A molecular module related to oyster fatty acid content and high temperature tolerance and application thereof

Abstract

The application discloses a molecular module related to oyster fatty acid content and high-temperature resistance and application thereof, and belongs to the field of genetic engineering and aquatic genetic breeding. The molecular module comprises two molecular markers of TG / T mutation at the 227th position and CA / C mutation at the 1778th position in the sequence shown in SEQ ID NO. 1. The application further provides a detection primer pair with nucleotide sequences shown in SEQ ID NO. 4 and SEQ ID NO. 5 respectively. The molecular module is typed by PCR-Sanger sequencing, and can screen high-temperature-resistant individuals (TGTG / CACA) or high-fat acid content individuals (TT / CC), has the advantages of low detection cost, simple operation and high breeding efficiency, and is suitable for oyster molecular marker assisted breeding.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and aquatic genetic breeding, and in particular to a molecular module related to fatty acid content and high-temperature tolerance of oysters and its applications. Background Technology

[0002] Oysters are the highest-yielding farmed shellfish species and an important marine economic resource. In recent years, frequent extreme temperature events, such as high summer temperatures, have led to frequent mass mortality in oyster farming areas, causing severe economic losses. At the same time, the oyster industry generally suffers from insufficient nutritional quality and poor stability under environmental stress, resulting in a large industry size but weak competitiveness per unit output. Long-chain polyunsaturated fatty acids (such as EPA and DHA) are not only core indicators for measuring the nutritional quality of oysters but also key components of cell membrane phospholipids, participating in physiological processes such as cell morphology maintenance, substance transport, and signal transduction by regulating membrane fluidity and stability. Therefore, cultivating new oyster varieties with both high unsaturated fatty acid content and good temperature adaptability has become an urgent need to promote the high-quality development of the industry.

[0003] Traditional aquatic breeding mainly relies on selective breeding, hybridization breeding, and polyploid breeding to select for phenotypic traits such as growth rate and disease resistance. However, these methods generally suffer from long generation cycles and low selection efficiency. For nutritional quality traits such as fatty acid content, progress has been particularly slow due to the need to destroy samples for live testing and the low throughput of conventional chemical analysis. The rise of molecular breeding technology has provided a new path to address these challenges. Genome-wide selection breeding has made some progress in species such as scallops and tilapia, but it relies on high-density genome-covered SNP chips or resequencing data, resulting in high genotyping costs for individual individuals. This severely restricts its large-scale application for low-priced, mass-farmed shellfish like oysters. Therefore, there is an urgent need to develop low-cost, high-efficiency targeted breeding strategies.

[0004] Molecular module breeding focuses on functional units composed of major genes or regulatory networks that control target traits. By identifying key sites through genetic mapping and validating their functions, these modules are directly applied to breeding screening. This significantly reduces costs while effectively improving breeding efficiency. It has been first implemented in crops such as wheat and rice, and its feasibility in aquaculture has been preliminarily verified in the breeding of new oyster varieties with high glycogen content. However, the molecular regulatory mechanism linking fatty acid content and temperature adaptability in oysters remains unclear, and stable molecular markers and functional modules that can be directly used for breeding are lacking. Fatty acid β-oxidation is a key pathway regulating intracellular membrane lipid composition and energy metabolism balance. Differences in the expression of its rate-limiting enzyme-encoding genes may be closely related to fatty acid accumulation levels and temperature response capabilities, but the specific functional genes in this pathway and their association with target traits, as well as their breeding application value, have not yet been revealed. Therefore, identifying key genes that simultaneously regulate fatty acid content and temperature adaptability at the whole-genome level, developing corresponding molecular modules, and establishing efficient detection methods are of significant practical importance for advancing the molecular breeding process of oysters. Summary of the Invention

[0005] The purpose of this invention is to provide a molecular module and its application related to the fatty acid content and high-temperature tolerance of oysters, thereby addressing the problems existing in the prior art. The molecular module provided by this invention is based on... Acadvl The two Indel sites in the gene promoter region can be genotyped using PCR-Sanger sequencing, which is low-cost and suitable for large-scale breeding. After functional and population validation, this module can be used to screen for heat-resistant individuals (TGTG / CACA) or individuals with high fatty acid content (TT / CC), providing an efficient tool for marker-assisted breeding of oysters.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a molecular module related to the fatty acid content and high temperature tolerance of oysters, the molecular module comprising a first molecular marker and a second molecular marker; The first molecule is marked by a TG / T mutation at position 227 of the sequence shown in SEQ ID NO.1; The second molecular marker is that a CA / C mutation exists at position 1778 of the sequence shown in SEQ ID NO.1.

[0007] Optionally, the genotypes at the site where the first molecular marker is located include TGTG, TGT, and TT, and the genotypes at the site where the second molecular marker is located include CACA, CAC, and CC.

[0008] The present invention also provides a primer pair for detecting the molecular module, comprising an upstream primer with the sequence shown in SEQ ID NO.4 and a downstream primer with the sequence shown in SEQ ID NO.5.

[0009] The present invention also provides an application of the primer pair described above in the genetic breeding of oysters with high temperature tolerance, wherein oysters with the genotype TGTG at the site of the first molecular marker have higher high temperature tolerance than other genotypes, and oysters with the genotype CACA at the site of the second molecular marker have higher high temperature tolerance than other genotypes. The oysters mentioned are Pacific oysters and Fujian oysters.

[0010] The present invention also provides the application of the primer pair described above in the cultivation of oysters with high fatty acid content, wherein the fatty acid content of oysters with genotype TT at the site of the first molecular marker is higher than that of other genotypes, and the fatty acid content of oysters with genotype CC at the site of the second molecular marker is higher than that of other genotypes. The oysters mentioned are Pacific oysters and Fujian oysters.

[0011] This invention also provides a method for breeding heat-resistant oysters, comprising the following steps: Using the DNA of the oyster sample to be tested as a template, PCR amplification was performed using the primer pair. The genotype of the corresponding site in the molecular module was determined according to the amplification product. Oysters with a dominant gene at at least one corresponding site were selected as parents for breeding. The dominant genotype at the site of the first molecular marker is TGTG, and the dominant genotype at the site of the second molecular marker is CACA; The oysters mentioned are Pacific oysters and Fujian oysters.

[0012] This invention also provides a method for breeding oysters with high fatty acid content, comprising the following steps: Using the DNA of the oyster sample to be tested as a template, PCR amplification was performed using the primer pair. The genotype of the corresponding site in the molecular module was determined according to the amplification product. Oysters with a dominant gene at at least one corresponding site were selected as parents for breeding. The dominant genotype at the site of the first molecular marker is TT, and the dominant genotype at the site of the second molecular marker is CC; The oysters mentioned are Pacific oysters and Fujian oysters.

[0013] Optionally, the PCR amplification reaction system consists of 1 μL DNA template, 12.5 μL Max Buffer, 0.5 μL dNTPs, 1 μL each of forward and reverse primers, 0.5 μL high-fidelity DNA polymerase, and 8.5 μL sterile deionized water.

[0014] Optionally, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 1-5 min; 94℃ denaturation for 10-30 s, 55℃ annealing for 10-30 s, 72℃ extension for 10-30 s, for a total of 35-40 cycles; final extension at 72℃ for 0-10 min.

[0015] Optionally, the genotype determination method includes using Sanger sequencing.

[0016] The present invention discloses the following technical effects: The molecular module provided by this invention is based on Acadvl Two key Indel sites in the gene promoter region (TG / T at position 227 and CA / C at position 1778) can be genotyped using simple PCR amplification combined with Sanger sequencing, eliminating the need for high-density microarrays or large-scale resequencing. The cost per sample is significantly lower than whole-genome selection breeding, making it suitable for large-scale breeding screening of low-value-added aquaculture species such as oysters. Furthermore, this molecular module has been validated by dual-luciferase reporter assays, showing that both sites significantly regulate promoter activity. Mutation at position 227 resulted in a decrease in promoter activity to approximately 36% of the wild-type level, indicating its clear molecular regulatory efficacy as a functional regulatory site.

[0017] This invention, through dual verification using wild populations and hybrid F2 populations, confirms that the survival rate of homozygous Fujian oysters with the dominant genotype (0 / 0) in the molecular module after heat shock at a semi-lethal temperature is significantly higher than that of heterozygous and homozygous Pacific oysters with the dominant genotype. Acadvl Gene knockdown experiments showed that this gene negatively regulates fatty acid accumulation. Therefore, this invention can be flexibly applied according to breeding objectives: screening individuals with TGTG and CACA genotypes as heat-resistant parents, or screening individuals with TT and CC genotypes as parents with high fatty acid content. Furthermore, synergistic improvement of two traits can be achieved through genotype combinations, providing an efficient and reliable technical tool for molecular marker-assisted breeding of oysters. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 For the control group and Acadvl Comparison of fatty acid content in wild-caught oysters from gene knockdown groups; Figure 2 Wild Pacific oyster, wild Fujian oyster, and wild Fujian oyster AcadvlStatistical graph of promoter activity after single-point mutation using promoter recombinant plasmid as template; Figure 3 Survival curves of different molecular module genotypes in the F2 generation of hybrids of Pacific oyster and Fujian oyster after heat shock at a semi-lethal temperature. Detailed Implementation

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0025] Example 1: Obtaining Molecular Modules and Identifying Functional Genes 1. Collection and processing of experimental materials In 2025, wild Pacific oyster populations were collected from the coast of Qingdao and temporarily housed in a laboratory recirculating aquaculture system for half a month to eliminate the impact of environmental changes on the experimental materials.

[0026] 2. Gene interference experiment For oysters AcadvlsiRNA interference fragments were designed and synthesized from the gene coding region. Preliminary experiments determined the optimal interference fragment to be siACADVL-671, and the optimal interference time was 48 hours post-injection. Oysters were immersed in an anesthetic mixture (500g MgCl2 dissolved in 5L seawater and 5L freshwater) for 12 hours until their shells relaxed and opened. After opening, 100μL of the interference reagent was injected into the adductor muscle of the oyster using a microsyringe. The experimental group (n=8) was injected with siACADVL-671 solution, while the control group (n=8) was injected with an equal volume of sterile deionized water.

[0027] The sequence of siACADVL-671 is as follows: The justice chain sequence is 5'-GGAUCAGUAAUGGAGGACUTT-3' (SEQ ID NO.2); The antisense sequence is 5'-AGUCCUCCAUUACUGAUCCTT-3' (SEQ ID NO.3).

[0028] The injection procedure was repeated twice to ensure the interference effect. After injection, the oysters were returned to room temperature seawater to recover and were cultured for 48 hours, after which the adductor muscle tissue was taken and freeze-dried.

[0029] 3. Determination of fatty acid content The fatty acid content in adductor muscle tissue was determined by gas chromatography. Approximately 0.05 g of freeze-dried sample was accurately weighed, and an internal standard solution of undecanoic acid triglyceride was added. The sample was then hydrolyzed with hydrochloric acid and extracted with a mixture of diethyl ether and petroleum ether. The extract was saponified with 2% sodium hydroxide methanol solution, cooled, and then methylated with boron trifluoride methanol solution. The reaction solution was extracted with n-heptane, dehydrated with anhydrous sodium sulfate, and the supernatant was loaded onto a column for gas chromatography analysis.

[0030] Gas chromatographic conditions: An Agilent 7890B gas chromatograph equipped with an FID detector and a DB-FastFAME column (30m × 0.25mm × 0.25μm) was used. The programmed temperature conditions were: initial temperature 125℃, held for 2 min; increased to 180℃ at 12℃ / min, held for 6 min; increased to 200℃ at 3.5℃ / min, held for 20 min; and increased to 230℃ at 5℃ / min, held for 8 min. The injection port temperature was 250℃, the detector temperature was 260℃, the split ratio was 10:1, and the injection volume was 1.0 μL. Using a mixed standard of 38 fatty acid methyl esters (Supelco 37 Component FAME Mix) as a reference, qualitative analysis was performed by retention time, and quantitative analysis was performed using the internal standard method to calculate the absolute content of each fatty acid.

[0031] The results showed that, compared with the control group, the experimental group injected with siACADVL-671 had a significantly higher content of total long-chain polyunsaturated fatty acids in the adductor muscle tissue, indicating that the knockdown group... Acadvl Gene expression can lead to increased levels of fatty acid accumulation. Acadvl Genes negatively regulate the content of long-chain fatty acids in oysters ( Figure 1 ).

[0032] Example 2: Screening of genetic loci in molecular modules 1. Sample collection and processing Forty-eight wild Pacific oysters and forty-eight wild Fujian oysters were collected from natural waters along the coast of Qingdao and Fujian, respectively. They were temporarily housed at a Qingdao coastal aquaculture base for half a month to eliminate the influence of environmental differences on genetic analysis. After the temporary housing period, gill tissue from each oyster was collected, flash-frozen in liquid nitrogen, and then stored at -80℃.

[0033] 2. Genomic DNA extraction Total DNA was extracted from gill tissue of each individual using the sodium lauryl sulfate method. 1 μL of RNase A (0.1 mg / mL) was added, and the mixture was incubated at 37°C for 30 min to digest the RNA. The resulting DNA solution was stored at -20°C for later use.

[0034] 3. Screening of candidate genetic variation sites Using the above DNA solution as a template, specific primer pairs were used. Acadvl PCR amplification was performed on the gene promoter region. The primer sequences are as follows: Forward primer F: 5'-TTGGTGGTGATGTTACTC-3' (SEQ ID NO.4); Reverse primer R: 5'-TGTGATGTGCAACGCAGT-3' (SEQ ID NO.5).

[0035] The PCR amplification reaction system consisted of: 1 μL DNA template, 12.5 μL Max Buffer, 0.5 μL dNTPs (2.5 mmol / L each), 1 μL forward primer (10 μmol / L), 1 μL reverse primer (10 μmol / L), 0.5 μL high-fidelity DNA polymerase (5 U / μL), and 8.5 μL sterile deionized water. The amplification program was as follows: 94℃ pre-denaturation for 1-5 min; 94℃ denaturation for 10-30 s, 55℃ annealing for 10-30 s, 72℃ extension for 10-30 s, for a total of 35-40 cycles; final extension at 72℃ for 0-10 min.

[0036] After the amplified products were confirmed to be of correct fragment size by 1% agarose gel electrophoresis, they were sent to a sequencing company for Sanger sequencing. Based on the sequencing results of 48 Pacific oysters and 48 Fujian oysters, [the following was performed / analyzed]. AcadvlSequence alignment analysis of the promoter region revealed two genetic variation sites with significantly different genotype frequencies between the two populations (chi-square test, P<0.05), located at position 227 (Indel, TG→T) and position 1778 (Indel, CA→C) at the 5' end of the sequence shown in SEQ ID NO.1. (Using Fujian oysters...) Acadvl Taking the gene promoter sequence (SEQ ID NO.1) as an example, the positions of the two genetic variation sites mentioned above in the sequence are as follows.

[0037] SEQ ID NO.1: TTGGTGGTGATGTTACTCGTTGAGTACATATGCACCAATAACAATCATATGGTAATTCGTTACTTTTACAAACTCTATAAACGACAAGAATTATTTTATTTTCATTTTTAAAATCTAACATTTAGTTTTTAGTATATACTTGTTAAAACATCCTGATCTTTCTATGTCATGTTCGTGCAATGTACTTAGATGCAGTCACAATTTAAACTTTCGTTTAACGTTGAAG tg ca AAAAAGGCCACACAATTTTATACATATGTCTTTTTGCATATTTCAGTGACTGATACATATCTAAATGTTTTACAAACAGGCTCAACATAGGTTTGTGTTCGTGACTGCGTTGCACATCACAAA (as shown in SEQ ID NO.1, there is a TG / T mutation at position 227 and a CA / C mutation at position 1778).

[0038] Further genotyping results are shown in Table 1. The genotypic distributions of the two loci in the *Crassostrea gigas* and *Crassostrea kwangsiensis* populations were significantly different, and showed strong linkage disequilibrium (D'>0.85). This locus was defined as a linkage disequilibrium with... Acadvl A molecular module closely related to gene expression and fatty acid content. The nucleotide sequence of this molecular module is shown in SEQ ID NO.1, with two molecular markers located at positions 227 and 1778 at the 5' end of the sequence, respectively.

[0039] Table 1. Molecular marker genotyping results of 48 wild Pacific oysters and 48 wild Fujian oysters. Note: "0 / 0" indicates the homozygous Fujian oyster genotype (temperature-tolerant genotype), "0 / 1" indicates the heterozygous genotype, and "1 / 1" indicates the homozygous long oyster genotype (heat-sensitive genotype).

[0040] Example 3: Functional Verification of Genetic Loci in Molecular Modules In this embodiment, the promoter activity regulation function of the two genetic loci screened in Example 2 was verified by combining single-point mutation with dual-luciferase reporter gene experiment.

[0041] 1. Construction of recombinant plasmids Using genomic DNA from Pacific oyster and Fujian oyster as templates, high-fidelity PCR amplification was performed. Acadvl Gene promoter region fragment. Amplification was performed using specific primers containing homologous arms of the pGL3-basic vector. The primer sequences are as follows: Forward primer F: 5'-ATCTGCGATCTAAGTAAGCTTACATATTTTACTTACTGCAAGATGATTTAAA-3' (SEQ ID NO.6); Reverse primer R: 5'-CAGTACCGGAATGCCAAGCTTTTGTGATGTGCAACGCAGTCA-3' (SEQ ID NO.7).

[0042] The PCR amplification system was the same as in Example 2. After gel purification, the amplification product was inserted into the linearized pGL3-basic vector. The ligation product was transformed into DH5α competent E. coli cells, positive single colonies were picked, and plasmids were extracted by alkaline lysis. The plasmid concentration and quality were further determined using a nucleic acid detection instrument (Nanodrop2000, USA).

[0043] 2. Single-point mutation experiment Based on homologous recombination, wild-type oysters from Fujian were used. Acadvl Using the promoter recombinant plasmid (SEQ ID NO. 1, position 227 is TG, position 1778 is CA) as a template, the two sites were mutated to the dominant genotype of Crassula longicornis (i.e., position 227 TG→T, position 1778 CA→C). Single-point mutations were performed using overlap extension PCR, with specific primers containing the mutated bases designed for each site. Primer for mutation at position 227 (TG→T): Forward primer F: 5'-CGTTGAAGTGTTTTTGGATCTCTTAAACCACGC-3' (SEQ ID NO.8); Reverse primer R: 5'-CCAAAAACACTTCAACGTTAAACGAAAGTTTAAATT-3' (SEQ ID NO.9).

[0044] Primer for mutation at position 1778 (CA→C): Forward primer F: 5'-TTGTCCAAAAAGGCCACACAATTTTATACATAT-3' (SEQ ID NO.10); Reverse primer R: 5'-GTGGCCTTTTTGGACAAATTGTGACCTAACAAGTTCG-3' (SEQ ID NO.11).

[0045] The PCR product was digested with the original plasmid, purified, and ligated for recombination to prepare a single-point mutant plasmid, which was then transformed into DH5α competent E. coli. After plasmid amplification, its concentration and mass were measured.

[0046] 3. Dual-luciferase reporter gene assay HEK293T cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum and passaged in a 37°C, 5% CO2 incubator. 24 h before transfection, cells were seeded into six-well plates to achieve a cell density of 60%–80%. The transfection system for each well was as follows: Mixture I consisted of 480 ng of recombinant plasmid (wild-type or mutant) and 20 ng of internal control plasmid pRL-TK, with 5 μL of P3000 reagent and 125 μL of Opti-MEM medium added; Mixture II consisted of 3.75 μL of Lipofectamine 3000 Reagent and 125 μL of Opti-MEM medium. Mixture II was slowly added to Mixture I, and after standing at room temperature for 10 min, it was evenly added dropwise to the six-well plates and incubated at 37°C, 5% CO2 for 36 h.

[0047] Thirty-six hours after transfection, the culture medium was aspirated, and each well was washed twice with 1 mL of pre-cooled PBS. 600 μL of luciferase assay reagent was added, and the plates were lysed at room temperature in the dark for 10 min. The lysate was centrifuged, and 60 μL of the supernatant was added to a white, opaque 96-well plate. Firefly luciferase activity was immediately detected at 600 nm using a full-wavelength scanning multi-function reader. Subsequently, 60 μL of stop reagent was added to each well, and the plates were incubated at room temperature in the dark for 10 min before detecting Renida luciferase activity at 600 nm. Three technical replicates were performed for each sample. The ratio of firefly luciferase activity to Renida luciferase activity for each sample was calculated as the relative promoter activity.

[0048] Experimental results ( Figure 2 The results showed that after the mutation from TG to T at site 227, promoter activity decreased to approximately 36% of the wild-type level (P<0.01); after the mutation from CA to C at site 1778, promoter activity decreased to approximately 44% of the wild-type level (P<0.05). These results indicate that both genetic loci within this molecular module can significantly affect... Acadvl The transcriptional activity of gene promoters is regulated, with the 227th site exhibiting a more significant regulatory effect on promoter activity.

[0049] Example 4: Application and Verification of Molecular Modules in the Breeding of High-Temperature Resistant Oysters This embodiment verifies the practical application effect of the above-mentioned molecular module in the breeding of oyster heat tolerance through two levels: natural wild population and hybrid F2 population.

[0050] 1. Verification of wild populations In 2025, 94 wild Pacific oysters were collected from the coast of Tangshan, Hebei Province, and 100 wild Fujian oysters were collected from the coast of Quanzhou, Fujian Province. These were then temporarily housed at a Qingdao aquaculture base for half a month. DNA was extracted from gill tissue using the method described in Example 2. PCR amplification and Sanger sequencing were performed using the primer pairs shown in SEQ ID NO. 4 and SEQ ID NO. 5 to genotype two Indel loci. The statistical results are shown in Table 2. The genotype frequency distributions of the two loci were significantly different in the two populations (P < 0.05), indicating that this molecular module stably differentiates in the natural population. Given that previous studies by our research group have confirmed that the Fujian oyster has significantly higher heat tolerance than the Pacific oyster, this molecular module has been identified as a breeding target closely related to temperature tolerance.

[0051] Table 2. Molecular marker genotyping results of 94 wild Pacific oysters and 100 wild Fujian oysters. 2. Construction and validation of F2 hybrid populations of Crassula longifolia and Crassula fuchsia In 2025, 30 adult wild Pacific oysters and 30 adult Fujian oysters were collected from Qingdao and Xiamen respectively, and temporarily raised at the Qingdao aquaculture base for one month until their gonads reached maturity. Thirty female Pacific oysters were then crossbred with 30 male Fujian oysters to construct a hybrid F1 population. In 2026, 30 females were randomly selected from the F1 population and mated with 30 males to construct a self-fertilized F2 population. The F2 larvae were then attached and transferred to the coastal aquaculture rafts in Qingdao for conventional aquaculture.

[0052] In July 2026, individuals were randomly collected from the F2 population. DNA extraction and genotyping were performed according to the method in Example 2. One hundred homozygous dominant individuals of *Crassostrea gigas* (0 / 0), one hundred heterozygous individuals of *Crassostrea gigas* (0 / 1), and one hundred homozygous dominant individuals of *Crassostrea gigas* (1 / 1) were selected as experimental materials. These 300 oysters were temporarily housed in a laboratory circulating water system for 3 days, followed by a high-temperature stress experiment: the oysters were placed in seawater at a semi-lethal temperature of 42°C for 1 hour, and then rapidly transferred to seawater at room temperature (15±2°C) for 14 days of recovery. The number of dead individuals was recorded daily, and dead individuals were promptly removed. Gill tissue was collected, flash-frozen in liquid nitrogen, and stored at -80°C for later use.

[0053] Kaplan-Meier survival analysis was used to compare the survival rate differences among the three genotype populations, and the Log-rank test was used for significance analysis. The results showed that the 14-day cumulative survival rate was 35% in homozygous dominant individuals of the Fujian oyster type (0 / 0), significantly higher than 28% in heterozygous individuals (0 / 1) (P<0.05), and even significantly higher than 20% in homozygous dominant individuals of the Pacific oyster type (1 / 1) (P<0.01). Figure 3The above results indicate that the heat-resistant genotypes derived from Fujian oysters can be stably inherited in hybrid offspring and significantly enhance survival under high-temperature stress. The molecular module developed in this invention can serve as an effective target for molecular breeding of heat-resistant oysters.

[0054] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A molecular module related to oyster fatty acid content and high-temperature tolerance, characterized in that, The molecular module includes a first molecular marker and a second molecular marker; The first molecule is marked by a TG / T mutation at position 227 of the sequence shown in SEQ ID NO.1; The second molecular marker is that a CA / C mutation exists at position 1778 of the sequence shown in SEQ ID NO.

1.

2. The molecular module according to claim 1, characterized in that, The genotypes at the site of the first molecular marker include TGTG, TGT, and TT, and the genotypes at the site of the second molecular marker include CACA, CAC, and CC.

3. A primer pair for detecting the molecular module of claim 1 or 2, characterized in that, It includes an upstream primer with the sequence shown in SEQ ID NO.4 and a downstream primer with the sequence shown in SEQ ID NO.

5.

4. The application of the primer pair as described in claim 3 in the genetic breeding of oysters with high-temperature tolerance, characterized in that, Oysters with the genotype TGTG at the site of the first molecular marker have higher heat tolerance than other genotypes, and oysters with the genotype CACA at the site of the second molecular marker have higher heat tolerance than other genotypes. The oysters mentioned are Pacific oysters and Fujian oysters.

5. The application of the primer pair as described in claim 3 in the cultivation of oysters with high fatty acid content, characterized in that, Oysters with the genotype TT at the location of the first molecular marker have higher fatty acid content than other genotypes, and oysters with the genotype CC at the location of the second molecular marker have higher fatty acid content than other genotypes. The oysters mentioned are Pacific oysters and Fujian oysters.

6. A method for breeding heat-resistant oysters, characterized in that, Includes the following steps: Using the DNA of the oyster sample to be tested as a template, PCR amplification was performed using the primer pair described in claim 3. The genotype of the corresponding site in the molecular module described in claim 1 or 2 was determined according to the amplification product. Oysters with a dominant gene at at least one corresponding site were selected as parents for breeding. The dominant genotype at the site of the first molecular marker is TGTG, and the dominant genotype at the site of the second molecular marker is CACA; The oysters mentioned are Pacific oysters and Fujian oysters.

7. A method for breeding oysters with high fatty acid content, characterized in that, Includes the following steps: Using the DNA of the oyster sample to be tested as a template, PCR amplification was performed using the primer pair described in claim 3. The genotype of the corresponding site in the molecular module described in claim 1 or 2 was determined according to the amplification product. Oysters with a dominant gene at at least one corresponding site were selected as parents for breeding. The dominant genotype at the site of the first molecular marker is TT, and the dominant genotype at the site of the second molecular marker is CC; The oysters mentioned are Pacific oysters and Fujian oysters.

8. The method according to claim 6 or 7, characterized in that, The PCR amplification reaction system consisted of 1 μL DNA template, 12.5 μL Max Buffer, 0.5 μL dNTPs, 1 μL each of forward and reverse primers, 0.5 μL high-fidelity DNA polymerase, and 8.5 μL sterile deionized water.

9. The method according to claim 6 or 7, characterized in that, The PCR amplification reaction program is as follows: 94℃ pre-denaturation for 1-5 min; 94℃ denaturation for 10-30 s, 55℃ annealing for 10-30 s, 72℃ extension for 10-30 s, for a total of 35-40 cycles; final extension at 72℃ for 0-10 min.

10. The method according to claim 6 or 7, characterized in that, The genotype determination method includes using Sanger sequencing.

Images