A kind of pinespine coccid SS-COI PCR detection primer pair, kit and detection method

Abstract

The present application relates to molecular detection technology field of Dreyfusia nordmannianae Takahashi, in particular to a kind of Dreyfusia nordmannianae Takahashi SS-COI PCR detection primer pair, kit and detection method.Dreyfusia nordmannianae Takahashi SS-COI PCR detection primer pair includes Dreyfusia nordmannianae Takahashi SS-COI PCR detection primer pair-1 or Dreyfusia nordmannianae Takahashi SS-COI PCR detection primer pair-3.The detection limit of Dreyfusia nordmannianae Takahashi SS-COI PCR detection primer pair-1 provided by the present application is 1.56ng / μL DNA concentration, and the detection limit of Dreyfusia nordmannianae Takahashi SS-COI PCR detection primer pair-3 is 1.56×10 ‑1 ng / μL, indicating high detection sensitivity.

Description

Technical Field

[0001] This invention relates to the field of molecular detection technology for Juniperus chinensis mealybug, and in particular to a primer pair, kit, and detection method for SS-COI PCR detection of Juniperus chinensis mealybug. Background Technology

[0002] The juniper mealybug (Planococcus vovae) belongs to the genus *Planococcus Ferris* of the family Pseudococcidae in the order Hemiptera. It primarily infests over 20 species of cypress plants belonging to four genera: *Platycladus*, *Cypress*, *Juniperus*, and *Thuja*. Both adult females and nymphs feed by sucking sap from the host plant, while simultaneously secreting large amounts of honeydew, which induces sooty mold, affecting photosynthesis and causing yellowing and premature leaf drop, as well as branch dieback. The juniper mealybug is widely distributed in Europe, the Mediterranean region, and southwestern Asia, and was previously unrecorded in China. It was first discovered on cypress trees in Langfang City, Hebei Province in June 2020, and was also found in Beijing that same year, indicating a new invasive pest event.

[0003] In recent years, several species of mealybugs have been recorded and discovered in my country, including *Planococcus minor*, *Planococcus lilacinus*, *Planococcus kraunhiae*, and *Planococcus citri*. Due to the similarity in morphological characteristics among different mealybug species, and when some insect stages or sample integrity are insufficient, traditional morphological methods alone cannot provide rapid and accurate species identification, posing significant challenges to port quarantine and grassroots forestry protection efforts. Therefore, developing rapid molecular detection technologies for different populations and developmental stages of *Planococcus juniper* mealybugs is of great significance for improving port control capabilities and early prevention and control effectiveness.

[0004] Currently, Species-Specific COI (SS-COI) PCR detection technology has become an important method for the rapid detection of various pests. This technology utilizes species-specific COI primers for PCR amplification, identifying the sample based on the presence or absence of the expected DNA band. It eliminates the need for sequencing and sequence alignment, offering advantages such as high sensitivity, strong specificity, good reproducibility, and speed and simplicity. The key to this technology lies in obtaining highly specific and sensitive PCR primers. Once specific primers are obtained, rapid and accurate detection and identification of the juniper mealybug can be achieved. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides a primer pair, kit, and detection method for the SS-COI PCR detection of *Juniperus chinensis* mealybug. Using the SS-COI PCR detection primers provided by this invention, *Juniperus chinensis* mealybug can be specifically detected, with sensitivities reaching 1.56 ng / μL and 1.56 × 10⁻⁶ ppm, respectively. -1 ng / μL.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a primer pair for SS-COI PCR detection of Juniperus chinensis mealybug, including primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1) or primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3).

[0008] The nucleotide sequence of the upstream primer of the SS-COI PCR detection primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1) of the Juniperus chinensis mealybug is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2.

[0009] The nucleotide sequence of the upstream primer of the SS-COI PCR detection primer pair -3 (PVSSCOI-F-3 / PVSSCOI-R-3) of the Juniperus chinensis is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 6.

[0010] The present invention also provides the application of the SS-COI PCR detection primer pair of Juniperus chinensis described in the above technical solution in the detection of Juniperus chinensis.

[0011] The present invention also provides a kit for detecting Juniperus chinensis mealybug, comprising the Juniperus chinensis mealybug SS-COI PCR detection primer pair described in the above technical solution.

[0012] Preferably, the kit also includes 2×Taq Plus PCR Master Mix.

[0013] This invention also provides a method for detecting the mealybug *Pseudobulbus juniper*, comprising the following steps:

[0014] 1) Extract DNA from the sample to be tested;

[0015] 2) Using the DNA of the sample to be tested described in step 1) as a template, perform PCR amplification using the SS-COI PCR detection primer pair of Juniperus chinensis described in the above technical solution to obtain the amplification product;

[0016] 3) Perform agarose gel electrophoresis on the amplification product described in step 2). When an amplification band of 190bp or 220bp appears, the sample to be tested is Juniperus chinensis mealybug.

[0017] Preferably, the PCR amplification system in step 2) is: 12.5 μL of 2×Taq Plus PCR Master Mix, 1 μL of upstream primer with a concentration of 10 μmol / L, 1 μL of downstream primer with a concentration of 10 μmol / L, 2 μL of template, and 8.5 μL of ddH2O.

[0018] Preferably, the PCR amplification program in step 2) is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 48~58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; and finally 72℃ extension for 2 min.

[0019] Preferably, when the primer pair for detecting Juniperus chinensis SS-COI PCR is primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1), the amplification product will show a 190bp amplification band after agarose gel electrophoresis.

[0020] The annealing temperature in the PCR amplification program is 48~58℃.

[0021] Preferably, when the primer pair for detecting *P. juniper* SS-COI PCR is primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3), the amplification product will show a 220bp amplification band after agarose gel electrophoresis.

[0022] The annealing temperature in the PCR amplification program is 48~54℃.

[0023] The beneficial effects of this invention are:

[0024] Specificity detection results show that the primer pair provided by this invention has good specificity and can specifically amplify *Cypress mealybug*. No target amplification bands were generated for *Cypress mealybug*, *Nanyan mealybug*, or *Ocean mealybug*. This indicates that the SS-COI PCR detection primers and method for *Cypress mealybug* provided by this invention have good specificity and are suitable for rapid and accurate detection of *Cypress mealybug*.

[0025] This invention performed PCR amplification at six different annealing temperatures. By comparing the amplification results, it was found that when the annealing temperatures were 48℃, 50℃, 52℃, 54℃, 56℃, or 58℃, the PVSSCOI-F-1 primer pair (PVSSCOI-R-1) for the SS-COI PCR detection of *Juniperus chinensis* only produced amplification bands in *Juniperus chinensis* samples, while closely related species did not produce amplification bands. Similarly, when the annealing temperatures were 48℃, 50℃, 52℃, or 54℃, the PVSSCOI-F-3 primer pair (PVSSCOI-R-3) for the SS-COI PCR detection of *Juniperus chinensis* only produced amplification bands in *Juniperus chinensis* samples, while closely related species did not produce amplification bands. To ensure primer specificity and PCR amplification efficiency, 54℃ was selected as the annealing temperature for subsequent experiments.

[0026] Sensitivity test results showed that the detection limit DNA concentration of primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1) for the SS-COI PCR detection of *P. juniper* mealybug provided in this invention was 1.56 ng / μL, and the detection limit DNA concentration of primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3) was 1.56 × 10⁻⁶. -1 A concentration of ng / μL indicates high detection sensitivity. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0028] Figure 1 A schematic diagram illustrating primer design based on partial sequences of the COI gene from five species of mealybugs;

[0029] Figure 2 Electrophoretic image showing the amplification results of *Planococcus vovae* and three other *Planococcus* species using primers Planococcus-F / Planococcus-R (M: DNA marker; 1: *Planococcus vovae*; 2: *Planococcus citri*; 3: *Planococcus lilacinus*; 4: *Planococcus minor*; NTC: negative control).

[0030] Figure 3 A schematic diagram of the design of juniper-specific primers PVSSCOI-F-1 / PVSSCOI-R-1 and PVSSCOI-F-3 / PVSSCOI-R-3 based on partial sequences in the COI genes of five species of mealybugs.

[0031] Figure 4 Electrophoretic images showing the amplification results of *Planococcus vovae* and three other *Planococcus* species using different primer pairs (M: DNA marker; 1: *Planococcus vovae*; 2: *Planococcus citri*; 3: *Planococcus lilacinus*; 4: *Planococcus minor*; NTC: negative control).

[0032] Figure 5 Screening of annealing temperatures for PCR amplification of SS-COI primer pair 1 (PVSSCOI-F-1 / PVSSCOI-R-1) and primer pair 3 (PVSSCOI-F-3 / PVSSCOI-R-3) (M: DNA marker; 1: *Planococcus vovae*, *Planococcus citri*, *Planococcus lilacinus*, *Planococcus minor*, *Planococcus minor*; NTC: negative control).

[0033] Figure 6 Electrophoretic images of amplification of eggs, nymphs, and adults of *Juniperus chinensis* using SS-COI primer pair 1 (PVSSCOI-F-1 / PVSSCOI-R-1) and primer pair 3 (PVSSCOI-F-3 / PVSSCOI-R-3) (M: DNA marker; 1: *Juniperus chinensis* egg / Beijing; 2: *Juniperus chinensis* nymph / Beijing; 3: *Juniperus chinensis* adult / Beijing; 4: *Juniperus chinensis* egg / Langfang; 5: *Juniperus chinensis* nymph / Langfang; 6: *Juniperus chinensis* adult / Langfang; NTC: negative control).

[0034] Figure 7 Electrophoretic imaging results of DNA amplification from 10-fold diluted *P. juniper* mealybug samples using SS-COI primer pair 1 (PVSSCOI-F-1 / PVSSCOI-R-1) and primer pair 3 (PVSSCOI-F-3 / PVSSCOI-R-3). (M: DNA marker; 1: 156 ng / μL; 2: 15.6 ng / μL; 3: 1.56 ng / μL; 4: 1.56 × 10⁻⁶) -1 ng / μL; 5: 1.56×10 -2 ng / μL; 6: 1.56×10 -3 ng / μL; 7: 1.56×10 -4 ng / μL; 8: 1.56×10 -5ng / μL; 9: 1.56×10 -6 ng / μL; NTC: negative control). Detailed Implementation

[0035] This invention provides a primer pair for SS-COI PCR detection of *P. juniper* mealybug, including primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1) or primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3); the nucleotide sequence of the upstream primer of primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1) is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2; the nucleotide sequence of the upstream primer of primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3) is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 6.

[0036] SEQ ID No. 1:

[0037] AGGATGAACTTTATATCCTCCT;

[0038] SEQ ID No. 2:

[0039] GATAATGATTGATCAAATATAGAGG;

[0040] SEQ ID No. 5:

[0041] CGGAATTTCATCAATCTTTAG;

[0042] SEQ ID No. 6:

[0043] ACCATTTCCTAAAGGATTAAAG.

[0044] The present invention also provides the application of the SS-COI PCR detection primer pair of Juniperus chinensis described in the above technical solution in the detection of Juniperus chinensis.

[0045] This invention also provides a kit for detecting the juniper mealybug, comprising the SS-COI PCR detection primer pair for the juniper mealybug described in the above-mentioned technical solution. Preferably, the kit further comprises 2×Taq Plus PCR Master Mix.

[0046] This invention also provides a method for detecting the mealybug *Pseudobulbus juniper*, comprising the following steps:

[0047] 1) Extract DNA from the sample to be tested;

[0048] 2) Using the DNA of the sample to be tested described in step 1) as a template, perform PCR amplification using the SS-COI PCR detection primer pair of Juniperus chinensis described in the above technical solution to obtain the amplification product;

[0049] 3) Perform agarose gel electrophoresis on the amplification product described in step 2). When an amplification band of 190bp or 220bp appears, the sample to be tested is Juniperus chinensis mealybug.

[0050] This invention extracts DNA from samples to be tested. The method for extracting DNA from the samples to be tested is not particularly limited; those skilled in the art can use conventional extraction methods.

[0051] This invention uses the DNA of the sample to be tested as a template and performs PCR amplification using the SS-COI PCR detection primer pair for *Juniperus chinensis* as described in the above technical solution to obtain the amplified product. In this invention, the preferred PCR amplification system is: 12.5 μL of 2×Taq Plus PCR Master Mix, 1 μL of 10 μmol / L upstream primer, 1 μL of 10 μmol / L downstream primer, 2 μL of template, and 8.5 μL of ddH2O. In this invention, the preferred PCR amplification program is: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 48-58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; and a final extension at 72℃ for 2 min.

[0052] In this invention, when the primer pair for detecting *P. juniper* mealybug SS-COI PCR is primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1), the amplification product, after agarose gel electrophoresis, preferably shows a 190 bp amplification band. In this invention, the annealing temperature in the PCR amplification program is preferably 48-58℃.

[0053] In this invention, when the primer pair for detecting *P. juniper* mealybug SS-COI PCR is primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3), the amplification product, after agarose gel electrophoresis, preferably shows a 220 bp amplification band. In this invention, the annealing temperature in the PCR amplification program is preferably 48-54℃.

[0054] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0055] Example 1

[0056] Total DNA extraction from *Juniperus chinensis* mealybug and closely related species, and screening of specific primers.

[0057] Total DNA extraction from 1 Juniper mealybug and closely related species

[0058] Take the test sample (see Table 1), grind it into powder with liquid nitrogen, and extract the sample DNA using a micro sample genomic DNA extraction kit (TIANGEN).

[0059] Table 1 Sample Details

[0060]

[0061] Because the universal primers LCO1490 / HCO2198 did not amplify well in the above samples, primers Planococcus-F / Planococcus-R were designed based on conserved fragments in the COI genes of *Planococcus juniper*, *Planococcus citrus*, *Planococcus aurantiacus*, *Planococcus natans*, and *Planococcus japonicus*. The product length was 477 bp. Figure 1 Using the DNA from the above samples as templates, primers (Table 2) were used to amplify the mitochondrial COI gene fragment to verify the usability of the sample DNA. The total PCR amplification system was 25 μL: 12.5 μL of 2×Taq Plus PCR Master Mix (Beijing Ruiboxingke Biotechnology Co., Ltd.), 1 μL each of upstream and downstream primers Planococcus-F / Planococcus-R (10 μmol / L), 2 μL of DNA template, and purified water to a final volume of 25 μL. The PCR amplification program was: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles, with a final extension at 72℃ for 2 min. After PCR amplification, all samples showed bright and clear amplified bands at the target band position after 1.2% agarose gel electrophoresis, indicating that the sample DNA could be used for subsequent detection. Figure 2 ).

[0062] Table 2 Primer information for PCR amplification of four species of mealybug.

[0063]

[0064] Where W represents A / T and R represents A / G.

[0065] 2. Screening of specific primers for *Juniperus chinensis* mealybug

[0066] Primers were designed based on sequences in the COI gene of *Cypress mealybug* that differ significantly from those of other insects in the genus *Metabolum* (citrus mealybug, southern mealybug, oceanic mealybug, and Japanese mealybug). Figure 3 After sequence alignment, five primer pairs were designed for PCR amplification of *Pseudomonas juniper*, *Pseudomonas citrus*, *Pseudomonas aurantiacus*, and *Pseudomonas paederi* (Table 3). The total PCR amplification system was 25 μL: 12.5 μL of 2×Taq Plus PCR Master Mix (Beijing Ruiboxingke Biotechnology Co., Ltd.), 1 μL each of forward and reverse primers (10 μmol / L), 2 μL of DNA template, and purified water to a final volume of 25 μL. The PCR amplification program was: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles, with a final extension at 72℃ for 2 min. After the PCR reaction, agarose gel electrophoresis was performed. The results showed that only primers 1 and 3 showed amplification bands in the *Pseudomonas juniper* sample, while no amplification bands were found in other closely related species. Therefore, primers 1 and 3 had good specificity. Figure 4 ).

[0067] Table 3 PCR amplification primer information

[0068]

[0069] The target fragment amplified by the SS-COI PCR detection primer pair -1 is 190bp. This primer pair is named PVSSCOI-F-1 / PVSSCOI-R-1, and the specific information is as follows:

[0070] Upstream primer PVSSCOI-F-1: 5'-AGGATGAACTTTATATCCTCCT-3' (SEQ ID No. 1);

[0071] Downstream primer PVSSCOI-R-1: 5'-GATAATGATTGATCAAATATAGAGG-3' (SEQ ID No. 2).

[0072] The target fragment amplified by the SS-COI PCR detection primer pair -3 was 220bp. This primer pair was named PVSSCOI-F-3 / PVSSCOI-R-3, and the specific information is as follows:

[0073] Upstream primer PVSSCOI-F-3: 5'-CGGAATTTCATCAATCTTTAG-3' (SEQ ID No. 5);

[0074] Downstream primer PVSSCOI-R-3: 5'-ACCATTTCCTAAAGGATTAAAG-3' (SEQ ID No. 6).

[0075] Example 2

[0076] Primer pair PVSSCOI-F / PVSSCOI-R PCR amplification annealing temperature screening

[0077] To determine the optimal annealing temperature for primer pair PVSSCOI-F / PVSSCOI-R in PCR amplification, six annealing temperatures were tested: 48℃, 50℃, 52℃, 54℃, 56℃, and 58℃. The total PCR amplification system was 25 μL: 12.5 μL of 2×Taq Plus PCR Master Mix (Beijing Ruiboxingke Biotechnology Co., Ltd.), 1 μL each of forward and reverse primers PVSSCOI-F / PVSSCOI-R (10 μmol / L), 2 μL of DNA template, and purified water to a final volume of 25 μL. The PCR amplification program was: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, annealing at 48℃, 50℃, 52℃, 54℃, 56℃, or 58℃ for 30 s, extension at 72℃ for 30 s, for a total of 30 cycles, with a final extension at 72℃ for 2 min, varying only the annealing temperature. The samples in Table 1 were used as examples.

[0078] All samples were subjected to 1.2% agarose gel electrophoresis, and the amplification results are as follows: Figure 5 As shown in the figure, four samples were subjected to PCR amplification at six different annealing temperatures. Comparison of the amplification results revealed that primer pair 1 (PVSSCOI-F-1 / PVSSCOI-R-1) produced amplification bands only in the *Citrus juniper* mealybug sample at all six annealing temperatures, while closely related species did not produce amplification bands. Primer pair 3 (PVSSCOI-F-3 / PVSSCOI-R-3) produced weak bands in *Citrus citrus mealybug* at annealing temperatures of 56℃ and 58℃. To ensure primer specificity and PCR amplification efficiency, 54℃ was selected as the annealing temperature for subsequent experiments.

[0079] Example 3

[0080] Stability and sensitivity testing of primer pair PVSSCOI-F / PVSSCOI-R

[0081] 1. Primer stability test

[0082] The eggs and adults of *Juniperus chinensis* mealybug were ground into powder with liquid nitrogen. DNA was extracted from the samples using a micro-sample genomic DNA extraction kit (TIANGEN). DNA was extracted directly from nymphs using the same kit. Specific sample information is shown in Table 4.

[0083] Table 4. Information on different life stages of *Mealybug juniper*.

[0084]

[0085] Using the DNA from the above samples as templates, PCR amplification was performed using the *P. juniper*-specific primers PVSSCOI-F / PVSSCOI-R. The total PCR amplification system was 25 μL: 12.5 μL of 2×Taq Plus PCR Master Mix (Beijing Ruiboxingke Biotechnology Co., Ltd.), 1 μL each of forward and reverse primers PVSSCOI-F / PVSSCOI-R (10 μmol / L), 2 μL of DNA template, and purified water to a final volume of 25 μL. The PCR amplification program was: 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles, followed by a final extension at 72℃ for 2 min.

[0086] The amplification results of primer pair PVSSCOI-F / PVSSCOI-R among different populations and developmental stages of *Juniperus chinensis* mealybug are as follows: Figure 6 As shown. According to Figure 6 The amplification results showed that amplification bands were present in the egg, nymph, and adult samples of *Juniperus chinensis* collected from Beijing and Langfang. This indicates that the primers and PCR program can reliably detect *Juniperus chinensis* and are suitable for the detection of its eggs, nymphs, and adults.

[0087] 2. Primer sensitivity detection test

[0088] Taking sample DNA (adult *Mealyptus langfangensis*) from Table 4 (sample number 6) as an example, sensitivity limit tests were performed using 10-fold serial dilutions. The DNA concentration was measured as 156 ng / μL for sample 1 using a NanoDrop ND-100 spectrophotometer (NanoDrop Technologies, Inc., USA). The DNA was then diluted to 15.6 ng / μL for sample 2, 1.56 ng / μL for sample 3, and 1.56 × 10⁻⁶ ng / μL for sample 4. -1 ng / μL, No. 5 1.56×10 -2 ng / μL, No. 6 1.56×10 -3 ng / μL, No. 7 1.56×10 -4 ng / μL, No. 8 1.56×10 -5 ng / μL, No. 9 1.56×10 - 6 Using samples 1-9 as templates, PCR amplification was performed with primers PVSSCOI-F / PVSSCOI-R at ng / μL (the PCR amplification system and PCR amplification procedure were the same as described above).

[0089] The amplification results of the diluted DNA sample are as follows: Figure 7 As shown. According to Figure 7 As can be seen, when using PVSSCOI-F-1 / PVSSCOI-R-1 as primers for amplification, a very faint band is produced when the DNA concentration is 1.56 ng / μL (primer #3). No band is produced for samples with DNA concentrations lower than 1.56 ng / μL (primer #3) and for the blank control (using sterile water as a template). When using PVSSCOI-F-3 / PVSSCOI-R-3 as primers for amplification, a band is produced when the DNA concentration is 1.56 × 10⁻⁶ (primer #4). -1 At ng / μL, a very faint band will be produced, indicating a DNA concentration less than 1.56 × 10⁻⁶ in sample #4. -1 No bands were generated in either the ng / μL sample or the blank control (using sterile water as a template). Therefore, the detection limit DNA concentration for primer pair-1 (PVSSCOI-F-1 / PVSSCOI-R-1) of *P. juniper mealybug* SS-COI PCR detection is 1.56 ng / μL, and the detection limit DNA concentration for primer pair-3 (PVSSCOI-F-3 / PVSSCOI-R-3) of *P. juniper mealybug* SS-COI PCR detection is 1.56 × 10⁻⁶ ng / μL. -1 ng / μL.

[0090] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer pair for SS-COI PCR detection of *Juniperus chinensis* mealybug, characterized in that, Including primer pair-1 or primer pair-3 for SS-COI PCR detection of Juniperus chinensis mealybug; The nucleotide sequence of the upstream primer of the SS-COI PCR detection primer pair -1 for *Juniperus chinensis* is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

2. The nucleotide sequence of the upstream primer of primer pair -3 for the SS-COI PCR detection of *Juniperus chinensis* is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

6.

2. The application of the SS-COI PCR detection primer pair of Juniperus chinensis as described in claim 1 in the detection of Juniperus chinensis.

3. A reagent kit for detecting the mealybug *Pseudobulbus juniper*, characterized in that, Includes the SS-COI PCR detection primer pair for *Juniperus chinensis* as described in claim 1.

4. The reagent kit according to claim 3, characterized in that, The kit also includes 2×Taq Plus PCRMaster Mix.

5. A method for detecting the mealybug *Pseudobulbus juniper*, characterized in that, Includes the following steps: 1) Extract DNA from the sample to be tested; 2) Using the DNA of the sample to be tested described in step 1) as a template, PCR amplification was performed using the SS-COI PCR detection primer pair of Juniperus chinensis as described in claim 1 to obtain the amplification product; 3) Perform agarose gel electrophoresis on the amplification product described in step 2). When an amplification band of 190bp or 220bp appears, the sample to be tested is Juniperus chinensis mealybug.

6. The method according to claim 5, characterized in that, Step 2) The PCR amplification system is as follows: 12.5 μL of 2×TaqPlus PCR Master Mix, 1 μL of upstream primer with a concentration of 10 μmol / L, 1 μL of downstream primer with a concentration of 10 μmol / L, 2 μL of template, and 8.5 μL of ddH2O.

7. The method according to claim 5, characterized in that, Step 2) The PCR amplification program is as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 30 s, 48~58℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30 cycles; and finally 72℃ extension for 2 min.

8. The method according to claim 5, characterized in that, When the SS-COI PCR detection primer pair for Juniperus chinensis is SS-COI PCR detection primer pair-1, the amplification product shows a 190bp amplification band after agarose gel electrophoresis. The annealing temperature in the PCR amplification program is 48~58℃.

9. The method according to claim 5, characterized in that, When the SS-COI PCR detection primer pair for Juniperus chinensis is SS-COI PCR detection primer pair-3, the amplification product shows a 220bp amplification band after agarose gel electrophoresis. The annealing temperature in the PCR amplification program is 48~54℃.

Images