A primer, method and kit for detecting salmonella by combining rpa and lateral flow chromatography

CN122811389APending Publication Date: 2026-09-25ZHEJIANG GONGSHANG UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610829906.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-06-10
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

[0005]鉴于以上所述现有技术的缺点,本发明的目的在于提供一种RPA-侧流层析联合检测沙门氏菌的引物、方法及试剂盒,用于解决现有沙门氏菌检测方法存在操作复杂、反应时间较长、成本高,难以满足即时检测需求的问题

Benefits of technology

[0020]污染控制:采用全密闭反应腔室,有效规避气溶胶交叉污染风险;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122811389A_ABST
    Figure CN122811389A_ABST
Patent Text Reader

Abstract

The application provides a primer, a method and a kit for detecting Salmonella by combining RPA and lateral flow chromatography, the RPA primer for detecting Salmonella is as follows: a forward primer Sal-invA-F-2: AGAAGGGTCGTCGTTAGGACTGATTGGCGAT; and a reverse primer Sal-invA-R-2: ATAAAGAACTGACTACGTAGACGCTCCGCA. The application combines the RPA isothermal amplification system and the lateral flow chromatography test strip technology, optimizes the primer design and the reaction condition in cooperation, the detection sensitivity is improved from 3 pg / µL of the traditional RPA system to 3 fg / µL, and there is no cross reaction to non-target strains, so that the dual breakthrough of "high sensitivity-strong specificity" is realized, and a new method is provided for rapid screening of foodborne pathogenic bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, and in particular to primers, methods and kits for the combined detection of Salmonella by RPA-lateral flow chromatography. Background Technology

[0002] Salmonella is a rod-shaped, Gram-negative bacterium belonging to the Enterobacteriaceae family. Salmonella can infect rodents, poultry, and livestock, and can also cause food poisoning in humans. Salmonella is a facultative anaerobe, thriving at 37°C, with an optimal growth pH between 6.8 and 7.8. It is typically cultured on LB agar, producing round, moist, semi-transparent colonies. This species of Salmonella is relatively heat-sensitive, being inactivated by heating at 60°C for 30 minutes. Conversely, it is highly tolerant of low temperatures, surviving for 2-3 weeks in water and 1-2 months in feces. While Salmonella is generally sensitive to antibiotics, antibiotic resistance is becoming increasingly common among Salmonella strains due to overuse.

[0003] Although traditional Salmonella testing has a long detection cycle of 3-7 days, it remains the international gold standard for food safety and clinical diagnosis. This method achieves target bacterial isolation and identification through a three-stage culture process: first, pre-enrichment culture at 37°C for 18-24 hours (buffered peptone water is a commonly used medium) eliminates antibacterial substances in the sample and revives low-concentration bacteria; then, enrichment culture at 42°C for 18-24 hours using a selective medium (such as RV Salmonella enrichment broth) inhibits the growth of non-target bacteria; finally, single colonies are obtained by incubation at 37°C for 18-24 hours using a selective isolation medium (XLD, HE agar), and strain confirmation is completed by combining biochemical tests and serological identification. This method has a detection limit of 1 CFU / sample, but its long cycle (difficult to meet the needs of rapid screening of fresh agricultural products), high cost, and interference problems caused by the matrix limit its application in point-of-care testing.

[0004] Currently, in the field of rapid testing, traditional PCR testing technology relies on precise temperature control equipment, has complex operating procedures, and a long testing cycle, making it difficult to meet the immediate testing needs of scenarios such as primary healthcare and on-site emergency response. Recombinant polymerase amplification (RPA) technology, with its advantages of isothermal amplification and rapid reaction, has become a research hotspot in nucleic acid testing. However, existing RPA systems still suffer from problems such as high reaction temperatures (mostly 37-42℃), long reaction times (usually 15-20 minutes), and high costs due to reliance on imported core enzymes. Furthermore, the lack of integrated testing devices limits its large-scale application in resource-constrained scenarios. Therefore, there is an urgent need to develop a rapid, sensitive, and convenient method for detecting Salmonella to ensure food safety and protect public health. Summary of the Invention

[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide primers, methods and kits for the combined detection of Salmonella by RPA-lateral flow chromatography, in order to solve the problems of existing Salmonella detection methods being complicated to operate, having long reaction times and high costs, and being unable to meet the needs of real-time detection.

[0006] To achieve the above and other related objectives, the present invention provides an RPA primer for detecting Salmonella, wherein the RPA primer for detecting Salmonella is as follows:

[0007] Forward primer Sal-invA-F-2: AGAAGGGTCGTCGTTAGGACTGATTGGCGAT;

[0008] Reverse primer Sal-invA-R-2: ATAAAGAACTGACTACGTAGACGCTCCGCA.

[0009] This application also provides a method for the combined detection of Salmonella using RPA-lateral flow chromatography, comprising the following steps:

[0010] (1) Extract genomic DNA from the sample to be tested;

[0011] (2) Using the genomic DNA extracted in step (1) as a template, perform RPA amplification reaction using the RPA primers for detecting Salmonella as described in claim 1;

[0012] (3) Take the amplification reaction product from step (2), dilute it to obtain a diluent, and vertically insert the lateral flow chromatography test strip into the diluent for detection. If two bands appear on the lateral flow chromatography test strip, one in the control area and one in the detection area, the result is positive, indicating that the sample contains Salmonella. If one band appears on the lateral flow chromatography test strip and it is in the control area, the result is negative, indicating that the sample does not contain Salmonella.

[0013] Preferably, in step (2), the amplification reaction system further includes at least T4-UvsX, T4-UvsY, T4-gp32, ATP, and Mg. 2+ .

[0014] Preferably, in step (2), the concentration of T4-UvsX in the amplification reaction system is 100~200 ng / μL, the concentration of T4-UvsY is 60~80 ng / μL, the concentration of T4-gp32 is 400~600 ng / μL, the concentration of ATP is 2~6 mM, and the concentration of Mg is... 2+ The concentration is 5~15 mM.

[0015] Preferably, in step (2), the amplification reaction temperature is 35~43℃ and the amplification reaction time is 15~30min.

[0016] This application also provides a kit for the combined detection of Salmonella by RPA-lateral flow chromatography, comprising the above-mentioned RPA primers for detecting Salmonella and a lateral flow chromatography test strip, wherein the kit is used to implement the above-mentioned method for the combined detection of Salmonella by RPA-lateral flow chromatography.

[0017] Addressing the performance bottlenecks and application limitations of isothermal nucleic acid amplification technology, this paper adopts a systematic research path of "RPA basic system optimization → RPA-lateral flow chromatography coupling device design → UvsX key enzyme modification, expression purification and application," which possesses significant scientific theoretical value, technological innovation significance and practical application prospects. This application focuses on the construction and optimization of an RPA system for the detection of Salmonella paratyphi B. Furthermore, it combines RPA technology with lateral flow chromatography to develop a novel RPA-lateral flow chromatography coupling device, truly achieving efficient, convenient and highly applicable on-site nucleic acid detection.

[0018] Preferably, the RPA-lateral flow chromatography kit for the combined detection of Salmonella includes a reaction tube and a colorimetric tube. The reaction tube is fitted with a heating tube, and the reaction tube is filled with RPA lyophilized powder. The RPA lyophilized powder contains at least the RPA primers for detecting Salmonella, T4-UvsX, T4-UvsY, T4-gp32, ATP, and Mg. 2+ The colorimetric tube contains a diluent tube and a side-flow chromatography test strip, and the diluent tube is filled with diluent. The reaction tube, diluent tube, and colorimetric tube all have a sealing structure. The walls of the reaction tube and diluent tube are scored, and the reaction tube and diluent tube will break along the scored plane under external force. The colorimetric tube is a flexible, transparent tube. The heating tube contains a bent, cylindrical isothermal USB heating element, which is used to heat the reaction tube via an external power source. The reaction tube and diluent tube can withstand temperatures from -20°C to 40°C.

[0019] The RPA-lateral flow chromatography combined detection kit for Salmonella in this application has the following advantages:

[0020] Pollution control: The fully enclosed reaction chamber is used to effectively avoid the risk of cross-contamination by aerosols;

[0021] Miniaturized equipment: Integrated self-heating module (37℃ constant temperature control), eliminating reliance on large equipment such as PCR instruments;

[0022] Visual interpretation: The test strip color development results can be used to determine the nature of the bacteria directly without the need for professional instruments, thus enabling on-site and low-cost operation of the entire process of "sampling-amplification-detection" of Salmonella paratyphi B.

[0023] Preferably, the heating tube and the color developing tube are PVC transparent flexible tubes, and the reaction tube and the diluent tube are quartz glass capillary tubes.

[0024] Quartz glass capillary tubes are chosen for containing lyophilized powder and its diluent (PBS). Firstly, the structure of quartz glass capillary tubes is highly stable compared to other materials, preventing the leaching of metal ions and organic additives during storage and reactions from affecting the lyophilized powder and diluent. Secondly, their strong resistance to hydrolysis and aging facilitates long-term storage of the lyophilized powder at low temperatures. Thirdly, their inner walls undergo hydroxylation treatment, significantly reducing their adsorption capacity for biomolecules such as proteins, thus minimizing sample loss. In contrast, borosilicate glass capillary tubes have relatively poor chemical stability, resulting in higher ion concentrations after prolonged immersion, which may affect experiments. Polytetrafluoroethylene (PTFE) capillary tubes are opaque and milky white, making it difficult to observe the internal storage conditions. Furthermore, their higher price compared to other materials makes them unsuitable for use in microfluidic devices.

[0025] PVC transparent tubing was chosen as the colorimetric tube for two main reasons. Firstly, transparent PVC has good transparency, with a light transmittance of 85%-92%, close to that of ordinary glass, meeting the requirements for dynamic fluid observation. Secondly, its flexibility allows for the breaking of the internal quartz glass capillary tube during actual device operation. While PE tubing is inexpensive and has good chemical stability, its semi-transparent, milky-white material is not conducive to observing experimental results. CR tubing has excellent elasticity, suitable for frequent bending scenarios, but its price is 1-2 times higher than PVC and PE tubing.

[0026] Preferably, the quartz glass capillary has an outer diameter of 5 mm, an inner diameter of 4 mm, and a length of 6 cm; the PVC transparent flexible tube has an outer diameter of 14 mm, an inner diameter of 12 mm, and a length of 10 cm.

[0027] Preferably, the diluent is PBS buffer.

[0028] Preferably, the side-flow chromatography test strip is fixed to the bottom groove of the colorimetric tube and maintains a 30° tilt angle to ensure that the mixture evenly covers the sample application pad.

[0029] More preferably, the sealing structure is a sealing cap, which adopts a stepped double-layer sealing structure and embeds a sealing ring in the middle to ensure the sealing of the reaction.

[0030] As described above, the present invention has the following beneficial effects:

[0031] (1) To meet the needs of on-site detection of Salmonella paratyphi B, the optimized RPA isothermal amplification system was combined with lateral flow chromatography test strip technology. Through primer design and reaction condition optimization, the detection sensitivity was increased from 3 pg / μL of the traditional RPA system to 3 fg / μL (a 1000-fold increase in sensitivity), and there was no cross-reaction to non-target strains. This achieved a dual breakthrough of "high sensitivity and strong specificity", providing a new method for rapid screening of foodborne pathogens.

[0032] (2) A portable combined device integrating RPA amplification and product detection was designed. It adopts a fully enclosed reaction chamber to effectively avoid the risk of cross-contamination by aerosols. It integrates an autonomous heating module to get rid of dependence on large equipment such as PCR instruments. It directly uses the color development results of the side-flow chromatography test strip to determine the result without the need for professional instruments, thereby realizing the on-site and low-cost operation of the whole process of "sampling-amplification-detection" of Salmonella paratyphi B. Attached Figure Description

[0033] Figure 1 The image shows electrophoresis of total DNA from Salmonella paratyphi B CMCC 50094 (1-4 are duplicates of total DNA from four tubes of Salmonella paratyphi B CMCC 50094).

[0034] Figure 2 The graph shows the effect of different T4-UvsX concentrations on RPA amplification efficiency (1: 100 ng / μL T4-UvsX; 2: 200 ng / μL T4-UvsX; 3: 300 ng / μL T4-UvsX; 4: 400 ng / μL T4-UvsX; 5: negative control).

[0035] Figure 3 The graph shows the effect of different T4-UvsY concentrations on RPA amplification efficiency (1: 20 ng / μL T4-UvsY; 2: 40 ng / μL T4-UvsY; 3: 60 ng / μL T4-UvsY; 4: 80 ng / μL T4-UvsY; 5: 100 ng / μL T4-UvsY; 6: Negative control).

[0036] Figure 4 The graph shows the effect of different T4-gp32 concentrations on RPA amplification efficiency (1: 200 ng / μL T4-gp32; 2: 400 ng / μL T4-gp32; 3: 600 ng / μL T4-gp32; 4: 800 ng / μL T4-gp32; 5: negative control).

[0037] Figure 5 Shown as different Mg2+ The effect of concentration on RPA amplification efficiency (1: 5 mM Mg) 2+ ; 2: 10 mM Mg 2 + 3: 15 mM Mg 2+ 4: 20 mM Mg 2+ 5: 25 mM Mg 2+ ; 6: Negative control)

[0038] Figure 6 The graph shows the effect of different ATP concentrations on RPA amplification efficiency (1: 2 mM ATP; 2: 4 mM ATP; 3: 6 mM ATP; 4: 8 mM ATP; 5: 10 mM ATP; 6: negative control).

[0039] Figure 7 The graph shows the effect of different temperatures on RPA amplification efficiency (1: 35℃; 2: 37℃; 3: 39℃; 4: 41℃; 5: 43℃).

[0040] Figure 8 The graph shows the effect of different reaction times on RPA amplification efficiency (1: 5 min; 2: 10 min; 3: 15 min; 4: 20 min; 5: 25 min; 6: 30 min).

[0041] Figure 9 The results are shown as the sensitivity results of the RPA system (1: 300 ng / μL; 2: 30 ng / μL; 3: 3 ng / μL; 4: 300 pg / μL; 5: 30 pg / μL; 6: 3 pg / μL; 7: 300 fg / μL).

[0042] Figure 10 The results show the specificity of the RPA system (1: Listeria LM1; 2: Escherichia coli O104; 3: Escherichia coli O157; 4: Staphylococcus aureus D48; 5: Staphylococcus carinatum pCA 44; 6: Staphylococcus warwick; 7: Micrococcus luteus 10209; 8: Pseudomonas aeruginosa ATCC 47085; 9: Salmonella paratyphi B CMCC 50094; 10: Negative control).

[0043] Figure 11 The image shows the actual product of the RPA-lateral flow chromatography kit for the combined detection of Salmonella (A: Preparation of reaction tubes and dilution tubes; B: Actual product of heating tube; C: Actual product of colorimetric tube; D: Reaction results of the apparatus).

[0044] Figure 12 This diagram illustrates the detection principle of the RPA-lateral flow chromatography combined detection kit for Salmonella.

[0045] Figure 13 The image shows the specificity validation results of the RPA-lateral flow chromatography combined detection kit for Salmonella.

[0046] Figure 14 The image shows the sensitivity test results of the RPA-lateral flow chromatography combined detection kit for Salmonella.

[0047] Figure 15 The images show actual samples of artificially contaminated food (A: processed food samples (milk, egg liquid, beef homogenate, pork homogenate); B: four types of artificially contaminated samples with high, medium, and low levels of contamination; C: actual images of positive and negative detection results from the device).

[0048] Figure 16 The image shows the results of testing artificially contaminated samples using the RPA-lateral flow chromatography kit for the detection of Salmonella (A: milk; B: egg liquid; C: beef homogenate; D: pork homogenate).

[0049] Figure 17 The results show the RPA detection results for three types of Salmonella (M: DNA marker; 1: Salmonella paratyphi A; 2: Salmonella paratyphi B; 3: Salmonella enteritidis subsp. enteritidis; 4: negative control). Detailed Implementation

[0050] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0051] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0052] The experimental strains used in the following embodiments of this application are:

[0053] Salmonella paratyphi B CMCC 50094, Listeria LM1, Escherichia coli O104, Escherichia coli O157, Pseudomonas aeruginosa ATCC 47085, Staphylococcus aureus D48, Staphylococcus wartii, Staphylococcus carminatus pCA 44, and Micrococcus luteus 10209 were preserved in the laboratory.

[0054] The RPA primers for detecting Salmonella are as follows:

[0055] Forward primer Sal-invA-F-2: AGAAGGGTCGTCGTTAGGACTGATTGGCGAT;

[0056] Reverse primer Sal-invA-R-2: ATAAAGAACTGACTACGTAGACGCTCCGCA.

[0057] This application provides a method for the combined detection of Salmonella using RPA-lateral flow chromatography, comprising the following steps:

[0058] (1) Extract genomic DNA from the sample to be tested;

[0059] Salmonella total DNA extraction

[0060] Salmonella paratyphi B CMCC 50094 was picked from glycerol bacteria stored at -80℃ in the laboratory and streaked onto LB solid medium. The culture was incubated overnight at 37℃ with the medium inverted. Single colonies of suitable size were picked and inoculated into 10 mL of LB liquid medium and incubated overnight at 37℃ with shaking at 180 rpm. Genomic DNA was extracted from Salmonella using the Shanghai Sangon Biotech Bacterial Genomic DNA Rapid Extraction Kit according to the manufacturer's instructions. 1 mL of the overnight Salmonella culture was added to a 1.5 mL centrifuge tube and centrifuged at 8,000 rpm for 1 min at room temperature. The supernatant was discarded, and the bacterial cells were collected. 400 µL of Buffer Digestion was added, and the mixture was vortexed. The cells were incubated at 65℃ for 1 h until complete lysis.

[0061] Add 200 µL of Buffer PB, mix thoroughly by inverting, and incubate at -20°C for 5 min. Centrifuge at 10,000 rpm for 5 min at room temperature, and transfer the supernatant (500-550 µL) to a new 1.5 ml centrifuge tube.

[0062] Add an equal volume of isopropanol, invert 5-8 times to mix thoroughly, and let stand at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant. Add 1 ml of 75% ethanol, invert and rinse for 1-3 minutes, centrifuge at 10,000 rpm for 2 minutes, discard the supernatant, and repeat once.

[0063] Open the lid and invert at room temperature for 5-10 minutes until any residual ethanol has completely evaporated. Dissolve the obtained DNA in 50-100 µL of TE buffer. The extracted DNA can be used immediately for the next experiment or stored at -20°C.

[0064] The concentration of Salmonella paratyphi B CMCC 50094 extracted from the four tubes was determined using a nucleic acid concentration analyzer, and the DNA was analyzed by agarose gel electrophoresis. The experimental results are as follows: Figure 1 As shown, a clear, single band can be seen on the gel, indicating that the extracted DNA is of high purity and intact.

[0065] (2) Using the genomic DNA extracted in step (1) as a template, perform RPA amplification reaction using the RPA primers for detecting Salmonella as described in claim 1;

[0066] Remove all components required for the reaction from the -20℃ freezer and thaw on ice. Referring to Table 1, under ice bath conditions, add buffer, ddH2O, RPA primers for detecting Salmonella, ATP, dNTPs, and creatine phosphate disodium salt to a 200 μL PCR tube. Mix thoroughly with a pipette, then add creatine kinase and the core reaction components in sequence, mixing thoroughly again. Finally, add the template gene and add magnesium acetate to the tube wall. After capping, invert the PCR tube and vortex for 10-15 s to mix thoroughly. Centrifuge for 5-8 s in a handheld centrifuge to collect all liquid at the bottom of the tube. After adding the contents, heat at 39℃ for 30 min, then at 60℃ for 10 min to inactivate the protein. Finally, observe the reaction results by agarose gel electrophoresis.

[0067] Table 1. RPA Reaction System

[0068]

[0069] RPA reaction system optimization

[0070] T4-UvsX concentration optimization

[0071] Based on the RPA primers for detecting Salmonella mentioned above, an RPA reaction system was established, and a concentration gradient of 100 ng / μL, 200 ng / μL, 300 ng / μL, and 400 ng / μL was set for T4-UvsX. A blank control with a concentration of 200 ng / μL and no template was added, and the RPA amplification reaction was performed.

[0072] Electrophoresis results as follows Figure 2As shown, a clear amplification band was observed when the UvsX concentration was between 100-200 ng / μL, but no target amplification band appeared with further increases in concentration. This may be because excessively high UvsX concentrations may affect the activity of other proteins or even hinder the normal pairing of primers and DNA templates. Simultaneously, excessively low UvsX concentrations can reduce the strand exchange activity of DNA itself, thus affecting the normal amplification reaction. Based on these considerations, 200 ng / μL was selected as the final UvsX concentration in the RPA system for subsequent experiments. T4-UvsY concentration optimization.

[0073] Based on the optimized RPA reaction system described above, and with concentration gradients of T4-UvsY set at 20 ng / μL, 40 ng / μL, 60 ng / μL, 80 ng / μL, and 100 ng / μL, and a blank control of 40 ng / μL without template added, RPA amplification reactions were performed. The electrophoresis results of the optimized UvsY concentration are shown below. Figure 3 As shown in the figure, the results indicate that the amplification product bands are brightest when the concentration is between 60-80 ng / μL. Band brightness decreases at excessively high and low concentrations. When the UvsY concentration is too low, UvsX cannot effectively bind to the DNA template, leading to decreased primer binding efficiency; while at excessively high concentrations, excess UvsY occupies DNA sites, affecting the formation of the UvsX-primer complex. Based on these results, 60 ng / μL was selected as the final concentration of UvsY accessory protein in the RPA system.

[0074] T4-gp32 concentration optimization

[0075] Based on the optimized RPA reaction system described above, and with concentration gradients for T4-gp32 set at 200 ng / μL, 400 ng / μL, 600 ng / μL, and 800 ng / μL, and a blank control at a concentration of 600 ng / μL without template added, RPA amplification was performed. The electrophoresis results of T4-gp32 are shown below. Figure 4 As shown in the figure, the target bands appeared at concentrations between 200 and 800 ng / μL. Among them, gp32 showed the highest band brightness and best reaction efficiency at a concentration of 400 ng / μL. Too low a concentration of gp32 destabilized the single-stranded DNA, causing it to re-anneal and thus hindering primer binding and reducing amplification efficiency; conversely, too high a concentration occupied the UvsX / UvsY binding sites, interfering with the formation of the recombinase complex. Based on these experimental results, 400 ng / μL was selected as the final concentration of T4-gp32 in the RPA system.

[0076] Mg 2+ Concentration optimization

[0077] Based on the optimized RPA reaction system described above, and targeting Mg 2+ A concentration gradient was set at 5 mM, 10 mM, 15 mM, 20 mM, and 25 mM, with a blank control (15 mM without template) added, and RPA amplification was performed. The electrophoresis results after magnesium ion concentration optimization are shown below. Figure 5 As shown. The results show Mg 2+ Bands were observed at concentrations ranging from 5 to 20 mM. Specifically, as the concentration increased from 5 mM to 15 mM, the band brightness of the amplified product increased sequentially; after 15 mM, the band brightness decreased sequentially, indicating that high concentrations of Mg... 2+ This actually reduces amplification efficiency. One possible reason for this is that Mg... 2+ Competition for the binding site between UvsX and ATP reduces primer binding efficiency and also decreases the proofreading function of polymerase, leading to non-specific amplification. Based on relevant literature and the above analysis, 15 mM was subsequently selected as the Mg content for the RPA reaction. 2+ The final concentration.

[0078] ATP concentration optimization

[0079] Based on the optimized RPA reaction system described above, and with ATP concentration gradients of 2 mM, 4 mM, 6 mM, 8 mM, and 10 mM, and a blank control of 4 mM without template added, RPA amplification was performed. The electrophoresis results for ATP concentration optimization are shown below. Figure 6 As shown in the figure. The results showed that clear target bands could be seen in the ATP concentration range of 2-6 mM, and there were significant differences in the brightness of different bands: the amplified band was the brightest at 4 mM, and the brightness decreased successively at 2 mM and 6 mM concentrations. No amplified bands appeared at 8 mM and 10 mM concentrations. Based on the above structure, 4 mM was selected as the final ATP concentration in the RPA reaction for subsequent experiments.

[0080] Optimization of reaction temperature

[0081] Based on the optimized RPA reaction system described above, and with temperature gradients set at 35℃, 37℃, 39℃, 41℃, and 43℃, RPA amplification reactions were performed. The electrophoresis results for the optimized reaction temperature are shown below. Figure 7 As shown, the electrophoresis results indicate that the target bands can be observed within the temperature range of 35-43℃, indicating that the RPA reaction can proceed normally within this temperature range. However, considering the heating energy consumption, and given that the difference in band brightness is not significant within the 37-43℃ range, 37℃ was selected as the RPA reaction temperature for subsequent experiments.

[0082] Response time optimization

[0083] Based on the optimized RPA reaction system described above, and with time gradients set at 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min, RPA amplification reactions were performed. The electrophoresis results for the optimized reaction time are shown below. Figure 8 As shown in the figure. Electrophoresis results show that the brightness of the target band gradually increases with the increase of reaction time. Considering the sensitivity of the reaction and the need to keep the reaction time as short as possible, the final reaction time was determined to be 30 min.

[0084] Response sensitivity

[0085] The sensitivity of the RPA detection method constructed with the optimized parameters using Salmonella was analyzed, and the experimental results are as follows: Figure 9 As shown in the figure, the extracted Salmonella genomic DNA was serially diluted to obtain a series of DNA templates with concentrations of 300 ng / μL, 30 ng / μL, 3 ng / μL, 300 pg / μL, 30 pg / μL, 3 pg / μL, and 300 fg / μL. The results show that as the concentration gradually decreased, the brightness of the target amplification product band gradually decreased. No amplification band appeared at the concentration of 300 fg / μL and in the negative control, indicating that the limit of detection (LOD) of the RPA amplification system constructed using Salmonella genomic DNA is 3 pg / μL.

[0086] Reaction Specificity

[0087] The specificity of the RPA detection method constructed with the optimized parameters using Salmonella was analyzed. Salmonella paratyphi B CMCC 50094 was used as the experimental group, while Listeria LM1, Escherichia coli O104, Escherichia coli O157, Staphylococcus aureus D48, Staphylococcus carinatum pCA 44, Staphylococcus wartii, Micrococcus luteus 10209, Pseudomonas aeruginosa ATCC 47085, and sterile water were used as the control groups. The experimental results are as follows: Figure 10 As shown in the figure, a clear amplification band was observed in the lane containing Salmonella paratyphi B CMCC 50094, while no amplification bands were observed in the other lanes, indicating that the RPA amplification reaction established for Salmonella paratyphi B CMCC 50094 has high specificity.

[0088] (3) Take the amplification reaction product completed under the optimized conditions of the above RPA amplification system, dilute it to obtain a diluent, and vertically insert the lateral flow chromatography test strip into the diluent for detection. If the lateral flow chromatography test strip shows two bands, one in the quality control area and one in the detection area, the result is positive, indicating that the sample contains Salmonella; if the lateral flow chromatography test strip shows one band and it is in the quality control area, the result is negative, indicating that the sample does not contain Salmonella.

[0089] This application also provides a kit for the combined detection of Salmonella using RPA-lateral flow chromatography, such as... Figure 11 As shown, the kit consists of three parts: a reaction tube for storing lyophilized powder, a heating tube for heating the reaction tube, and a colorimetric tube for displaying the final reaction results.

[0090] The reaction tube is a quartz glass capillary tube with an outer diameter of 5 mm, an inner diameter of 4 mm, and a length of 6 cm. If the capillary tube is too thin, on the one hand, the reaction tube will have low hardness and be easily damaged during storage; on the other hand, a thin tube will not facilitate the flow of liquid inside the tube. Conversely, a tube that is too thick will increase costs and is not conducive to the simplicity and compactness of the detection device. Both ends are sealed with matching caps (outer diameter 5 mm, inner diameter 3.9 mm) printed by a 3D printer. The bottom 1 cm is pre-sealed with sealing putty, and the bottom 1 cm is pre-polished with a grinding wheel to facilitate breaking the glass tube at the polished point later, thus allowing the liquid inside the glass tube to flow out more easily. See the detailed procedure below. Figure 11 A. The internal components contain pre-lyophilized RPA reaction components (buffer, primer set, creatine phosphate disodium salt, ATP, dNTPs, magnesium acetate, UvsX, UvsY, BSU, gp32, creatine kinase). The heating element is a 14 mm outer diameter, 12 mm inner diameter, and 8 cm long transparent PVC tube. It contains a bent, cylindrical isothermal USB heating element. Upon connection to a power source, it provides continuous heating at approximately 39°C, meeting the temperature requirements of the RPA reaction. The bottom is sealed with a matching cap (14 mm outer diameter, 11.9 mm inner diameter). See the attached image for a detailed product picture. Figure 11 B. The colorimetric tube is a 10 cm long, 14 mm outer diameter, 12 mm inner diameter, PVC transparent tube. It contains pre-made test strips and a sealed diluent tube. The diluent tube is identical in shape to the reaction tube, and contains 350 μL of PBS pre-filled and sealed at both ends with the matching caps. See the attached image for a detailed picture. Figure 11 C. Figure 12 This is a schematic diagram illustrating the working principle of the RPA-lateral flow chromatography combined detection kit for Salmonella.

[0091] The main testing process includes:

[0092] The first step is to preprocess the sample to be tested to obtain crude genomic DNA. Take 5 μL of crude genomic DNA, add 45 μL of ddH2O, mix well, and then add it to the reaction tube. Then, put on the matching cap to seal it.

[0093] The second step is to insert the reaction tube into the heating tube, connect the USB interface, and heat for 30 minutes.

[0094] The third step is to drop the heated reaction tube into the colorimetric tube containing the side-flow chromatography test strip and diluent tube, and then seal it with the matching cap.

[0095] The fourth step is to gently pry open the bottom of the PVC transparent tube to disconnect the reaction tube and diluent tube from the polished area. This allows the reaction solution and diluent to flow out of the tube and mix at the bottom of the tube. The mixture will then extend upwards along the sample application pad of the side-flow chromatography test strip, ultimately achieving the purpose of detection.

[0096] See the actual image of the RPA-sideflow chromatography combined device for on-site testing results. Figure 11 D.

[0097] The RPA-lateral flow chromatography kit for detecting Salmonella is used for the detection of artificially contaminated samples.

[0098] Artificially contaminated samples (milk, eggs, beef, and pork) with high, medium, and low bacterial counts were treated with a bacterial sample rapid release agent to obtain crude genomic DNA. Using this as a template, a newly established RPA-lateral flow chromatography system was used to detect contaminated food samples.

[0099] Technical testing for Salmonella specificity verification

[0100] To verify the specificity of the RPA technology combined with lateral flow chromatography test strip technology for detecting Salmonella beta, Salmonella betae, Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Staphylococcus carinatum, Staphylococcus war nettle, Micrococcus luteus, Pseudomonas aeruginosa, and sterile water were selected as reaction templates for specificity experiments. The components of the RPA reaction system constructed in Chapter 2 were mixed with the corresponding genomic DNA of the reaction template and heated at 37°C for 30 min. Then, 350 μL of PBS was added to the amplified product for dilution, and after thorough mixing, approximately 80 μL of the diluted solution was added to the sample pad of a laboratory-made test strip. The specificity experimental results are as follows: Figure 12 As shown, we can clearly see that both the C and T lines are visible on the test strip results for Salmonella paratyphi B, while only the C line is visible on the corresponding test strips for Listeria monocytogenes, Escherichia coli, Staphylococcus aureus, Staphylococcus carinatum, Staphylococcus war nettle, Micrococcus luteus, Pseudomonas aeruginosa, and sterile water. This indicates that the RPA technology combined with lateral flow chromatography test strip technology for detecting Salmonella B has good specificity and can meet the detection requirements.

[0101] In the screening of the aforementioned RPA reaction systems, when using RPA technology to detect Salmonella betaecarpa, the determination of amplification results mainly relies on agarose gel electrophoresis. However, this method suffers from two drawbacks: firstly, nucleic acid diffusion during electrophoresis leads to nucleic acid loss; secondly, low-concentration amplification products are easily masked by fluorescence in the gel background. The side-flow chromatography test strip method, on the other hand, offers significant advantages. The design of dual-labeled primers allows the amplification products to bind to antibodies on the test strip, making the results readily observable with the naked eye. Furthermore, the high specificity of antibody binding greatly reduces interference from non-specific amplification products.

[0102] Genomic DNA extracted from Salmonella betae was serially diluted to obtain DNA templates of 300 ng / μL, 30 ng / μL, 3 ng / μL, 300 pg / μL, 30 pg / μL, 3 pg / μL, 300 fg / μL, 30 fg / μL, and 3 fg / μL, respectively. Sterile water was used as a negative control. The templates were detected using RPA-LFA technology, and the results are shown below. Figure 14 As shown. From Figure 14 As can be seen, two lines, C and T, can be observed in all nine dilution gradients of Salmonella betae genomic DNA. Furthermore, the color depth of the T line gradually decreases as the concentration decreases. In contrast, the negative control, sterile water, only shows one line, C. This demonstrates that the sensitivity of this method for detecting Salmonella betae reaches 3 fg / μL.

[0103] RPA-lateral flow chromatography combined with device for detecting artificially contaminated samples First, the food ingredients purchased from a local supermarket were pre-processed. Milk was poured directly into a 15 mL centrifuge tube. Eggs were shelled, stirred with a glass rod, and then poured into a centrifuge tube. Beef and pork were cut into small pieces, 4 g of each were weighed out, and 12 mL of PBS was added. The mixture was homogenized at low speed until the tissue was dispersed, then homogenized at high speed for 60 s, and finally transferred to centrifuge tubes. The experimental results are shown in the figure. Figure 15 A. After treatment, four food samples were inoculated with Salmonella betaecarpa, with each food sample inoculated with three different levels of bacterial load. The resulting artificially contaminated samples are shown below. Figure 15 As shown in B. Crude DNA was then obtained according to the method described above, and used as a template for detection according to the working principle of the RPA-lateral flow chromatography coupled device. Representative equipment and test results are shown below. Figure 15 As shown in C.

[0104] See the image below for the results of four food samples contaminated with Salmonella at different levels. Figure 16If the sample is Salmonella positive, both the test line and the control line will appear. Conversely, if the sample is Salmonella negative, only the control line will be displayed, and the test line will not be shown. As can be seen from the graphs, all the test strips in the results graphs showed both the test line and the control line, indicating that the detection limit of this device reached 5-6 CFU / mL in spiked samples of four types of food: milk, egg liquid, beef homogenate, and pork homogenate. Based on this, we successfully detected the presence of Salmonella in 12 groups of samples.

[0106] This application verifies the specificity and sensitivity of RPA combined with lateral flow chromatography test strip technology for detecting Salmonella paratyphi B. The RPA combined with lateral flow chromatography test strip technology constructed in this application exhibits high specificity; through experiments using serial dilutions of Salmonella paratyphi B genomic DNA, its sensitivity reached 3 fg / μL. This application designs a kit for the combined detection of Salmonella using RPA-lateral flow chromatography, concentrating the RPA reaction and the lateral flow chromatography test strip reaction in a sealed space. This device design ensures that the entire reaction is completed within a sealed space, effectively avoiding the problem of aerosol contamination. Furthermore, the device is compact and portable, facilitating result observation, and includes a built-in heating device, avoiding the dependence on large heating equipment for the RPA reaction. This device successfully detected three different levels of Salmonella paratyphi B contamination in four food samples: milk, egg liquid, beef, and pork, making it suitable for on-site testing.

[0107] To verify the universality of the RPA-lateral flow chromatography combined detection method and kit for Salmonella in this application, the embodiments of this application were used to detect three types of Salmonella. The RPA detection results are as follows: Figure 17 As shown.

[0108] from Figure 17 The results showed that the RPA reaction products of Salmonella Paratyphi A, Salmonella Paratyphi B, and Salmonella Enteritidis subsp. Enteritidis all exhibited a 144 bp target band in the agarose gel electrophoresis images, while the blank control group did not show any target band. Based on these results, the RPA primers used in this application for detecting Salmonella were able to successfully detect all three types of Salmonella.

[0109] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. An RPA primer for detecting Salmonella, characterized in that, The RPA primers for detecting Salmonella are as follows: Forward primer Sal-invA-F-2: AGAAGGGTCGTCGTTAGGACTGATTGGCGAT; Reverse primer Sal-invA-R-2: ATAAAGAACTGACTACGTAGACGCTCCGCA.

2. A method for the combined detection of Salmonella using RPA-lateral flow chromatography, characterized in that: Includes the following steps: (1) Extract genomic DNA from the sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform RPA amplification reaction using the RPA primers for detecting Salmonella as described in claim 1; (3) Take the amplification reaction product from step (2), dilute it to obtain a diluent, and vertically insert the lateral flow chromatography test strip into the diluent for detection. If two bands appear on the lateral flow chromatography test strip, one in the control area and one in the detection area, the result is positive, indicating that the sample contains Salmonella. If one band appears on the lateral flow chromatography test strip and it is in the control area, the result is negative, indicating that the sample does not contain Salmonella.

3. The method according to claim 2, characterized in that: In step (2), the amplification reaction system also includes at least T4-UvsX, T4-UvsY, T4-gp32, ATP, and Mg. 2+ .

4. The method according to claim 3, characterized in that: In step (2), the concentrations of T4-UvsX, T4-UvsY, T4-gp32, ATP, and Mg in the amplification reaction system are 100-200 ng / μL, 60-80 ng / μL, 400-600 ng / μL, 2-6 mM, and Mg. 2+ The concentration is 5~15 mM.

5. The method according to claim 1, characterized in that: In step (2), the amplification reaction temperature is 35~43℃ and the amplification reaction time is 15~30min.

6. A kit for the combined detection of Salmonella using RPA-lateral flow chromatography, characterized in that: The kit includes the RPA primers and lateral flow chromatography test strips for detecting Salmonella as described in claim 1, and is used to implement the method for combined RPA-lateral flow chromatography detection of Salmonella as described in any one of claims 2 to 5.

7. The reagent kit according to claim 6, characterized in that: The RPA-lateral flow chromatography kit for the combined detection of Salmonella includes a reaction tube and a colorimetric tube. The reaction tube is encased in a heating tube and filled with lyophilized RPA powder. The lyophilized RPA powder contains at least the RPA primers for detecting Salmonella, T4-UvsX, T4-UvsY, T4-gp32, ATP, and Mg. 2+ The colorimetric tube contains a diluent tube and a side-flow chromatography test strip, and the diluent tube is filled with diluent. The reaction tube, diluent tube, and colorimetric tube all have a sealing structure. The walls of the reaction tube and diluent tube are scored, and the reaction tube and diluent tube will break along the scored plane under external force. The colorimetric tube is a flexible, transparent tube. The heating tube contains a bent, cylindrical isothermal USB heating element, which is used to heat the reaction tube via an external power source. The reaction tube and diluent tube can withstand temperatures from -20°C to 40°C.

8. The reagent kit according to claim 7, characterized in that: The heating tube and color developing tube are made of PVC transparent flexible tubing, and the reaction tube and diluent tube are made of quartz glass capillary tubes.

9. The reagent kit according to claim 8, characterized in that: The quartz glass capillary has an outer diameter of 5 mm, an inner diameter of 4 mm, and a length of 6 cm; the PVC transparent flexible tube has an outer diameter of 14 mm, an inner diameter of 12 mm, and a length of 10 cm.

10. The kit according to claim 7, characterized in that: The diluent is PBS buffer.