A double fluorescent PCR reagent detection method for streptococcus suis detection

Abstract

The application discloses a double fluorescent PCR reagent detection method for detecting streptococcus suis, and comprises the following steps: S1, diluting a quality control product; S2, testing a primer probe; S3, optimizing a concentration of the primer probe; S4, testing a minimum detection limit; S5, testing specificity; and S6, conducting a clinical test. The application determines the test primer probe, optimizes the concentration of the primer probe, successfully develops a streptococcus (type 2 and type 7) double fluorescent PCR detection reagent, and the minimum detection limit of a FAM signal channel of the streptococcus (type 2 and type 7) double fluorescent PCR detection reagent kit is 10 3 dilution, the minimum detection CFU is 2.6*10 2 / ml, the minimum detection limit of a VIC signal channel is 10 3 dilution, the minimum detection CFU is 3.4*10 2 / ml, and the specificity is good.

Description

Technical Field

[0001] This invention relates to the field of bacterial molecular biology detection technology, specifically to a dual-fluorescent PCR reagent detection method for detecting Streptococcus suis. Background Technology

[0002] Streptococcus suis, belonging to the genus Streptococcus, is a Gram-positive facultative anaerobic bacterium, spherical or oval in shape, often arranged in pairs or chains. It can cause meningitis, septicemia, arthritis, and other diseases in pigs, making it a significant pathogen and causing severe economic losses to the pig industry. Based on differences in capsular antigens, it can be divided into 35 serotypes (types 1-34 and 1 / 2) and a considerable number of untyped strains. Types 1, 2, and 7 are the main serotypes causing disease and death in pigs, especially type 2, which is the most pathogenic and the main serotype causing disease in pigs and infection in humans. This bacterium is relatively resistant to the external environment, surviving for weeks in feces, sewage, and dust. In the tissues of diseased or dead pigs, Streptococcus suis can survive for weeks or even months. However, it is sensitive to commonly used disinfectants, such as 2% sodium hydroxide, 0.5% peracetic acid, and 10% bleaching powder, which can rapidly kill it.

[0003] Existing technologies: For the detection of Streptococcus suis using conventional PCR or quantitative real-time PCR methods, there are patents for universal streptococcal detection kits, serological type 2 detection kits, or multiplex serological detection kits, as well as some rapid detection test cards (similar to colloidal gold test strips).

[0004] The existing typing methods for Streptococcus suis mainly include the following: (1) Traditional typing method: Traditional streptococcal typing methods are mainly based on the structural differences of glycosylated antigens, such as through serum agglutination reaction, immunoblotting and other methods to type streptococci. However, this method is not sensitive enough to identify differences between different strains and may result in false positives or false negatives. (2) PCR typing method: PCR technology can amplify different gene fragments to type Streptococcus suis. For example, cps gene, cps2J gene, lytA gene and other genes can be used as target genes for typing. Among them, the cps gene encodes the enzyme for streptococcal polysaccharide synthesis. By amplifying the cps gene fragment, Streptococcus suis can be divided into different serotypes. (3) MLST typing method: MLST (Multi-Locus Sequence Typing) is a typing method widely used in microbial molecular epidemiology research. By performing sequence analysis on multiple core genes, the genotypic differences between different streptococcal strains are determined and thus the strains are typed. (4) Whole genome sequencing: can obtain the complete genome sequence and perform high-resolution typing and evolution studies on strains, but it has problems such as long time and high cost. Summary of the Invention

[0005] The purpose of this invention is to provide a dual-fluorescent PCR reagent detection method for detecting Streptococcus suis, in order to solve the problems mentioned in the background art.

[0006] To achieve the above objectives, the present invention provides the following technical solution: a dual-fluorescence PCR reagent detection method for detecting Streptococcus suis, comprising the following steps: S1: Quality Control Product Dilution: Take SS / 2 / QC / DNA and SS / 7 / QC / DNA, and dilute them 10-fold sequentially with 1×TE buffer to a final concentration of 10. 4 , as a template; S2: Primer and probe test: Reconstitute type 2 and type 7 primers and probes with sterile purified water to 50 μmol / L. Prepare the fluorescent PCR reaction solution according to Table 2 in the instruction manual. Use the nucleic acid diluted in S1 as the template for fluorescent PCR amplification. Perform 3 reactions for each dilution. The system is 20 μl reaction solution + 5 μl template. The reaction program is as follows: incubation at 37℃ for 2 minutes; pre-denaturation at 95℃ for 20 seconds; denaturation at 95℃ for 10 seconds; annealing and extension at 60℃ for 30 seconds; 40 cycles. Collect FAM and VIC fluorescence signals at 60℃. S3: Primer and probe concentration optimization: Prepare the fluorescent PCR reaction solution according to Table 3 in the instruction manual. Use nucleic acid diluted in S1 as template, and perform two replicate reactions for each dilution. The system is 20 μl reaction solution + 5 μl template. The reaction program is: 37℃ for 2 minutes; 95℃ pre-denaturation for 20 seconds; 95℃ denaturation for 10 seconds; 60℃ annealing and extension for 30 seconds, 40 cycles. Collect FAM and VIC fluorescence signals at 60℃. By comparing the detection Ct value and the amplification curve, select the primer and probe concentrations with the lowest detection Ct value and the most typical amplification curve. S4: Limit of Detection: Based on the results of S3, take the samples that are close to the critical value in the serial dilution of S1 as templates and perform 20 repeated tests. Using the lower limit of the 95% confidence interval, the number of positive results should be greater than or equal to 19. This concentration is the limit of detection. S5: Specificity test: Using pE.coli / QC / DNA, SE / QC / DNA, PM / QC / DNA, MH / QC / DNA, Mycobacterium bovis (carboxyvalent vaccine), Streptococcus lactis, Streptococcus dysgalactiae, Aeromonas hydrophila, Actinobacillus pleuropneumoniae, Bordetella bronchiseptica, SA / QC / DNA, GBS / QC / DNA, and SS / 9 / QC / DNA as templates, the specificity of the established dual fluorescent PCR detection method for streptococci (types 2 and 7) was verified. S6: Clinical Trials: Extract nucleic acid from 60 clinical samples as templates and use the established dual fluorescence PCR detection method for streptococci (types 2 and 7) in clinical trials.

[0007] Compared with the prior art, the beneficial effects of the present invention are: This invention, through research and determination of test primers and probes, and optimization of primer and probe concentrations, successfully developed a dual fluorescent PCR detection reagent for Streptococcus (types 2 and 7). The limit of detection (LOD) of the FAM signal channel in the Streptococcus (types 2 and 7) dual fluorescent PCR detection kit is 10⁻⁶ sq. of SS / 2 / QC / DNA. 3 The lowest detectable CFU at dilution was 2.6 × 10⁻⁶. 2 / ml, the limit of detection for the VIC signaling channel is 10 of SS / 7 / QC / DNA. 3 The lowest detectable CFU at dilution was 3.4 × 10⁻⁶. 2 This invention offers high specificity ( / ml) and can simultaneously detect two serotypes of Streptococcus suis, enabling serotyping of both serotypes 2 and 7 in a single test. The invention is simple and convenient to operate, saving testing time. With its high specificity and sensitivity, this invention effectively solves the problem of detecting and analyzing different serotypes of Streptococcus suis in a single sample. Attached Figure Description

[0008] Figure 1 This is an overall diagram of dual-channel amplification using primers and probes according to the present invention; Figure 2 This is a single-channel fluorescence amplification curve of VIC using primers and probes of this invention. Figure 3 This is a single-channel fluorescence amplification curve of FAM using primers and probes of this invention. Figure 4 This is a summary diagram of dual-channel amplification using primer and probe concentration ratios of the present invention. Figure 5 This is a single-channel amplification curve of VIC based on the primer and probe concentration ratio of this invention. Figure 6 This is a single-channel FAM amplification curve of the primer and probe concentration ratio of this invention. Figure 7 This is a summary diagram of two sets of dual-channel amplification based on the primer and probe concentration ratios of this invention; Figure 8 This is a single-channel amplification curve of VIC with primer and probe concentration ratios for two groups, as shown in the figure. Figure 9 This is a single-channel FAM amplification curve for two sets of primer and probe concentration ratios according to the present invention. Figure 10 This is a summary diagram of the dual-channel amplification using three sets of primer and probe concentration ratios according to the present invention. Figure 11 The following are three sets of VIC single-channel amplification curves showing the primer and probe concentration ratios of this invention. Figure 12The following are three sets of FAM single-channel amplification curves showing the primer and probe concentration ratios of this invention. Figure 13 This is a dual-channel amplification curve used to test the specificity of this invention. Detailed Implementation

[0009] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0010] Please see Figure 1-11 This invention provides a technical solution: a dual-fluorescent PCR reagent detection method for detecting Streptococcus suis, comprising the following steps: S1: Quality Control Product Dilution: Take SS / 2 / QC / DNA and SS / 7 / QC / DNA, and dilute them 10-fold sequentially with 1×TE buffer to a final concentration of 10. 4 , as a template; S2: Primer and probe test: Reconstitute type 2 and type 7 primers and probes with sterile purified water to 50 μmol / L. Prepare the fluorescent PCR reaction solution according to Table 2 in the instruction manual. Use the nucleic acid diluted in S1 as the template for fluorescent PCR amplification. Perform 3 reactions for each dilution. The system is 20 μl reaction solution + 5 μl template. The reaction program is as follows: incubation at 37℃ for 2 minutes; pre-denaturation at 95℃ for 20 seconds; denaturation at 95℃ for 10 seconds; annealing and extension at 60℃ for 30 seconds; 40 cycles. Collect FAM and VIC fluorescence signals at 60℃. S3: Primer and probe concentration optimization: Prepare the fluorescent PCR reaction solution according to Table 3 in the instruction manual. Use nucleic acid diluted in S1 as template, and perform two replicate reactions for each dilution. The system is 20 μl reaction solution + 5 μl template. The reaction program is: 37℃ for 2 minutes; 95℃ pre-denaturation for 20 seconds; 95℃ denaturation for 10 seconds; 60℃ annealing and extension for 30 seconds, 40 cycles. Collect FAM and VIC fluorescence signals at 60℃. By comparing the detection Ct value and the amplification curve, select the primer and probe concentrations with the lowest detection Ct value and the most typical amplification curve. S4: Limit of Detection: Based on the results of S3, take the samples that are close to the critical value in the serial dilution of S1 as templates and perform 20 repeated tests. Using the lower limit of the 95% confidence interval, the number of positive results should be greater than or equal to 19. This concentration is the limit of detection. S5: Specificity test: Using pE.coli / QC / DNA, SE / QC / DNA, PM / QC / DNA, MH / QC / DNA, Mycobacterium bovis (carboxyvalent vaccine), Streptococcus lactis, Streptococcus dysgalactiae, Aeromonas hydrophila, Actinobacillus pleuropneumoniae, Bordetella bronchiseptica, SA / QC / DNA, GBS / QC / DNA, and SS / 9 / QC / DNA as templates, the specificity of the established dual fluorescent PCR detection method for streptococci (types 2 and 7) was verified. S6: Clinical Trials: Extract nucleic acid from 60 clinical samples as templates and use the established dual fluorescence PCR detection method for streptococci (types 2 and 7) in clinical trials.

[0011] Results and Analysis 1.1 Primer and probe test results: Using S1 diluted nucleic acid as a template, fluorescent PCR amplification was performed. Three reactions were performed for each dilution. The results showed that this dual primer and probe combination was effective with 10 SS / 2 / QC / DNA. 0 ~10 4 Using dilutions as templates, all yielded Ct values ​​and typical amplification curves; SS / 7 / QC / DNA at 10... 0 ~10 4 Using dilutions as templates, all yielded Ct values ​​and typical amplification curves (Table 5). Figure 1 Therefore, further optimization of primer and probe concentrations is needed to attempt to reduce the Ct value; 1.2 Primer and probe concentration optimization: The fluorescent PCR reaction solution was prepared according to Table 3. Using nucleic acid diluted to S1 as a template, two replicates were performed for each dilution. The results showed that 10-1 of SS / 2 / QC / DNA detected by solution 1 was optimal. 0 ~10 4 The Ct values ​​of all dilutions were 1-2 cycles lower than those of ratios 2 and 3; the SS / 7 / QC / DNA values ​​detected by ratio 1 were 10. 0 ~10 4 The Ct values ​​of all dilutions were approximately one cycle lower than those of dilutions 2 and 3, and the amplification curves were all typical (Table 6). Figures 2-10 ); 1.3 Limit of Detection Results: Based on the results, the optimal reaction system was selected, and 10~10^6 of the serially diluted SS / 2 / QC / DNA from S1 was taken. 4 Dilution, SS / 7 / QC / DNA 10~10 4 Using dilutions as templates, 12 replicates were performed. At the lower confidence interval (lower limit of 95%), the number of positive results should be greater than or equal to 13. This concentration is the limit of detection. Results showed that the FAM signal channel detected 10 and 10 of SS / 2 / QC / DNA. 2All dilutions were detected, with a detection rate of 100%. SS / 2 / QC / DNA were detected in 10... 3 Not all dilutions were detected; the detection rate was 83.3% (10 / 12). SS / 2 / QC / DNA was detected in 10... 4 Not all dilutions were detected; the detection rate was 25% (3 / 12). The VIC signal channel detected 10 and 10 of SS / 7 / QC / DNA. 2 All dilutions were detected, with a detection rate of 100%. SS / 7 / QC / DNA were detected in 10... 3 Not all dilutions were detected; the detection rate was 58.3% (7 / 12). 10 samples were tested for SS / 7 / QC / DNA. 4 All dilutions were undetectable (Table 7). Therefore, the limit of detection for the FAM signal channel of the Streptococcus (types 2 and 7) dual fluorescent PCR detection kit is 10⁻⁶ of SS / 2 / QC / DNA. 3 The lowest detectable CFU at dilution was 2.6 × 10⁻⁶. 2 / ml, the limit of detection for the VIC signaling channel is 10 of SS / 7 / QC / DNA. 3 The lowest detectable CFU at dilution was 3.4 × 10⁻⁶. 2 / ml; 1.4 Specificity studies: No Ct values ​​or typical amplification curves were observed using B. abortus / QC / DNA, PM / QC / DNA, MH / QC / DNA, Streptococcus lactis, Streptococcus dysgalactiae, Aeromonas hydrophila, Actinobacillus pleuropneumoniae, Bordetella bronchiseptica, bovine herpesvirus type 1, or GBS / QC / DNA. When SA / QC / DNA was used as a template, no Ct values ​​or typical amplification curves were observed in the VIC signal channel. When MB / QC / DNA was used as a template, no Ct values ​​or typical amplification curves were observed in the FAM signal channel. Figure 4 The results indicate that the dual fluorescent PCR detection kit for streptococci (types 2 and 7) shows no cross-reactivity with the nucleic acids of Mycoplasma bovis, Pasteurella multocida, Mansonia solani, Streptococcus lactis, Streptococcus dysgalactiae, Aeromonas hydrophila, Actinobacillus pleuropneumoniae, Bordetella bronchiseptica, Mycoplasma bovis, Streptococcus agalactiae, and other streptococci, demonstrating good specificity.

[0012] in conclusion 2.1 The optimal primers and probes for the Streptococcus (types 2 and 7) dual fluorescent PCR detection kit are: SS / 2 / F: AGCACAGCAAATTATATTATGTTTG, SS / 2 / R:CGACAAATCACTATCATTCTCTTTT, SS / 2 / PF: FAM-TTGACGGCAACATTGTTGAGTCCTTA-BHQ1, SS / 7 / F: AAGATTGATGAATCTAGTCAGTC, SS / 7 / R: GATAGCCGTAATTGTACATCATT, SS / 7 / PV: VIC- CGGTTCCTGTGTCAGGACCAGCAATT- BHQ1; 2.2 The ratio of SS / 2 / F∶SS / 2 / R∶SS / 2 / PF∶SS / 7 / F∶SS / 7 / R∶SS / 7 / PV was determined to be 6∶6∶3∶6∶6∶2, which is 60 reactions / tube (29 μl / tube). Among them, there are 6 μl / tube each of the upstream and downstream primers (50 μM) for Streptococcus 2, 3 μl / tube of the probe for Streptococcus 2 (50 μM), 6 μl / tube each of the upstream and downstream primers (50 μM) for Streptococcus 7, and 2 μl / tube of the probe for Streptococcus 7 (50 μM). 2.3 The optimal reaction program was determined to be: incubation at 37℃ for 2 minutes; pre-denaturation at 95℃ for 20 seconds; denaturation at 95℃ for 10 seconds; annealing extension at 60℃ for 30 seconds; 40 cycles; and collection of FAM and VIC fluorescence signals at 60℃. 2.4 The limit of detection (LOD) of the FAM signal channel in the Streptococcus (types 2 and 7) dual fluorescent PCR detection kit is 10⁻⁶ of SS / 2 / QC / DNA. 3 The lowest detectable CFU at dilution was 2.6 × 10⁻⁶. 2 / ml, the limit of detection for the VIC signaling channel is 10 of SS / 7 / QC / DNA. 3 The lowest detectable CFU at dilution was 3.4 × 10⁻⁶. 2 / ml, 2.5 The dual fluorescent PCR detection kit for streptococci (types 2 and 7) has good specificity.

[0013] Table 1 Primer and probe details

[0014] Table 2. Reaction solution system configuration

[0015] Table 3 PCR reaction solution preparation (60 reactions / vial)

[0016] Table 5 Primer and probe test results

[0017] Note: "-" indicates no Ct value.

[0018]

[0019]

[0020] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, and is not intended to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions made by those skilled in the art to the technical solution of the present invention do not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A dual-fluorescent PCR reagent detection method for detecting Streptococcus suis, characterized in that, Includes the following steps: S1: Quality Control Product Dilution: Take SS / 2 / QC / DNA and SS / 7 / QC / DNA, and dilute them 10-fold sequentially with 1×TE buffer to a final concentration of 10. 4 , as a template; S2: Primer and probe test: Reconstitute type 2 and type 7 primers and probes with sterile purified water to 50 μmol / L. Prepare the fluorescent PCR reaction solution according to Table 2 in the instruction manual. Use the nucleic acid diluted in S1 as the template for fluorescent PCR amplification. Perform 3 reactions for each dilution. The system is 20 μl reaction solution + 5 μl template. The reaction program is as follows: incubation at 37℃ for 2 minutes; pre-denaturation at 95℃ for 20 seconds; denaturation at 95℃ for 10 seconds; annealing and extension at 60℃ for 30 seconds; 40 cycles. Collect FAM and VIC fluorescence signals at 60℃. S3: Primer and probe concentration optimization: Prepare the fluorescent PCR reaction solution according to Table 3 in the instruction manual. Use nucleic acid diluted in S1 as template, and perform two replicate reactions for each dilution. The system is 20 μl reaction solution + 5 μl template. The reaction program is: 37℃ for 2 minutes; 95℃ pre-denaturation for 20 seconds; 95℃ denaturation for 10 seconds; 60℃ annealing and extension for 30 seconds, 40 cycles. Collect FAM and VIC fluorescence signals at 60℃. By comparing the detection Ct value and the amplification curve, select the primer and probe concentrations with the lowest detection Ct value and the most typical amplification curve. S4: Limit of Detection: Based on the results of S3, take the samples that are close to the critical value in the serial dilution of S1 as templates and perform 20 repeated tests. Using the lower limit of the 95% confidence interval, the number of positive results should be greater than or equal to 19. This concentration is the limit of detection. S5: Specificity test: Using pE.coli / QC / DNA, SE / QC / DNA, PM / QC / DNA, MH / QC / DNA, Mycobacterium bovis (carboxyvalent vaccine), Streptococcus lactis, Streptococcus dysgalactiae, Aeromonas hydrophila, Actinobacillus pleuropneumoniae, Bordetella bronchiseptica, SA / QC / DNA, GBS / QC / DNA, and SS / 9 / QC / DNA as templates, the specificity of the established dual fluorescent PCR detection method for streptococci (types 2 and 7) was verified. S6: Clinical Trials: Nucleic acid was extracted from 60 clinical samples and used as templates to conduct clinical trials using the established dual fluorescence PCR detection method for streptococci (types 2 and 7).

Images