shell (g). L The length of the cephalothorax is measured in mm. W Width of the cephalothorax (mm).

[0018] The materials involved in the following embodiments are as follows: The FastPure Blood / Cell / Tissue / Bacteria DNA Isolation Mini Kit was purchased from Vazyme, catalog number DC112; the 2 × Rapid Taq Master Mix was purchased from Vazyme, catalog number P222; and the 20 bp DNALadder (Dye Plus) was purchased from Takara, catalog number 3420A.

[0019] Whole-genome resequencing of individuals with different shell thicknesses of *Eriocheir sinensis* was performed using the BGI DNBSEQ-T7 sequencing platform to screen for shell thickness-specific associated fragments. Based on the association analysis results, genomic variation sites were located, yielding a 27 bp specific fragment, SEQ ID NO: 1. The specific steps and analysis process are as follows: Raw sequencing data of the *Eriocheir sinensis* population was obtained using the PE 150 sequencing mode. FastP software was used for quality control of the raw data, removing adapter sequences and low-quality bases to obtain clean data. The clean data obtained after quality control was aligned to the *Eriocheir sinensis* reference genome (version number: GCA_024679095.1) using the MEM algorithm in BWA (v0.7.17) software, and the results were sorted and deduplicated using SAMtools (v1.9). Single-sample variation detection and multi-sample joint genotyping were performed using the HaplotypeCaller module of GATK (v4.1.8) software to obtain a population variation information file (VCF). PLINK (v1.9) was used to perform quality control filtering on the variation data. Combined with the individual shell thickness index (STI), genome-wide association analysis (GWAS) was performed using GEMMA software to locate significant differential signals on the Chr09 chromosome, thereby obtaining the correct specific deletion sequence.

[0020] The nucleotide sequence of the specific DNA fragment is as follows: ACCTAATTACTTATACAAATACCTGCT (SEQ ID NO: 1) has a full length of 27 bp. In mutant (thick-shelled) individuals, the above sequence is mutated to a single base A, i.e., a 26 bp fragment deletion occurs.

[0021] The flowchart of the method for identifying the shell thickness of the Chinese mitten crab in this invention is as follows: Figure 1 As shown.

[0022] Example 1 DNA Extraction (1) Sample collection 182 mature Chinese mitten crab individuals were selected, and their STI values ​​were measured according to the above standards. Based on the STI values, 8 thin-shelled individuals and 8 thick-shelled individuals were selected. The population originated from Yili, Xinjiang; Dongying, Shandong; Nanjing, Suzhou, and Yancheng, Jiangsu; Wuhu, Anhui; and Xiaogan, Hubei. Walking leg tissue samples were taken from the Chinese mitten crabs using the following method: The crabs were washed and each crab was placed individually in a rearing box containing aerated water. After the Chinese mitten crabs stabilized, the tips of non-functional walking legs (such as the third or fourth walking leg; damage to the walking legs has no impact on the growth and development of the crabs) were quickly cut off with scissors. Tissue samples were collected from both thin-shelled and thick-shelled individuals, flash-frozen in liquid nitrogen for 30 min, and stored in an ultra-low temperature freezer at -80℃. Thin-shelled individuals were designated EsB, and thick-shelled individuals were designated EsH.

[0023] Thin-shell group: Includes samples EsB01 to EsB08. The STI values ​​of this group are: 0.001409, 0.001264, 0.001201, 0.001156, 0.001099, 0.000920, etc. (outliers were removed from some samples). The average shell thickness index of the samples is approximately 0.001175. g / mm 2 .

[0024] Thick-shell group: Includes samples EsH01 to EsH08. The STI values ​​of this group are highly concentrated, at 0.001975, 0.001972, 0.001910, 0.001909, 0.001895, 0.001862, 0.001813, and 0.001813 respectively. The average shell thickness index of the samples is approximately 0.001894. g / mm 2 .

[0025] Analysis of significant differences: The mean STI value of the thick-shell group (0.001894) was significantly higher than that of the thin-shell group (0.001175), approximately 1.61 times that of the thin-shell group. The difference was highly significant after a t-test. P<0.001 This confirms that the selected samples exhibit typical extreme differences in phenotype, ensuring the high authenticity and reliability of the loci identified by GWAS analysis.

[0026] (2) Genomic DNA extraction S1: Take approximately 50 mg of walking leg muscle tissue from the Chinese mitten crab, mince it or grind it into powder using liquid nitrogen, and place it in a 1.5 mL centrifuge tube. Add 200 μL of Buffer ACL and 20 μL of Proteinase K sequentially, and vortex thoroughly to mix until there are no obvious particulate substances in the solution; S2: Place the centrifuge tube in a 56°C water bath and incubate until the tissue is completely digested (about 3 hours). During this period, the tube can be inverted and mixed several times to promote digestion. S3: Add 200 μL of Buffer BCL to the digestion solution and shake thoroughly to mix. S4: Add 150 μL of anhydrous ethanol, shake to mix. At this time, flocculent precipitate may appear. Briefly centrifuge to collect the liquid on the inner wall of the tube cap. S5: Place the FastPure gDNA Mini Columns II adsorption column into a 2 mL collection tube, and transfer the entire mixture obtained in step S4 (including the flocculent precipitate) into the adsorption column. Centrifuge at 12,000 rpm (13,400 × g) for 1 min; S6: Discard the filtrate and return the adsorption column to the collection tube. Add 500 μL of Buffer WA along the tube wall to the adsorption column and centrifuge at 12,000 rpm (13,400 × g) for 1 min; S7: Discard the filtrate and return the adsorption column to the collection tube. Add 600 μL of Buffer WB along the tube wall to the adsorption column and centrifuge at 12,000 rpm (13,400 × g) for 1 min; S8: Transfer the adsorption column to a new 1.5 mL centrifuge tube. Add 50 μL of solution buffer (preheated to 55°C) to the center of the adsorption column membrane and incubate at room temperature for 5 min. Centrifuge at 12,000 rpm (13,400 × g) for 1 min and collect the DNA product. After concentration determination and electrophoresis, store at -20°C.

[0027] Example 2: Molecular marker verification of the shell thickness trait in Chinese mitten crab Specific primer pairs designed based on SEQ ID NO: 2, which extracts 400 bp sequences before and after the start site of SEQ ID NO: 1: Upstream primer (Es-2655-F): TACCTGCCTGCTTACCTAT (SEQ ID NO: 3); Downstream primer (Es-2655-R): CCAGTTACCTGCCTGTTAA (SEQ ID NO: 4); 20 µL PCR reaction system: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 3 and SEQ ID NO: 4), 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water; PCR reaction procedure: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 56℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃. Take 5 μL of PCR amplification product and load it onto a 5% agarose gel. Load 5 μL of 20 bp DNA ladder (Dye Plus) onto lanes 6 and 12. Electrophoresis is performed at 120 V for 30 min, and the electrophoresis results are analyzed using a BioLearning gel imaging system.

[0028] Identification of shell thickness trait: For thin-shelled individuals in lanes 1 to 8, the electrophoresis results showed a single specific band of approximately 148 bp, indicating a homozygous wild-type genotype (not carrying the dominant thick-shell allele); For thick-shelled individuals in lanes 10 to 16, the electrophoresis results showed a specific band of approximately 122 bp, or both 148 bp and 122 bp bands, indicating a homozygous mutant or heterozygous genotype (carrying the dominant thick-shell allele).

[0029] Example 3: Molecular marker-assisted live breeding of the shell thickness trait in Chinese mitten crab. (1) Sample collection: 500 individuals were randomly selected from a Chinese mitten crab population, which originated from a breeding base in Gucheng Lake, Gaochun District, Nanjing City. The walking leg tissue of the Chinese mitten crabs was sampled as follows: The crabs were washed and temporarily kept in an aquarium. After the crabs stabilized, the tips of the non-functional walking legs (the third or fourth walking leg) were quickly cut off with scissors. Tissue samples from all individuals were collected, flash-frozen in liquid nitrogen for 30 min, and stored in an ultra-low temperature freezer at -80℃. The samples were numbered sequentially from B000 to B499. (2) Genomic DNA extraction: The DNA extraction process is the same as in Example 1; (3) Determination of crab shell thickness: 20 µL PCR reaction system: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers (SEQ ID NO: 3 and SEQ ID NO: 4), 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water; PCR reaction procedure: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 56℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃. Take 5 μL of PCR amplification product and load it onto a 5% agarose gel. Load 5 μL of 20 bp DNA Ladder (Dye Plus) onto lane 9, electrophoresis at 120V for 30 min, and then analyze the electrophoresis results using a BioLearning gel imaging system.

[0030] Identification of shell thickness trait: Individuals with a specific band size in the range of 140 bp to 160 bp (specifically 148 bp) are identified as Chinese mitten crabs that do not carry the dominant thick-shell allele (homozygous wild type); individuals with a specific band size of around 120 bp (specifically 122 bp), or individuals with both 122 bp and 148 bp bands detected simultaneously, are identified as Chinese mitten crabs that carry the dominant thick-shell allele (homozygous mutant or heterozygous type, carrying the dominant thick-shell gene).

[0031] Group validation results as follows Figure 4 As shown: Individuals B002, B067, B103, B459, and B489 only amplified a single 148 bp band, and were identified as not carrying the thick-shell dominant allele, and were used for ordinary commercial crab farming; Individuals B003, B046, B121, B463, and B466 amplified two bands, 122 bp and 148 bp; Individuals B027, B074, B0167, B370, and B373 amplified a 122 bp specific band (including homozygous and heterozygous double bands), and were identified as carrying the thick-shell dominant allele, and were retained as core parents for subsequent germplasm breeding.

[0032] (4) Phenotypic sampling backtesting: To further verify the predictive power of the aforementioned molecular markers in actual breeding populations, 40 samples were randomly selected from the 500 individuals that had completed genotyping for retrospective phenotypic verification. Among these, 20 individuals were identified by PCR as carrying the thick-shell dominant allele, and 20 individuals were not carrying the thick-shell dominant allele. Following the aforementioned "shell thickness index (STI)" measurement standard, these 40 sampled individuals were dissected, and their dry shell weight (M), carapace length (L), and carapace width (W) were measured to calculate the actual STI value.

[0033] Results: The actual average STI value of the 20 samples carrying the thick-shell dominant allele was 0.00169. g / mm² The actual average STI value of the 20 samples that did not carry the thick-shell dominant allele was 0.00130. g / mm² Further statistical results showed that among the 40 samples, 20 individuals carrying the thick-shell dominant allele had an actual STI ≥ 0.00140 g / mm², achieving a 100% concordance rate for the thick-shell phenotype; while among the 20 individuals not carrying the thick-shell dominant allele, 18 had an actual STI ≤ 0.00140 g / mm², achieving a 90.0% concordance rate for the thin-shell phenotype.

[0034] Verification conclusion: The difference was found to be highly significant. P<0.05 The results of the sampling verification data show that the genotypic identification of the deletion molecular marker is highly consistent with the actual shell thickness phenotype of the Chinese mitten crab. This fully confirms that the molecular marker developed in this invention is not only theoretically effective, but also has extremely high phenotypic predictive power in actual live breeding populations, and can be accurately and efficiently applied to early-stage assisted breeding of the thick-shell trait in the Chinese mitten crab.

[0035] The above description is merely a preferred embodiment of the present invention. All equivalent variations and modifications made within the scope of the claims of this invention should be considered within the scope of this invention. The referenced sequences are as follows: The sequence number SEQ ID NO1 is: 1ACCTAATTACTTATACAAATACCTGCT. . TACCTGCCTGCTTACCTAT . CCAGTTACCTGCCTGTTAA.

[0036] The above description is only a part of the embodiments of the present invention and is not intended to limit the present invention to other implementation methods.

Claims

1. A molecular marker for identifying the shell thickness trait of the Chinese mitten crab and its application, characterized in that: The molecular marker is located on chromosome 9 (Chr09) of the Chinese mitten crab genome, version number GCA_024679095.

1. Esine02655 Gene region; the molecular marker exhibits sequence length polymorphism, including two allele types: wild-type allele: nucleotide sequence ACCTAATTACTTATACAAATACCTGCT, length 27 bp; mutant allele: the sequence shown in SEQ ID NO: 1 above is mutated to a single base A, with a 26 bp sequence deletion compared to the wild type.

2. An auxiliary detection and breeding method for the shell thickness trait of the Chinese mitten crab, characterized in that: This is achieved by identifying the specific DNA sequence as described in claim 1.

3. The identification method according to claim 2, characterized in that, Includes the following steps: (1) Collect the walking leg muscle tissue of Chinese mitten crab and extract the genomic DNA of Chinese mitten crab; (2) PCR amplification was performed using genomic DNA as a template; the upstream primer for the PCR amplification was SEQ ID NO: 3, and the downstream primer was SEQ ID NO: 4; (3) The amplification products were detected by 5% agarose gel electrophoresis. If a specific amplification band of about 122 bp was detected or both 122 bp and 148 bp amplification bands were detected, it was determined that the product carried the thick-shell dominant allele. If a specific amplification band of about 148 bp was detected, it was determined that the product did not carry the thick-shell dominant allele.

4. The identification method according to claim 3, characterized in that: The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 15 sec, 56℃ annealing for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ extension for 5 min, storage at 4℃.

5. The identification method according to claim 3, characterized in that: The PCR amplification reaction system consisted of: 10 μL of 2 × Rapid Taq Master Mix, 1 μL each of 10 μM upstream and downstream primers, 1 μL of 50 ng / μL DNA template, and 7 μL of ultrapure water.

6. A primer pair for identifying the shell thickness trait of the Chinese mitten crab, characterized in that: The upstream primer of the primer pair is SEQ ID NO: 3, and the downstream primer is SEQ ID NO:

4.

7. A kit for identifying the shell thickness of the Chinese mitten crab, characterized in that: The kit contains the primer pair as described in claim 6.

Images