New molecular target for rapid detection of enterococcus faecalis in food and method for detecting the same

Abstract

The application discloses a new molecular target for rapidly detecting Streptococcus faecalis in food and a detection method thereof. The specific molecular target for identifying Streptococcus faecalis is shown in the nucleotide sequence of SEQ ID NO. 1. The application discloses the specific molecular target for identifying Streptococcus faecalis, and provides related primers and a corresponding PCR detection method. Compared with the prior art, the detection method of the application can detect more Streptococcus faecalis, and the practicability is enhanced. Meanwhile, through DNA sensitivity, pure bacteria sensitivity, anti-interference ability and probiotic food sample detection ability evaluation, it is proved that the application has good application effect in different detection objects and complex sample backgrounds. The detection method of the application has the advantages of simple operation, easy result determination, short detection time, strong specificity, high sensitivity, good anti-interference ability, low cost and good stability for Streptococcus faecalis detection.

Description

Technical Field

[0001] This invention belongs to the field of microbial testing technology and relates to a new molecular target for rapid detection of fecal streptococci in food and its detection method. Background Technology

[0002] Enterococcus faecalis ( Enterococcus faecalis Enterococcus faecalis is a Gram-positive, facultative anaerobic coccus, often appearing singly, in pairs, or in short chains. It is widely found in the intestines of humans and animals, in food, water, soil, sewage, and environmental samples. It can exist as a member of the normal intestinal flora, as well as as an important opportunistic pathogen and indicator of hygiene contamination. Enterococcus faecalis exhibits strong tolerance to the external environment and can survive under certain salt concentrations, temperature variations, and complex substrates. Therefore, it has significant detection value in areas such as food safety, drinking water hygiene, environmental monitoring, animal husbandry, and clinical infection control.

[0003] Enterococci are among the most common and clinically significant species in the genus Enterococcus, causing various diseases such as urinary tract infections, wound infections, abdominal infections, bacteremia, sepsis, and infective endocarditis. One study reported that among 1157 clinical Enterococcal isolates collected from a hospital, Enterococci were present in 382 cases (33.0%), making them one of the main species in clinical Enterococcal infections. Another study analyzed 320 Enterococcus isolates from different clinical specimens collected from a hospital in Shenzhen between 2010 and 2016. The results showed that urine was the primary source (139 isolates, 43.4%), followed by wound secretions (57 isolates, 17.8%), blood (32 isolates, 10.0%), bile (27 isolates, 8.4%), and other sources (65 isolates, 20.3%). The above data indicate that Enterococcus faecalis is widely distributed in clinical infection samples, and is particularly closely related to urinary tract infections, wound infections, and bloodstream infections.

[0004] In recent years, with the widespread use of antibiotics, drug resistance in *Enterococcus faecalis* has become increasingly prominent, posing significant challenges to clinical treatment and hospital infection control. Literature reports that among 320 clinical isolates of *Enterococcus faecalis*, 207 strains (64.7%) were positive for the *ermB* gene; their resistance rate to erythromycin was as high as 95.6%, and to telithromycin 51.3%. International data shows that *Enterococcus* can cause approximately 15%–20% of hospital-acquired urinary tract infections, and about 60% of *Enterococcus* infections are related to healthcare facilities. *Enterococcus faecalis* also possesses characteristics such as biofilm formation, tolerance to adverse environments, and the acquisition and transfer of drug-resistant genes, making them highly susceptible to transmission and persistent contamination in hospital environments, food processing environments, and aquatic environments. Therefore, rapid, accurate, and specific detection of *Enterococcus faecalis* is of great significance for clinical infection diagnosis, guidance of anti-infection treatment, hospital infection control, food safety evaluation, and environmental hygiene monitoring.

[0005] In the fields of food and water safety, *Enterococcus faecalis* is also an important indicator of microbial contamination. my country's GB 8538-2022 "National Food Safety Standard - Test Methods for Drinking Natural Mineral Water" has included *Enterococcus faecalis* in the microbial testing items for drinking natural mineral water, and also specifies the detection methods for indicators such as coliforms, *Enterococcus faecalis*, *Pseudomonas aeruginosa*, and *Clostridium perfringens*. This indicates that *Enterococcus faecalis*-related testing not only serves clinical infection diagnosis but is also widely used in drinking water hygiene evaluation and food safety supervision. For the detection of *Enterococcus* in food and water samples, traditional methods typically require multiple steps, including sample pretreatment, selective enrichment, isolation and culture, colony observation, biochemical identification, and subsequent confirmation. The operation process is lengthy, with a testing cycle usually exceeding 48 hours, making it difficult to meet the practical needs of food companies for rapid release, screening by grassroots laboratories, and emergency environmental monitoring.

[0006] Currently, methods for detecting Enterococcus faecalis mainly include traditional isolation and culture methods, biochemical identification methods, automated microbial identification systems, mass spectrometry, immunological detection, and molecular biological detection. While traditional culture and biochemical identification methods yield relatively reliable results, they are cumbersome and time-consuming. Furthermore, different species within the Enterococcus genus are closely related, and some strains share similar colony morphology, biochemical reactions, and physiological characteristics, leading to inaccurate identification or cross-contamination with closely related bacteria. Automated identification systems and MALDI-TOF MS mass spectrometry offer high throughput and fast detection speeds, but they rely on specialized instruments, supporting databases, and professional operators, resulting in higher detection costs and limiting their widespread application in grassroots laboratories, food enterprises, and on-site testing scenarios.

[0007] With the development of molecular biology techniques, nucleic acid detection methods, such as PCR, real-time quantitative PCR, and loop-mediated isothermal amplification, have gradually become an important direction for the rapid detection of Enterococcus faecalis. Molecular detection methods have advantages such as short detection time, high sensitivity, relatively simple operation, and intuitive result interpretation, making them suitable for rapid screening and accurate identification of target bacteria. However, the accuracy of molecular detection methods largely depends on the specificity and conservation of the detection target. While commonly used universal targets such as 16S rRNA can be used for bacterial classification and identification, their resolution is limited when distinguishing Enterococcus faecalis from other closely related enterococci. Some reported targets suffer from insufficient intraspecies coverage, interspecies cross-amplification, or a limited number of experimentally validated strains, which can easily affect the accuracy and stability of the detection results. Summary of the Invention

[0008] To address the aforementioned problems, the purpose of this invention is to overcome the shortcomings of existing technologies and provide a novel specific molecular target for identifying Enterococcus faecalis and a rapid detection method thereof. This novel specific molecular target offers advantages such as high specificity, high detection efficiency, simple operation, and strong anti-interference ability. It can detect Enterococcus faecalis without the need for mass spectrometry, biochemical identification, or other methods, making it more practical.

[0009] This invention utilizes comparative genomics and pan-genome analysis to screen specific fragments from the *Enterococcus faecalis* genome that are stably present in target bacteria but absent or significantly different in non-target bacteria. Based on these fragments, primers were designed to establish a PCR detection method, effectively improving the specificity and accuracy of *Enterococcus faecalis* detection. This rapid detection method based on novel molecular targets can be used for rapid screening of *Enterococcus faecalis* in food, water, environmental, and clinical samples, providing a new technological foundation for food safety supervision, drinking water hygiene monitoring, hospital infection control, and the development of related diagnostic kits.

[0010] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The present invention claims protection for a specific molecular target (named dut) for identifying fecal streptococci, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0011] Specific sequence fragments found in *Enterococcus faecalis* were obtained through pan-genome analysis, as shown in SEQ ID NO. 1; these fragments can serve as novel molecular targets for identifying *Enterococcus faecalis*. Whether the analyte contains *Enterococcus faecalis* can be determined by observing whether the amplified product shows a signal at the expected position.

[0012] A second objective of this invention is to provide the application of the aforementioned specific molecular targets in the identification of fecal streptococci for non-disease diagnostic and therapeutic purposes.

[0013] A third object of the present invention is to provide a set of PCR primers for identifying *Enterococcus faecalis*, said primer set being designed based on the nucleotide sequence shown in SEQ ID NO. 1. Preferably, it includes: F: 5'-AGAAGAGGGCTTGAGTGT-3', R: 5'-GTCATCATCCGCTAATAAA-3'.

[0014] A fourth object of the present invention is to provide a kit for identifying fecal streptococci, which contains the above-described PCR primer set.

[0015] A fifth objective of this invention is to provide the application of the above-described PCR primer set or kit in the detection of fecal streptococci for non-disease diagnostic and therapeutic purposes.

[0016] The sixth object of the present invention is to provide a method for identifying fecal streptococci for non-disease diagnostic and therapeutic purposes, comprising the following steps:

[0017] S1: Use the above PCR primer set to perform PCR amplification on the DNA of the sample to be tested;

[0018] S2: Perform gel electrophoresis to detect the amplification products;

[0019] S3: Observe whether the size of the amplified product meets expectations.

[0020] The primer set of the present invention has good product specificity, and the presence of the fecal streptococcus can be determined by observing whether the amplified product is in the expected position.

[0021] In a preferred embodiment of the present invention, the PCR amplification system in S1 includes: 2×Hieff® masterPCR Mix, template DNA, PCR primer set and sterile double-distilled water.

[0022] In a preferred embodiment of the present invention, the PCR amplification system comprises: 12.5 μL of 2×Hieff® master PCR Mix, 0.5 μL of 10 μmol / L upstream primer, 0.5 μL of 10 μmol / L downstream primer, 1 μL of template DNA, and sterile double-distilled water to a final volume of 25 μL.

[0023] In a preferred embodiment of the present invention, the PCR amplification in S1 is performed as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60.8°C for 30 s, extension at 72°C for 45 s, for a total of 35 cycles of denaturation, annealing, and extension; and finally, final extension at 72°C for 10 min.

[0024] Furthermore, the sample to be tested is a pure bacterial culture, a mixed bacterial system, or a spiked sample of probiotic food containing fecal streptococci.

[0025] This invention discloses a specific molecular target for identifying *Enterococcus faecalis* and provides a related primer set and corresponding PCR detection method. Compared with existing technologies, the detection method of this invention can detect more *Enterococcus faecalis*, enhancing its practicality. Furthermore, evaluations of DNA sensitivity, pure bacterial sensitivity, anti-interference ability, and detection capability in probiotic food spiked samples demonstrate its good application performance under different detection targets and complex sample backgrounds. The detection method of this invention for *Enterococcus faecalis* detection has the advantages of simple operation, easy result interpretation, short detection time, high specificity, high sensitivity, good anti-interference ability, low cost, and good stability. Attached Figure Description

[0026] Figure 1 The electrophoresis results of the PCR evaluation of the novel molecular target specific to *Enterococcus faecalis* in Example 2 (target bacteria).

[0027] Figure 2 The electrophoresis results of PCR evaluation of the novel molecular target specific to Enterococcus faecalis in Example 2 (non-target bacteria).

[0028] Figure 3 The electrophoresis results were used to evaluate the sensitivity of the PCR detection method for the specific new molecular target in Example 3 to detect DNA from the strain *Streptococcus faecalis*.

[0029] Figure 4 The electrophoresis results are used to evaluate the sensitivity of the PCR detection method for the specific new molecular target in Example 4 to pure bacteria of Enterococcus faecalis.

[0030] Figure 5 The electrophoresis results are for evaluating the anti-interference ability of the PCR detection method for the specific new molecular target in Example 5.

[0031] Figure 6 The electrophoresis results of spiked probiotic food samples were evaluated using the PCR detection method for the specific new molecular target described in Example 6. Detailed Implementation

[0032] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.

[0033] Construction of the PCR method for identifying fecal streptococci as described in Example 1

[0034] 1) Primer design

[0035] Based on the sequence SEQ ID NO.1, a specific PCR amplification primer set (including forward and reverse primers) was designed. The primer set sequences are shown in Table 1 below.

[0036] Table 1. Primer set for specific PCR detection

[0037] 2) The method for identifying fecal enterococci is as follows:

[0038] S1: DNA template preparation: The test strains were enriched and cultured in LB liquid medium, and their bacterial genomic DNA was extracted using a commercial bacterial genomic DNA extraction kit as test templates;

[0039] S2: PCR amplification: PCR amplification of the DNA sample to be tested was performed using the primer set described above.

[0040] ①PCR detection system:

[0041] ②PCR amplification program: 95℃ for 5 min; 95℃ for 30 s, 60.8℃ for 30 s, 72℃ for 45 s, 35 cycles; 72℃ for 10 min.

[0042] S3: PCR amplification products were subjected to gel electrophoresis;

[0043] S4: Observe whether there is a single amplified band at the position of the product size corresponding to each primer set. If it is present, it indicates that the sample contains Enterococcus faecalis; if no corresponding single amplified band appears, the sample does not contain the corresponding Enterococcus faecalis.

[0044] Example 2: Specificity evaluation of the PCR detection method for fecal enterococci

[0045] Forty strains identified as *Enterococcus faecalis* and 22 strains of non-target *Enterococcus faecalis* were collected and subjected to PCR detection according to the method in Example 1. Specifically, S1 DNA template preparation involved extracting genomic DNA from each bacterium; S2 PCR amplification used a primer set. A blank control was set up, with sterile double-distilled water containing no genomic DNA as the template.

[0046] The bacterial strains used and the test results are shown in Table 2 below. In the table, "+" indicates positive and "-" indicates negative in the test result column. The electrophoresis results of the PCR products are shown below. Figure 1 and Figure 2 As shown; Figure 1 Bacteria numbered 1-40 are fecal streptococci; Figure 2 Numbers 1-22 are non-fecal streptococci (corresponding to 41-62 in Table 1, respectively); M is 2000 Maker, N is blank control, "+" indicates positive control, and "-" indicates negative control.

[0047] Table 2. Results of the specificity evaluation test for identifying Enterococcus faecalis in this invention ; ; ;

[0048] As shown in Table 2, the detection results of the primer set showed that only Enterococcus faecalis showed specific amplification bands, while non-target Enterococcus faecalis strains did not show specific bands, indicating that the identification method of the present invention has high specificity.

[0049] Example 3: Evaluation of the sensitivity of a PCR detection method for specific novel molecular targets in detecting Enterococcus faecalis DNA.

[0050] Using the extracted Enterococcus faecalis genomic DNA as a template, the original DNA concentration was determined to be 67.75 ng / μL. The solution was then serially diluted 10-fold with sterile double-distilled water. DNA from each dilution was used as template, and amplification was performed according to the PCR system and amplification procedure described in Example 1. The amplification products were detected by agarose gel electrophoresis. A blank control was set up, with the blank control template being an aqueous solution containing no genomic DNA. The electrophoresis results of the PCR products are shown below. Figure 3 As shown, M represents 2000 Maker and N represents the blank control.

[0051] Table 3. Sensitivity evaluation results of the specific target DNA of Enterococcus faecalis in this invention

[0052] Table 3 shows that the DUT target primer set can be amplified to 10. -6 The gradient corresponds to a minimum detectable DNA concentration of 6.775 × 10⁻⁶. -5 The concentration of ng / μL indicates that the PCR detection method described in this invention has high detection sensitivity for Enterococcus faecalis genomic DNA. The electrophoresis results of the PCR products are as follows: Figure 3 As shown, M represents 2000 Maker and N represents the blank control.

[0053] Example 4: Electrophoresis results evaluating the sensitivity of pure bacteria of Enterococcus faecalis to PCR detection of specific novel molecular targets.

[0054] After activating and culturing *Enterococcus faecalis*, single colonies were picked and inoculated into LB liquid medium and incubated at 37°C for 16–18 h to obtain bacterial suspensions in good growth condition. The bacterial suspensions were serially diluted 10-fold with 0.85% sterile physiological saline, and plate counts were performed on each gradient. Genomic DNA was extracted from each gradient suspension simultaneously, and the PCR system and amplification procedure described in Example 1 were followed for detection. The electrophoresis results of the PCR products are shown below. Figure 4 As shown, M represents 2000 Maker and N represents the blank control.

[0055] Table 4. Evaluation results of the sensitivity of pure bacteria targeting Enterococcus faecalis (dut) in this invention.

[0056] Table 4 shows that the dut target primer set can amplify up to 10⁻⁶ pure samples of Enterococcus faecalis. -8 The gradient corresponds to a total bacterial count of 20 CFU / mL, indicating that the PCR detection method described in this invention is effective for pure bacterial samples at a concentration of 10 CFU / mL. 1 It has a high sensitivity, being on the order of CFU / mL.

[0057] Example 5 Evaluation of the anti-interference ability of PCR detection method for specific novel molecular targets

[0058] To evaluate the impact of complex microbial communities on the detection method of this invention, one strain of *Pseudomonas aeruginosa* and one strain of *Lactobacillus plantarum* were selected as interfering bacteria. Enterococcus faecalis culture was cultured to 10... 4 DNA was extracted after mixing CFU / mL of interfering bacterial suspensions with different concentrations, and amplified according to the PCR system and amplification procedure described in Example 1. The amplification products were detected by agarose gel electrophoresis. The electrophoresis results of the PCR products are shown below. Figure 5 As shown (Pseudomonas aeruginosa on the left, Lactobacillus plantarum on the right), M is 2000 Maker and N is blank control.

[0059] Table 5. Evaluation results of the anti-interference ability of the specific target of Enterococcus faecalis in this invention

[0060] Table 5 shows that under different concentrations of interference from Pseudomonas aeruginosa and Lactobacillus plantarum, the dut target primer set can amplify a single target band, indicating that the PCR detection method described in this invention still has good anti-interference ability in the mixed bacterial background.

[0061] Example 6 Evaluation of PCR detection method for specific novel molecular targets in spiked samples of probiotic food

[0062] To evaluate the applicability of the method of this invention to actual samples, sterilized probiotic food samples were used as the matrix, and spiked samples were prepared by adding different gradients of *Enterococcus faecalis* bacterial suspensions. Samples were taken at 4 h, 8 h, and 12 h after spiking, and DNA was extracted. The PCR system and amplification procedure described in Example 1 were then used for detection. The electrophoresis results of the PCR products are shown below. Figure 6 As shown, M represents 2000 Maker and N represents the blank control.

[0063] Table 6. Detection results of the specific target of *Enterococcus faecalis* of the present invention on spiked samples of probiotic food.

[0064] Table 6 shows that the DUT target primer set has the ability to detect spiked samples of probiotic food, and can identify approximately 10 samples within 12 hours of incubation. 2 The presence of fecal streptococci at a concentration of CFU / mL indicates that the PCR detection method described in this invention can be used for rapid screening of fecal streptococci in complex matrix samples such as probiotic foods.

[0065] SEQ ID NO.1 ATGAAACAACGTGGTTTTGAGATTATTTCTAAGTATCAAGAAGAGGGCTTGAGTGTCCCACAACGAGCAACAAAAGGTGCCGCGGGGTATGATTTTCAAGCAGCCGAAACGGTCGTTGTACCAAGTCTTTGGAAGTTACAACAAGCTGGAGAAAATCCCAAACCAATTTTAGTTAAAACAGGAATTAAGGCGTATATGCCTGATTCTGAATATTTAGAATTGGTGAGTCGTTCTTCGAAC CCGCTAAAACGGTTCCTACTTTTAGCGAATGGTGTCGGAGTCATTGACAGAGATTATTATAATAACGAGAATAACGAAGGACATATCATGTTCCAATTTTAAACTTTGGATATGAAGATGTTGTCATTGAAAAAGGTGAACGAATTGGCCAAGGGATTTTTAAGCCGTTTTTATTAGCGGATGATGACCAAGTCGAGGCAGAAAGAACGGGCGGTTTTGGTTCGTCTGGACAAAAATAA.

Claims

1. A specific molecular target for identifying *Enterococcus faecalis*, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

1.

2. The application of the specific molecular target described in claim 1 in the identification of fecal streptococci for non-disease diagnostic and therapeutic purposes.

3. A set of PCR primers for identifying *Enterococcus faecalis*, characterized in that, The primer set was designed based on the nucleotide sequence shown in SEQ ID NO.

1.

4. The PCR primer set according to claim 3, characterized in that, The primer set includes: F: 5'-AGAAGAGGGCTTGAGTGT-3', R: 5'-GTCATCATCCGCTAATAAA-3'.

5. A kit for identifying fecal streptococci, characterized in that, A set of PCR primers containing the formula of claim 3 or 4.

6. The use of the PCR primer set of claim 3 or 4 or the kit of claim 5 in the detection of fecal streptococci for non-disease diagnostic and therapeutic purposes.

7. A method for identifying fecal streptococci for non-disease diagnostic and therapeutic purposes, characterized in that, Includes the following steps: S1: Perform PCR amplification on the DNA of the sample to be tested using the PCR primer set described in claim 3 or 4; S2: Perform gel electrophoresis to detect the amplification products; S3: Observe whether the size of the amplified product meets expectations.

8. The method according to claim 7, characterized in that, The PCR amplification in S1 includes the following system: 2×Hieff® master PCR Mix, template DNA, PCR primer set, and sterile double-distilled water. Preferably, the system consists of: 12.5 μL of 2×Hieff® master PCR Mix, 0.5 μL of 10 μmol / L upstream primer, 0.5 μL of 10 μmol / L downstream primer, 1 μL of template DNA, and sterile double-distilled water to a final volume of 25 μL.

9. The method according to claim 7, characterized in that, The PCR amplification program in S1 is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 60.8℃ for 30 s, extension at 72℃ for 45 s, for a total of 35 cycles of denaturation, annealing, and extension; and final extension at 72℃ for 10 min.

10. The method according to claim 7, characterized in that, The sample to be tested is streptococcus in pure bacterial cultures, mixed bacterial systems, or spiked probiotic food samples.

Images