Detection of methicillin-resistant staphylococcus aureus in biological samples

Abstract

The present invention relates to the detection of methicillin-resistant Staphylococcus aureus in a biological sample, and discloses a method for identifying methicillin-resistant Staphylococcus aureus (MRSA) in a sample, wherein the method involves detecting in the sample a nucleic acid sequence specific for S. aureus, mecA and mecC. The present invention also provides a kit for determining the presence of MRSA in a sample.

Description

[0001] This application is a divisional application of Chinese Patent Application No. 201480063720.0, filed on September 22, 2014, entitled "Detection of methicillin-resistant Staphylococcus aureus in biological samples". Technical Field

[0002] This invention primarily relates to methods for pathogen detection. Specifically, this invention relates to methods for detecting methicillin-resistant Staphylococcus aureus (MRSA) in biological samples. Background Technology

[0003] The following description is provided to aid the reader's understanding. The information provided or the references cited are not to be considered prior art.

[0004] Staphylococcus aureus is a cause of a variety of conditions in humans, including skin infections (such as folliculitis, blepharitis, cellulitis, impetigo, and furuncles), pneumonia, mastitis, phlebitis, meningitis, scalded skin syndrome, osteomyelitis, urinary tract infections, and food poisoning. Furthermore, the Centers for Disease Control and Prevention (CDC) has identified methicillin-resistant Staphylococcus aureus (MRSA) as a growing problem in healthcare settings, as it is a leading cause of hospital-acquired infections (such as hospital-acquired (HA) infections of surgical wounds or nosocomial infections).

[0005] MRSA is one of the two most prevalent antibiotic-resistant pathogens; the other is vancomycin-resistant enterococci (Society for Healthcare and Epidemiology, SHEA Guidelines 2003). More than 50% of nosocomial infections in intensive care units are due to MRSA (National Nosocomial Infections Surveillance System, NNIS report, January 1992 – June 2004). Therefore, MRSA represents a significant threat to public health.

[0006] Methicillin resistance is caused by the acquisition of a foreign gene, mecA, which encodes a penicillin-binding protein (PBP2a or PBP2') that exhibits low affinity for β-lactam antibiotics (Wielders and Fluit, 2002). mecA is carried on a mobile genetic element called the staphylococcal box chromosome mec (SCCmec), which also contains a ccr gene complex encoding a recombinase essential for the element's mobility. The SCCmec box is a large element capable of moving into or outside the Staphylococcus aureus genome.

[0007] The mecA gene has also been found in coagulase-negative staphylococcal (CNS) strains, which are less pathogenic than Staphylococcus aureus. These strains include Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus capitis, Staphylococcus warneri, Staphylococcus sciuri, and Staphylococcus caprae. Some of these other staphylococcal strains grow in the same environments as Staphylococcus aureus, such as the anterior nasal cavity and skin. As a result, clinical samples such as nasal swabs or wound swabs can potentially contain a mixture of more than one staphylococcal species. Therefore, detecting mecA alone is insufficient for the direct identification of MRSA from clinical samples. Because the identification of MRSA is clinically more significant than that of other staphylococci (due to their increased pathogenicity and virulence), diagnostic assays to differentiate MRSA from other staphylococcal strains containing the mecA gene are needed.

[0008] More recently, an additional mec gene, called mecC, was discovered that also contributes to β-lactam resistance. mecC (GenBank accession number FR821779), previously referred to as a mecA homolog in earlier publications, is located on the SCCmec XI element (GenBank accession number FR823292). The mecC gene in humans and bovine Staphylococcus aureus has been described, and it encodes a protein with <63% amino acid identity to PBP2a encoded by mecA.

[0009] Hospital-acquired (HA) MRSA is typically controlled by monitoring infections in patients and personnel. Contact precautions and / or patient isolation may be appropriate when infection progresses or when infection prevention is needed. The prevalence of community-acquired (CA) MRSA is also increasing. CA-MRSA is defined as MRSA acquired in individuals without known MRSA risk factors (e.g., recent hospitalization, contact with an infected patient). Because rapid and reliable identification of MRSA has become important for diagnosing and treating infected patients and for implementing and managing hospital infection control procedures, diagnostic assays for detecting the presence of Staphylococcus aureus (specifically, the presence of MRSA) are required. Furthermore, assays that do not require a separate front-end sample preparation process from the detection system are also needed. Summary of the Invention

[0010] This article provides methods and kits for detecting MRSA in biological samples. Specifically, the described methods involve the positive identification of MRSA by screening for the presence of three marker nucleic acid sequences. This method can be performed on raw biological samples, yielding a direct, streamlined sample-to-result process.

[0011] The present invention discloses a method for detecting the presence or absence of methicillin-resistant Staphylococcus aureus (MRSA) in biological samples, comprising:

[0012] (a) Contact the biological sample with the following:

[0013] (i) The first primer pair that specifically hybridizes under stringent conditions to a target nucleic acid region (if present) specifically targeting Staphylococcus aureus.

[0014] (ii) A second primer pair that specifically hybridizes to the target mecA nucleic acid region (if present) under stringent conditions, and

[0015] (iii) A third primer pair that specifically hybridizes to the target mecC nucleic acid region (if present) under stringent conditions.

[0016] To produce a reaction-sample mixture, wherein at least one primer of each primer pair is attached to a fluorophore tag.

[0017] (b) The reaction-sample mixture is subjected to real-time polymerase chain reaction (PCR) conditions, under which each target nucleic acid present in the biological sample is amplified to generate a fluorescent signal.

[0018] (c) Measure the amount of fluorescence signal produced by each fluorophore, and

[0019] (d) The presence or absence of MRSA is determined by comparing the cycling threshold of the target nucleic acid, wherein...

[0020] (i) When fluorescence signals of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acid are detected, and

[0021] (1) The cycling threshold (Ct) of Staphylococcus aureus-specific nucleic acids minus the Ct of mecA and / or mecC nucleic acids ≤ 1.9, or

[0022] (2) The Ct from Staphylococcus aureus-specific nucleic acid minus the Ct from mecA and / or mecC nucleic acids > 1.9 and the Ct from mecA and / or mecC nucleic acids plus 1.9 < the Ct from Staphylococcus aureus-specific nucleic acid.

[0023] This confirms the presence of MRSA in the biological sample;

[0024] (ii) When the Ct values ​​of both Staphylococcus aureus-specific nucleic acid and mecA and / or mecC nucleic acids are detected, and the difference between the Ct value from the Staphylococcus aureus-specific nucleic acid and the Ct value from mecA and / or mecC nucleic acids is < 1.9, and the sum of the Ct values ​​from the Staphylococcus aureus-specific nucleic acid and 1.9 is < the Ct value from mecA and / or mecC nucleic acids, the presence of Staphylococcus aureus and methicillin resistance genes in the biological sample is determined; or

[0025] (iii) If a fluorescence signal of a Staphylococcus aureus-specific target nucleic acid sequence is detected but no fluorescence signal of mecA and / or mecC is detected, then Staphylococcus aureus is confirmed to be present in the biological sample and MRSA is confirmed to be absent.

[0026] Prior to contact with the biological sample, all primer pairs are contained together in an amplification master mix, which also contains DNA polymerase, dNTPs, and PCR buffer. Additionally, the amplification master mix contains a fourth primer pair that specifically hybridizes to the control target nucleic acid under stringent conditions.

[0027] In some embodiments, the target nucleic acid specifically targeting Staphylococcus aureus comprises all or part of a gene sequence selected from the group consisting of: spa, agr, ssp protease, sir, sodM, cap, coa, α-hemolysin, γ-hemolysin, femA, Tuf, sorting enzyme, fibrinogen-binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthase, sar, sbi, rpoB, gyrase A, and orfX. In one specific embodiment, the target nucleic acid specifically targeting Staphylococcus aureus is spa.

[0028] The first primer pair can point to the spa nucleic acid sequence and consists of a first primer containing SEQ ID NO:1 and a second primer containing SEQ ID NO:2. The second primer pair points to the mecA nucleic acid sequence and can consist of a first primer containing SEQ ID NO:4 and a second primer containing SEQ ID NO:6. The third primer pair points to the mecC nucleic acid and can consist of a first primer containing SEQ ID NO:7 and a second primer containing SEQ ID NO:9.

[0029] One primer in each primer pair may contain a probe sequence element as part of the same primer molecule, resulting in a product called a primer-probe (e.g., Scorpion™ primer-probe). The probe sequence is typically located at the 5' end of the primer and may also contain a fluorophore linked to a quencher to reduce background fluorescence. After PCR extension, the synthesized target region is attached to the same strand as a probe. During denaturation, the probe portion of Scorpion™ specifically hybridizes with a portion of the newly generated PCR product, physically separating the fluorophore from the quencher, thereby generating a detectable signal. In some embodiments, the fluorophores of the mecA primer and the mecC primer are identical. The fluorophores of the primer-probe may be fluorescein amidite (FAM), while the fluorophores of the mecA and mecCspa genes may be oxanthracene dyes that fluoresce in the red region of the visible spectrum.

[0030] Biological samples can be contacted individually or simultaneously with one or more primer pairs. When simultaneous contact (i.e., multiplexing) occurs, one or more of the first, second, and third primer pairs are contacted with the biological sample and with each other to amplify the target nucleic acid sequence. Optionally, an internal positive control nucleic acid and a fourth primer pair complementary to the internal positive control nucleic acid can be included in the amplification mixture.

[0031] Kits containing oligonucleotides (which may be primers or primer-probes) for performing amplification as described herein are also provided. Detailed Implementation

[0032] This invention uses several definitions to describe the invention, which are shown below and throughout the specification.

[0033] Unless otherwise stated, the singular forms “a,” “an,” and “the” used herein include plural expressions. Thus, for example, the expression “oligonucleotide” includes multiple oligonucleotide molecules, while the expression “nucleic acid” refers to one or more nucleic acids.

[0034] The term "approximately" in this article refers to a fluctuation of 10%.

[0035] Primer pairs that specifically hybridize with the target nucleic acid under stringent conditions can hybridize with any part of the gene. Therefore, the entire gene can be amplified, or a segment of the gene can be amplified, depending on the part of the gene that the primers are intended to hybridize with.

[0036] As used herein, the term “amplification” or “performing an amplification” includes methods for replicating a target nucleic acid, thereby increasing the copy number of a selected nucleic acid sequence. Amplification can be exponential or linear. The target nucleic acid can be DNA (such as, for example, genomic DNA and cDNA) or RNA. The sequence amplified in this manner forms an “amplifier.” While exemplary methods involving amplification using polymerase chain reaction (PCR) are described below, numerous other methods for amplifying nucleic acids (e.g., isothermal methods, rolling circle methods, etc.) are known in the art. Those skilled in the art will understand that these other methods can be used in place of or in conjunction with PCR methods. See, for example, Saiki, “Amplification of Genomic DNA” in PCR Protocols, Innis et al., Eds., Academic Press, San Diego, CA 1990, pp 13-20; Wharam et al., Nucleic AcidsRes. 2001 Jun 1;29(11):E54-E54; Hafner et al., Biotechniques 2001 Apr;30(4):852-860.

[0037] The terms “complementary,” “complementary,” or “complementarity” used herein to refer to polynucleotides (e.g., nucleotide sequences such as oligonucleotides or target nucleic acids) mean the standard Watson / Crick pairing rule. Complementarity of nucleic acid sequences follows an antiparallel pairing, such that the 5' end of one sequence pairs with the 3' end of another. For example, the sequence “5'-AGT-3'” is complementary to the sequence “3'-TCA-5'.” Nucleic acids described herein may contain bases not commonly found in natural nucleic acids; these include, for example, inosine, 7-deazaguanine, locked nucleic acids (LNA), and peptide nucleic acids (PNA). Complementarity does not need to be perfect; stable double helices can contain mismatched base pairs, degenerative, or unmatched bases. Those skilled in the art of nucleic acid technology can empirically consider several variables to determine double helix stability, including, for example, oligonucleotide length, oligonucleotide base composition and sequence, ionic strength, and the incidence of mismatched base pairs. Complementary sequences can also be RNA sequences complementary to a DNA sequence or its complementary sequence, and can also be cDNA. The term "fundamentally complementary" as used herein means that the two sequences hybridize specifically (as defined below). Those skilled in the art will understand that fundamentally complementary sequences do not necessarily hybridize along their full length. Nucleic acids that are "completely complementary" to the reference sequence consist of nucleotide sequences that are 100% complementary to the reference sequence along its full length (according to the Watson / Crick pairing rule). Complete complementarity does not involve mismatches with the reference sequence.

[0038] As used herein, in detecting signals from detectable markers to determine the presence of target nucleic acids in a sample, all terms “detection” do not require the method to provide 100% sensitivity and / or 100% specificity. It is well known that “sensitivity” is the probability of a positive test when a person has the target nucleic acid, while “specificity” is the probability of a negative test when a person does not have the target nucleic acid. A sensitivity of at least 50% is preferred, with at least 60%, at least 70%, at least 80%, at least 90%, and at least 99% being significantly more preferred. A specificity of at least 50% is preferred, with at least 60%, at least 70%, at least 80%, at least 90%, and at least 99% being significantly more preferred. Detection also covers assays with false positives and false negatives. False negative rates can be 1%, 5%, 10%, 15%, 20%, or even higher. False positive rates can be 1%, 5%, 10%, 15%, 20%, or even higher.

[0039] In the context of nucleic acids, "fragment" refers to a sequence of nucleotide residues that is at least about 5 nucleotides, at least about 7 nucleotides, at least about 9 nucleotides, at least about 11 nucleotides, or at least about 17 nucleotides. Fragments are typically less than about 300 nucleotides, less than about 100 nucleotides, less than about 75 nucleotides, less than about 50 nucleotides, or less than 30 nucleotides. In some embodiments, fragments can be used in polymerase chain reaction (PCR), various hybridization procedures, or microarray procedures to identify or amplify identical or related portions of mRNA or DNA molecules. A fragment or region can uniquely identify each polynucleotide sequence of the present invention.

[0040] "Genomic nucleic acids" or "genomic DNA" refers to some or all of the DNA derived from chromosomes. Genomic DNA can be whole or fragmented (e.g., digested with restriction endonucleases using methods known in the art). In some embodiments, genomic DNA may include all or part of a sequence from a single gene or sequences from multiple genes. In contrast, the term "total genomic nucleic acids" is used herein to refer to the complete complement of DNA contained in the genome. Methods for purifying DNA and / or RNA from various samples are well known in the art.

[0041] As used in this article, "multiplex PCR" refers to the simultaneous amplification of two or more products in the same reaction vessel. Each product is primed with a unique primer pair. Multiplex reactions may also include specific probes for each product, labeled with detectable modules.

[0042] As used herein, the term "oligonucleotide" refers to a short aggregate composed of deoxyribonucleic acid, ribonucleic acid, or any combination thereof. Oligonucleotides are typically at least about 10, 11, 12, 13, 14, 15, 20, 25, 40, or 50 up to about 100, 110, 150, or 200 nucleotides (nt), more preferably about 10, 11, 12, 13, 14, or 15 up to about 70 or 85 nt, and most preferably about 18 up to about 26 nt. The single-letter codes for nucleotides are as described in Table 1, Section 2422 of the U.S. Patent Examination Procedure Manual. In this regard, the nucleotide designation "R" indicates a purine such as guanine or adenine, "Y" indicates a pyrimidine such as cytosine or thymine (or uracil for RNA); and "M" indicates adenine or cytosine. Oligonucleotides can be used as primers or probes.

[0043] The “primers” used in this article for amplification are oligonucleotides complementary to the target nucleic acid sequence and which, in the presence of DNA or RNA polymerase, induce the addition of a nucleotide to the 3' end of the primer. The 3' nucleotide of the primer should generally be identical to the target nucleic acid sequence at the corresponding nucleotide position for optimal expression and amplification. The term “primer” as used in this article includes all synthetically available primers, including peptide nucleic acid primers, locked nucleic acid primers, phosphate-thioester modified primers, labeled primers, etc. The “forward primer” used in this article is a primer complementary to the antisense strand of dsDNA. The “reverse primer” is complementary to the sense strand of dsDNA. “Exogenous primer” specifically refers to an oligonucleotide added to a reaction vessel that is not generated from amplification within the reaction vessel, which contains the sample nucleic acid to be amplified from outside the vessel. Primers “linked” to fluorophores or other labels are linked to the label by some method. An example is a primer-probe combination.

[0044] Primers are typically at least 10, 15, 18, or 30 nucleotides long up to about 100, 110, 125, or 200 nucleotides long, preferably at least 15 up to about 60 nucleotides long, and most preferably at least 25 up to about 40 nucleotides long. In some embodiments, primers and / or probes are 15 to 35 nucleotides long. There is no standard length for optimal hybridization or polymerase chain reaction amplification. The optimal length for a specific primer application can be readily determined in the manner described in H. Erlich, PCR Technology, Principles and Application for DNA Amplification, (1989).

[0045] A primer pair is a pair of primers, both pointing to a target nucleic acid sequence. A primer pair contains a forward primer and a reverse primer, each hybridizing to a different strand of the double-stranded target nucleic acid sequence under stringent conditions. The forward primer is complementary to the antisense strand of the dsDNA, while the reverse primer is complementary to the sense strand of the dsDNA. One primer in a primer pair can be a primer-probe (i.e., a bifunctional molecule containing a PCR primer element covalently linked to a probe element via a polymerase blocking group, and also containing a fluorophore that interacts with a quencher).

[0046] Oligonucleotides (e.g., probes or primers) that specifically target nucleic acids will "hybridize" with the target nucleic acid under specified conditions. As used herein, "hybridization" or "performing hybridization" refers to a process in which the oligonucleotide single strand anneals to its complementary strand through base pairing under defined hybridization conditions.

[0047] "Specific hybridization" refers to two nucleic acid sequences possessing a high degree of complementarity. Specific hybridization complexes form under permissible annealing conditions and remain hybridized after any subsequent washing step. Permissible annealing conditions for nucleic acid sequences can be routinely determined by one of ordinary skill in the art and can occur, for example, at 65°C in the presence of approximately 6×SSC. The stringency of hybridization can be expressed in part by the temperature at which the washing step is performed. Such temperatures are typically chosen to be approximately 5°C to 20°C lower than the thermal melting point (Tm) of the specific sequence at defined ionic strengths and pH. Tm is the temperature at which 50% of the target nucleic acid hybridizes with a perfectly matched probe (at defined ionic strengths and pH). Equations for calculating Tm and the conditions used for nucleic acid hybridization are known in the art. Specific hybridization preferably occurs under stringent conditions, as is well known in the art. Stringent hybridization conditions are hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, followed by washing at 60°C in 0.1×SSC. Hybridization procedures are well known in the art and are described, for example, in Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons Inc., 1994.

[0048] If, when an oligonucleotide is compared with a nucleic acid, the oligonucleotide shares at least 50% sequence identity with that nucleic acid, then the oligonucleotide used herein is "specifically" targeted at that nucleic acid. A nucleic acid-specific oligonucleotide is one that, under suitable hybridization or washing conditions, hybridizes with the target nucleic acid but substantially does not hybridize with non-target nucleic acids. A high level of sequence identity is preferred and includes at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, and more preferably at least 98% sequence identity. Sequence identity can be determined using a commercially available computer program, according to initial settings employing algorithms well known in the art. As used herein, sequences with "high sequence identity" contain identical nucleotides at at least about 50%, preferably at least about 60%, and more preferably at least about 75% of the compared nucleotide positions.

[0049] Oligonucleotides used as primers or probes are typically capable of specifically hybridizing with target nucleic acids under stringent conditions. These primers or probes are used to specifically amplify (i.e., amplify a specific target nucleic acid) or specifically detect (i.e., detect a specific target nucleic acid sequence) the target nucleic acid.

[0050] As used herein, the term "sample" or "test sample" may include clinical samples, isolated nucleic acids, or isolated microorganisms. In a preferred embodiment, the sample is obtained from a biological source (i.e., a "biological sample"), such as tissues, body fluids, or microorganisms collected from a subject. Sample sources include, but are not limited to, sputum (processed or unprocessed), bronchoalveolar lavage fluid (BAL), bronchoalveolar lavage fluid (BW), blood, body fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue (e.g., biopsy material). Preferred sample sources include nasopharyngeal swabs, wound swabs, and nasal washes. As used herein, the term "patient sample" means a sample obtained from a person seeking diagnosis and / or treatment for a disease.

[0051] The term "amplification mixture" as used herein refers to a mixture of reagents used in nucleic acid amplification reactions, but does not contain primers or samples. The amplification mixture contains buffer, dNTPs, and DNA polymerase. The amplification mixture may also contain at least one of MgCl2, KCl, and nonionic and ionic detergents (including cationic detergents).

[0052] The “amplification master mix” contains the amplification mixture and primers for amplifying the target nucleic acid, but does not contain the sample to be amplified.

[0053] The term "reaction-sample mixture" as used in this article refers to a mixture containing the amplification master mix and the sample.

[0054] The term "probe sequence element" as used in this article refers to a nucleotide segment whose connection to the primer lies in its attachment to or adjacency to the primer nucleic acid sequence, and its specific hybridization with the target nucleic acid sequence to be detected under stringent conditions.

[0055] As used herein, the term "primer-probe detection system" refers to a method for real-time PCR that utilizes bifunctional molecules (referred to herein as primer-probes) containing PCR primer elements covalently linked to probe elements via polymerase-blocking groups. Furthermore, each primer-probe molecule contains a fluorophore that interacts with a quencher to reduce background fluorescence. The primer-probes used herein may contain a 3' primer with a 5' extended probe tail (containing a hairpin structure) and a fluorophore / quencher pair. During PCR, polymerase extension to the probe tail is blocked by the inclusion of hexadecimal glycol (HEG). In the first round of amplification, the 3' target-specific primer anneals and extends with the target nucleic acid, thereby integrating the primer-probe into a newly synthesized strand with a newly synthesized target region against the 5' probe. In the next round of denaturation and annealing, the probe region of the primer-probe hairpin loop hybridizes with the target, thereby separating the fluorophore and quencher and generating a measurable signal. Such primer-probe combinations are described in Whitcombe et al., Nature Biotech 17: 804-807 (1999). SCORPION primers are exemplary primer-probe combinations.

[0056] As used herein, the terms “target nucleic acid,” “target nucleic acid sequence,” or “target sequence” refer to a sequence comprising a segment of the target nucleotide to be amplified and detected. A copy of the target sequence is typically produced during the amplification reaction and is referred to as an amplification product, amplicon, or amplicon. Target nucleic acids can consist of chromosomal segments, complete genes with or without spacer sequences, segments or portions of genes with or without spacer sequences, or nucleic acid sequences against which probes or primers are designed. Target nucleic acids can include wild-type sequences, mutations, deletions or duplications, tandem repeats, the target gene, a region of the target gene, or any upstream or downstream region thereof. Target nucleic acids can represent substitution sequences or alleles of a specific gene. Target nucleic acids can be derived from genomic DNA, cDNA, or RNA. Target nucleic acids as used herein can be DNA or RNA extracted from cells or nucleic acid copies amplified from them, or can include extracted nucleic acids further converted using a bisulfite reaction.

[0057] The “positive control nucleic acid” or “internal positive amplification control” used herein is a nucleic acid known to be present in a sample in a certain amount or level. In some embodiments, the positive control nucleic acid is not naturally present in the sample and is added to the sample prior to the real-time polymerase chain reaction of the reaction-sample mixture in the method disclosed herein for determining the presence or absence of MRSA. The “cycle threshold” (Ct) of the analyte used herein is a PCR cycle at which the fluorescence signal exceeds a specified fluorescence threshold. Ct depends on the amplification reaction efficiency, which includes the starting template copy number, organism lysis, PCR amplification, hybridization or cleavage of the fluorescent probe, and detection sensitivity.

[0058] The term "TaqMan® PCR Detection System" as used in this article refers to a method for real-time PCR. In this method, a TaqMan® probe, which hybridizes to the amplified nucleic acid segment, is contained in the amplification master mixture. The TaqMan® probe contains a donor and a quencher fluorophore at one end, positioned sufficiently close to each other so that the donor fluorescence is dominated by the quencher. However, when the probe hybridizes to the amplified segment, the 5'-exonuclease activity of Taq polymerase cleaves the probe, thereby allowing the donor fluorophore to emit detectable fluorescence.

[0059] The inventors have discovered that a positive MRSA test can be performed by determining the presence or absence of three marker nucleic acid sequences in a biological sample. Therefore, the present invention provides a method for determining the presence or absence of methicillin-resistant Staphylococcus aureus (MRSA) in a biological sample, the method comprising: (a) contacting the biological sample with a first primer pair that specifically hybridizes under stringent conditions to a target nucleic acid segment (if present) specifically targeting Staphylococcus aureus, a second primer pair that specifically hybridizes under stringent conditions to a target mecA nucleic acid segment (if present), and a third primer pair that specifically hybridizes under stringent conditions to a target mecC nucleic acid segment (if present), to generate a reaction-sample mixture, wherein at least one primer of each primer pair is linked to a fluorescent label; (b) subjecting the reaction-sample mixture to real-time polymerase chain reaction (PCR) conditions under which each target nucleic acid present in the biological sample is amplified to produce a fluorescent signal; (c) measuring the amount of fluorescent signal produced by each fluorophore using an integrated thermal cycling system; and (d) determining the presence or absence of MRSA by comparing the amount of fluorescence from the target nucleic acid and applying an algorithm discovered by the inventors.

[0060] Biological Samples and Sample Preparation

[0061] Biological samples from which MRSA can be detected and quantified using the methods of this invention are derived from sterile and / or non-sterile sites. Sterile sites from which samples can be obtained include bodily fluids such as whole blood, plasma, cell-free plasma, urine, cerebrospinal fluid, synovial fluid, pleural fluid, pericardial fluid, intraocular fluid, tissue biopsy, or tracheal aspiration. As used herein, “cell-free plasma” refers to plasma containing less than 1% cells by volume. Non-sterile sites from which samples can be obtained include, for example, sputum, feces, and swabs from, for example, the skin, groin, nasal cavity, and / or throat. Samples from non-sterile sites are preferred in this invention, more preferably wound and / or nasal swabs. Samples used for MRSA detection may also comprise isolated bacterial cultures that have formed colonies on a suitable culture medium. Samples may also include bacterial isolates.

[0062] Exemplary sources of biological samples include nasopharyngeal swabs, wound swabs, and nasal washes. Biological samples may be suspected of containing MRSA and / or MRSA nucleic acids. Furthermore, biological samples may be obtained from individuals suspected of being infected with MRSA. Biological samples can be contacted with the amplification master mix for use in microfluidic / microelectron centrifugation platforms.

[0063] While the methods of the present invention preferably employ untreated biological samples and thus yield a direct, streamlined sample-to-result process, the detection methods disclosed herein are effective for purifying isolated nucleic acids (DNA or RNA) from biological samples (isolated according to any method known to those skilled in the art). Samples can be collected or concentrated by centrifugation, if desired. Cells in the sample can be lysed, for example, by treatment with enzymes, thermal surfactants, sonication, or a combination thereof. Alternatively, biological samples can be treated with commercially available nucleic acid extraction kits.

[0064] In some implementations, one or more primer pairs are present in the amplification master mix prior to contact with the biological sample, which also contains DNA polymerase, dNTPs, and PCR buffer. While amplification is preferably performed in multiplex form, individual reactions for each marker may be used selectively. Biological samples can be contacted with primer pairs and / or the amplification master mix in a direct amplification disc to form a reaction-sample mixture. For example, biological samples can be contacted with the amplification master mix in a direct amplification disc (such as those sold by Focus Diagnostics, Inc. (Cypress, CA, USA)) as part of a SIMPLEXA Direct real-time PCR assay, in conjunction with 3M... TMThe integrated cycler works in tandem. The direct amplification disk is a thin disc containing multiple designated areas, each with a well for receiving the amplification master mix and an associated well for receiving untreated patient samples. A sample-reaction mixture is generated in the direct amplification disk during or after the addition of the amplification master mix and the sample.

[0065] Real-time PCR

[0066] The reaction-sample mixture is subjected to real-time polymerase chain reaction (PCR) conditions under which each target nucleic acid present in the biological sample is amplified and the amplification products are detected and measured. In some embodiments, after RT-PCR detection and target analyte differentiation in the same tray, the biological sample is loaded directly into the direct amplification tray without separate front-end sample preparation. Preferably, amplification is performed in a direct amplification tray (an 8-well tray from Focus Diagnostics, Inc.). In some embodiments, real-time PCR amplification is performed in the direct amplification tray using the SIMPLEXA Direct assay, while detection is performed using an integrated thermal cycler such as a 3M (St. Paul, MN, USA) product. TM It is performed using an integrated circulation system. 3M TM The integrated cycler can receive direct amplification disks and perform multiple assays on each disk. This device can heat >5°C per second and cool >4°C per second. Cycling parameters can be varied depending on the length of the amplified product to be extended.

[0067] Oligonucleotide primers, probes, and / or primer-probe combinations can be used to include internal positive amplification controls (IPCs) within the sample.

[0068] Therefore, in some embodiments, at least one primer in each primer pair in the amplification reaction contains a detectable module. The detectable module may be on a probe attached to a primer, such as a primer-probe configuration. The probe may be detectably labeled using methods known in the art. Useful labels include, for example, fluorescent dyes (e.g., Cy5®, Cy3®, FITC, rhodamine, lanthamide phosphors, Texas Red, fluoresceinamide (FAM), JOE, xanthracene dyes such as Cal Fluor Red 610® (“CFR610”) (which fluoresces in the red region of the visible spectrum and is effectively quenched by I-BHQ2 dye), Quasar 670®, etc. 32 P, 35 S, 3 H, 14 C 125 I, 131I. High electron density reagents (e.g., gold), enzymes such as those commonly used in ELISA (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), colorimetric markers (e.g., colloidal gold), and magnetic markers (e.g., Dynabeads). TM Biotin, dioxigenin, or haptens and proteins suitable for use with antiserum or monoclonal antibodies. Other markers include ligands or oligonucleotides that can form complexes with corresponding receptors or oligonucleotide complements, respectively. Markers can be directly integrated into the nucleic acid to be detected, or they can be attached to probes (e.g., oligonucleotides) or antibodies that hybridize or bind to the nucleic acid to be detected.

[0069] Therefore, after amplification, multiple target segments can be identified using different detectable modules (such as size and / or color). Detectable modules can be fluorescent dyes. In some embodiments, different primer pairs are labeled with different distinguishable detectable modules. Thus, for example, HEX and FAM fluorescent dyes can be present on different primers in multiplex PCR and ligated to the resulting amplicon. In other embodiments, one detectable module is used to label the forward primer, while different detectable modules are used to label the reverse primer, for example, the forward primer uses FAM dye and the reverse primer uses HEX dye. The use of different detectable modules is useful for distinguishing amplification products of the same length or very similar lengths. In some embodiments, primer-probes for Staphylococcus aureus-specific genes are labeled with one detectable marker (e.g., FAM), while primer-probes specifically targeting each of the mecA and mecC genes are labeled with different detectable markers (e.g., CFR610). Thus, in some embodiments, two different fluorescent dyes are used to label different primer-probes used in a single amplification.

[0070] In some implementations, the probes used are equipped with detectable tags, and detection is performed by detecting the probe tag on each amplification product. Alternatively, a quencher can be linked to the detectable tag, which can be placed before the target of the amplification probe to detect the tag. The TAQMAN probe is an example of such a probe.

[0071] In some embodiments, one of the primers in a probe and primer pair may form part of the same molecule. This is called a primer-probe (e.g., a SCORPION primer-probe). In these embodiments, the primer-probe also contains a fluorophore linked to a quencher to reduce background fluorescence. After PCR extension with such a fluorescently labeled primer-probe, the synthesized target region is attached to the same strand as the probe. Upon denaturation, the probe portion of the primer-probe specifically hybridizes with a portion of the newly generated PCR product, physically separating the fluorophore from the quencher, thereby generating a detectable signal. Thus, in some embodiments, one primer in each primer pair may be a primer-probe containing a probe sequence element at the 5' end of the primer, wherein said probe element further comprises a fluorophore and a quencher.

[0072] In some embodiments, the probes used in the methods of the present invention comprise or consist of short fluorescently labeled DNA sequences designed for detecting segments of DNA sequences with genetic variation, such as those disclosed in French et al., HyBeacon probes: a new tool for DNA sequence detection and allelediscrimination, Mol Cell Probes, December 2001; 15(6):363-74, which are incorporated herein by reference in their entirety. The central location of the fluorescent molecule within this type of probe offers some advantages over probes that have signal transduction chemistry at the ends of DNA probes. HyBeacons® is an example of this type of probe.

[0073] Target nucleic acids and primers

[0074] According to the present invention, the disclosed method uses oligonucleotide primers and probes to amplify and detect target nucleic acids, such as all or part of marker genes specifically targeting Staphylococcus aureus, and all or part of the mecA and mecC genes. In one embodiment, the method involves using primer pairs specifically targeting spa, mecA, and mecC (including any or all fragments of these genes).

[0075] In addition, primers can also be used to amplify one or more control nucleic acid sequences.

[0076] Using separate markers for each target, the target nucleic acids described herein can be detected individually or in multiple forms. In one specific embodiment, fluorescently labeled primer-probes (such as SCORPION primer-probes) are used in primer pairs specifically targeting the mecA gene and contain the same fluorescent markers as those in primer pairs targeting mecC.

[0077] Those skilled in the art can design and prepare primers suitable for amplifying target nucleic acids under the guidance of this invention. The length of the amplification primers used in this invention depends on several factors, including nucleotide sequence identity and the temperature at which these nucleic acids hybridize or are used during in vitro nucleic acid amplification. The considerations required to determine the preferred length of amplification primers for specific sequence identity are well known to those skilled in the art.

[0078] Oligonucleotides used as hybridization probes can be designed in a similar manner to primers. Like oligonucleotide primers, oligonucleotide probes often have similar melting temperatures, and each probe must be long enough to allow sequence-specific hybridization to occur without being too long to reduce fidelity during synthesis. Oligonucleotide probes are typically 15–60 nucleotides long.

[0079] In some implementations, the provided primer mixture exhibits degeneracy at one or more nucleotide positions. Degenerate primers are used in PCR where variability exists within the target nucleic acid sequence, i.e., the sequence information is ambiguous. Typically, degenerate primers exhibit variability at no more than about four, no more than about three, preferably no more than about two, and most preferably no more than about one nucleotide position within the primer.

[0080] The target nucleic acid can be the entire amplified gene. Alternatively, in some embodiments, the target gene is a fragment or segment of a gene. The fragment can be derived from any region of the complete sequence, but the fragment length according to the method of the invention is typically at least 30, 50, 75, 100, 150, 200, 250, or 300 nucleotides. Those skilled in the art will understand that the specific size and location of the target nucleic acid will control the choice of amplification primers, and vice versa.

[0081] Specific primers, probes, and primer-probes used to amplify and detect all or fragments of marker genes specific to Staphylococcus aureus. These include sequences pointing to those present in Staphylococcus aureus but absent in other staphylococcal species. Examples of specific marker genes include, but are not limited to: spa, agr, ssp protease, sir, sodM, cap, coa, α-hemolysin, γ-hemolysin, femA, Tuf, sorting enzyme, fibrinogen-binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthase, sar, sbi, rpoB, gyrase A, and orfX. Detection of Staphylococcus aureus-specific genes helps differentiate Staphylococcus aureus-containing samples from those that may contain other low-pathogenic species or strains (e.g., Staphylococcus epidermidis). A suitable biomarker gene is the 1.55 kb spa gene (see, for example, GenBank accession number NC_002952, range 125378-123828). Exemplary primer and labeled primer-probe sequences for amplifying and detecting spa include:

[0082] Staphylococcus aureus SPA primer 1:

[0083] 5'd CTTGATAAAAAGCATTTTGTTGAGCTTCA 3' (SEQ ID NO:1)

[0084] Staphylococcus aureus SPA primer 2:

[0085] 5' TGCATCTGTAACTTTAGGTACATTA 3' (SEQ ID NO:3)

[0086] Staphylococcus aureus SPA-labeled primer-probe:

[0087] 5'd BHQ-1-agcggtGCAGCAGGTGTTACGCCACCgc-T(FAM)-spacer 18-TGCATCTGTAACTTTAGGTACATTA 3' (SEQ ID NO: 2)

[0088] Technicians will understand that other primers, probes, and primer-probe combinations (including other SCORPION primer-probe combinations) can be used.

[0089] Select specific primers and probes to amplify and detect fragments of the 2.0 kb mecC gene (see, for example, GenBank accession number FR821779, range 36219-36322).

[0090] Exemplary primer and labeled primer-probe sequences for amplifying and detecting mecC include:

[0091] mecAh primer 1:

[0092] 5'dTCACCGATTCCCAAATCTTGC 3' (SEQ ID NO:4)

[0093] mecAh primer 2:

[0094] 5' AAGCAAGCAATAGAATCATCAGACA 3' (SEQ ID NO:6)

[0095] mecAh-labeled primer-probe:

[0096] 5'd CFR610-acgtgCCTAATGCTAATGCAATGCGGGCAcgt-BHQ-2-spacer 18-AAGCAAGCAATAGAATCATCAGACA 3' (SEQ ID NO:5)

[0097] Technicians will understand that other primers, probes, and primer-probes (including other SCORPION™ primer-probes) pointing to mecC can be used.

[0098] Select specific sequences and probes to amplify and detect fragments of the 2.0 kb mecA gene (see, for example, GenBank accession number X52593, range 1491-1519). Exemplary primer and labeled primer-probe sequences for amplifying and detecting mecA include:

[0099] mecA primer 1:

[0100] 5'd TCTTCACCAACACCTAGTTTTTTCA 3' (SEQ ID NO:7)

[0101] mecA primer 2:

[0102] 5' GGTAATATCGACTTAAAACAAGCAATAGA 3' (SEQ ID NO:9)

[0103] mecA-labeled primer-probe:

[0104] 5'd CFR610acgcggcCTTACTGCCTAATTCGAGTGCTACTCTAGC gccgcgt-BHQ-2- spacer 18 GGTAATATCGACTTAAAACAAGCA ATAGA 3' (SEQ ID NO:5)

[0105] Therefore, the quantitative detection and differentiation of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus using the method of the present invention can be achieved using primer pairs containing primer-probes and real-time PCR for amplifying and detecting the Staphylococcus aureus-specific gene spa, as well as the methicillin resistance genes mecA and mecC, on a direct amplification disk using an integrated cyclic system. This method specifically amplifies target nucleic acids (such as target genomic DNA) and simultaneously detects them in the same reaction using fluorescently labeled probes. The primer-probe pairs of spa primer pairs may contain fluorescein amide (e.g., FAM) labels, and each primer-probe pair of mecA and mecC primer pairs may contain an oxanthracene dye (e.g., CFR610) that fluoresces in the red region of the visible spectrum.

[0106] algorithm

[0107] When performing real-time PCR on the sample-reaction mixture and detecting and measuring fluorescence signals associated with the amplified genes, the method of the present invention also uses an MRSA algorithm to determine the presence or absence of MRSA, which provides the final result by matching the cycle threshold (Ct) from the amplified target nucleic acid sequence. Preferably, primers-probes labeled with xanthracene dyes (e.g., CFR610) are used to amplify the mecA and mecC target nucleic acids, the xanthracene dyes fluorescing in the red region of the visible spectrum, and primers-probes labeled with fluorescein fluorophores (e.g., FAM) are used to amplify the spa target nucleic acid sequence. Thus, the signals of mecA and / or mecC (hereinafter referred to as "Ct of mecA_C (CFR610 channel)") originate from the xanthracene dye and the signals of spa (hereinafter referred to as "Ct of SA (FAM channel)") originate from the fluorescein fluorophore.

[0108] The MRSA algorithm shows that:

[0109]

[0110] Therefore, the presence or absence of MRSA in a sample can be determined based on the following conditions:

[0111] (1) When fluorescence signals of both the Staphylococcus aureus-specific gene (FAM signal) and the mecA and / or mecC gene (CFR610 signal) are detected, and the following conditions are met, the presence of MRSA in the biological sample is confirmed:

[0112] (a) Ct (FAM channel) of SA – Ct (CFR610 channel) of mecA_C ≤ 1.9 (i.e., the cycling threshold from Staphylococcus aureus-specific target nucleic acid sequences (e.g., spa) minus the cycling threshold from mecA and / or mecC target nucleic acid sequences ≤ 1.9), or

[0113] (b) Ct (FAM channel) of SA – Ct (CFR610 channel) of mecA_C > 1.9, and Ct (CFR610 channel) of mecA_C + 1.9 < Ct (FAM channel) of SA (i.e., the cycling threshold from Staphylococcus aureus-specific target nucleic acid sequences (e.g., spa) minus the cycling threshold from mecA and / or mecC target nucleic acid sequences > 1.9, and the cycling threshold from mecA and / or mecC target nucleic acid sequences plus 1.9 < the cycling threshold from Staphylococcus aureus-specific target nucleic acid sequences).

[0114] (2) When fluorescence signals of both the Staphylococcus aureus-specific target nucleic acid sequence (FAM signal) and the mecA and / or mecC target nucleic acid sequence (CFR610 signal) are detected, and the following conditions are met, the presence of Staphylococcus aureus and at least one methicillin resistance gene in the sample is determined:

[0115] The Ct (FAM channel) of SA - the Ct (CFR610 channel) of mecA_C < 1.9, and the Ct (FAM channel) of SA + 1.9 < the Ct (CFR610 channel) of mecA_C (i.e., the cycle threshold from the Staphylococcus aureus-specific target nucleic acid sequence minus the cycle threshold from the mecA and / or mecC target nucleic acid sequence < 1.9, and the cycle threshold from the Staphylococcus aureus-specific target nucleic acid sequence plus 1.9 < the cycle threshold from the mecA and / or mecC target nucleic acid sequence).

[0116] In this case, the sample contains Staphylococcus aureus and a methicillin resistance gene, but the methicillin resistance gene can originate from Staphylococcus aureus or from a coagulase-negative Staphylococcus spp. in the same sample.

[0117] (3) Samples with a detectable signal (FAM) for a specific target nucleic acid sequence of Staphylococcus aureus but without a detectable CFR610 signal for mecA and / or mecC are interpreted as containing Staphylococcus aureus but not MRSA.

[0118] (4) If no signal for the target nucleic acid sequence of Staphylococcus aureus (FAM) is detected and no signal for mecA or mecC (CFR610) is detected, the sample is interpreted as negative for Staphylococcus aureus and MRSA.

[0119] Reagent test kit

[0120] This invention also provides kits containing oligonucleotides (which may be primers or primer-probes) for amplification as described herein to determine the presence or absence of MRSA in biological samples. The kits of this invention may also contain oligonucleotides (which can be used as probes to detect amplified nucleic acids), and / or one or more restriction enzymes for digesting non-target nucleic acids to enhance the detection of target nucleic acids via oligonucleotide primers.

[0121] In some implementations, the kit includes:

[0122] (i) The first primer pair that hybridizes specifically to a target marker gene region against Staphylococcus aureus under stringent conditions.

[0123] (ii) The second primer pair that specifically hybridizes to the target mecA gene segment under stringent conditions, and

[0124] (iii) A third primer pair that specifically hybridizes to the target mecC gene segment under strict conditions.

[0125] The first primer pair can specifically hybridize with the spa gene and can consist of any one of the oligonucleotides containing SEQ ID NO:1 and SEQ ID NO:3, or a primer-probe consisting of SEQ ID NO:2. The second primer pair can consist of any one of the oligonucleotides containing SEQ ID NO:4 and SEQ ID NO:6, or a primer-probe consisting of SEQ ID NO:5. The third primer pair can consist of any one of the oligonucleotides containing SEQ ID NO:7 and SEQ ID NO:9, or a primer-probe consisting of SEQ ID NO:8.

[0126] The kit may additionally include an assay definition scan card and / or instructions, such as printed or electronic instructions, for using the oligonucleotide in the assay. In some embodiments, the kit includes instructions for analyzing biological samples to determine the presence or absence of MRSA. In some embodiments, the kit includes an amplification reaction mixture or amplification master mixture. The reagents contained in the kit may be contained in one or more containers, such as vials.

[0127] Primers, probes, and / or primer-probe pairs specifically designed for amplification and detection of internal controls can be included in the amplification master mix as target primer pairs to monitor potential PCR inhibition. The necessary reagents for amplification and detection of targets and internal controls can be formulated into a single amplification master mix, which can be provided in the kit as a single-reaction sample.

[0128] Example

[0129] Example 1

[0130] Nasal swab samples were obtained from individuals using a suitable collection device. 50 μl of untreated nasal swab sample was directly loaded into the sample well of wedge 1 of the SIMPLEXA direct amplification disk (Focus Diagnostics, Inc., Cypress, CA, USA) without a separate front-end sample preparation step. 50 μl of the amplification master mix, containing PCR buffer, DNA polymerase, dNTPs, magnesium chloride, potassium chloride, ammonium sulfate, primers consisting of SEQ ID NO:1, 2, 4, 5, 7, and 8, and an internal control DNA fragment and primer pairs specifically targeting the control fragment, were aspirated into the sample well of wedge 1 of the disk. The primers consisting of SEQ ID NO:2, 5, and 8 were SCORPION primer-probe pairs and labeled with FAM (SEQ ID NO:2) and CFR610 (SEQ ID NO:6 and 8).

[0131] Seal the wedge with foil, then insert the direct amplification disk into the 3M. TM The RT-PCR was initiated in an integrated PCR cycler (3M, St. Paul, MN, USA). The PCR cycling conditions included the following steps: i) at 97°C... o Sample preheating at point C for 480 seconds, 1 cycle, ii) at 97 o Polymerase activation at point C for 120 seconds, 1 cycle, iii) at 97 o Denaturation at point C for 10 seconds, and 58 o Annealing at point C for 30 seconds, 37 cycles.

[0132] Target genomic DNA was specifically amplified and simultaneously detected in the same reaction using fluorescently labeled primers and probes. The presence of MRSA was determined using the following MRSA algorithm, which provides the final result by matching the cycle threshold (Ct) in the FAM and CFR610 channels:

[0133] if:

[0134] 1) Ct of SA (FAM channel) - Ct of mecA_C (CFR610 channel) ≤ 1.9, or

[0135] 2) Ct of SA (FAM channel) - Ct of mecA_C (CFR610 channel) > 1.9 and Ct of mecA_C (CFR610 channel) + 1.9 < Ct of SA (FAM channel).

[0136] Samples with signals in the FAM and CFR610 channels will be interpreted as MRSA.

[0137] if:

[0138] 1) Ct of SA (FAM channel) - Ct of mecA_C (CFR610 channel) < 1.9 and Ct+1.9 of SA (FAM channel) < Ct of mecA_C (CFR610 channel)

[0139] Samples with signals in the FAM and CFR610 channels will be interpreted as methixiline-resistant SA (SA, methresist).

[0140] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0141] The invention described illustratively herein can be suitably practiced in the absence of any one or more elements, any one or more limitations, the omission of which is not specifically disclosed herein. Furthermore, the terminology and expressions used herein are descriptive rather than limiting, and the use of these terms and expressions is not intended to exclude any equivalents of the features and portions thereof to be shown and described, but rather it is acknowledged that various modifications are possible within the scope of the invention as claimed.

[0142] Therefore, it should be understood that although the present invention has been specifically disclosed through preferred embodiments and optimal features, modifications, improvements, and variations of the invention disclosed herein are possible to those skilled in the art, and such modifications, improvements, and variations are considered to be within the scope of the invention. The materials, methods, and embodiments provided herein represent preferred embodiments, are exemplary, and are not intended to limit the scope of the invention.

[0143] This invention is described broadly and generically. Each narrower group of species and subgenerics falling within the generic disclosure also forms part of this invention. This includes the generic description of the invention, as well as any conditions or negative limitations that remove any subject matter from that category, regardless of whether the excised material is specifically described herein.

[0144] Furthermore, when features or aspects of the invention are described in the Markush group, those skilled in the art will recognize that the invention can also be described in any single member or subgroup of the Markush group.

[0145] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated herein by reference in their entirety as if they were individually incorporated by reference. In case of conflict, this specification (including definitions) shall prevail.

[0146] This disclosure relates to the following implementation plan.

[0147] 1. A method for determining the presence or absence of methicillin-resistant Staphylococcus aureus in a biological sample, comprising:

[0148] (a) Contact the biological sample with the following:

[0149] (i) The first primer pair that specifically hybridizes under stringent conditions to a target nucleic acid region (if present) specifically targeting Staphylococcus aureus.

[0150] (ii) A second primer pair that specifically hybridizes to the target mecA nucleic acid region (if present) under stringent conditions, and

[0151] (iii) A third primer pair that specifically hybridizes to the target mecC nucleic acid region (if present) under stringent conditions.

[0152] To produce a reaction-sample mixture, wherein at least one primer of each primer pair is attached to a fluorophore tag.

[0153] (b) The reaction-sample mixture is subjected to real-time polymerase chain reaction (PCR) conditions, under which each target nucleic acid present in the biological sample is amplified to generate a fluorescent signal.

[0154] (c) Measure the amount of fluorescence signal produced by each fluorophore, and

[0155] (d) The presence or absence of MRSA is determined by comparing the fluorescence intensity from the target biomarker nucleic acid, wherein...

[0156] (i) When fluorescence signals of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acid are detected, and

[0157] (1) The cycling threshold (Ct) from Staphylococcus aureus-specific target nucleic acids minus the Ct from mecA and / or mecC nucleic acids ≤ 1.9, or

[0158] (2) The Ct from Staphylococcus aureus-specific target nucleic acid minus the Ct from mecA and / or mecC nucleic acids > 1.9 and the Ct from mecA and / or mecC nucleic acids plus 1.9 < the Ct from Staphylococcus aureus-specific target nucleic acid.

[0159] This confirms the presence of MRSA in the biological sample;

[0160] (ii) When the Ct values ​​of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acids are detected, and the difference between the Ct value from the Staphylococcus aureus-specific target nucleic acid and the Ct value from mecA and / or mecC nucleic acids is < 1.9, and the sum of the Ct value from the Staphylococcus aureus-specific target nucleic acid and 1.9 is < the Ct value from mecA and / or mecC nucleic acids, the presence of Staphylococcus aureus and methicillin resistance genes in the biological sample is confirmed; or

[0161] (iii) If a fluorescence signal of a Staphylococcus aureus-specific target nucleic acid sequence is detected but no fluorescence signal of mecA and / or mecC is detected, then Staphylococcus aureus is confirmed to be present in the biological sample and MRSA is confirmed to be absent.

[0162] 2. The method of embodiment 1, wherein one primer of each primer pair is a primer-probe containing a probe sequence element at the 5' end of the primer, wherein the probe sequence element further comprises a fluorophore and a quencher, and wherein the fluorophores of the mecA primer and the mecC primer are identical.

[0163] 3. The method of embodiment 1, wherein all primer pairs are contained together in a master amplification mixture prior to contact with the biological sample, the mixture further comprising DNA polymerase, dNTPs and PCR buffer.

[0164] 4. The method of implementation scheme 1, wherein step (a) further includes contacting the biological sample with a fourth primer pair, the fourth primer pair specifically hybridizing with a control target nucleic acid segment under stringent conditions.

[0165] 5. The method of embodiment 2, wherein the target nucleic acid specifically targeting Staphylococcus aureus comprises all or part of a gene sequence selected from the group consisting of: spa, agr, ssp protease, sir, sodM, cap, coa, α-hemolysin, γ-hemolysin, femA, Tuf, sorting enzyme, fibrinogen-binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthase, sar, sbi, rpoB, gyrase A, and orfX.

[0166] 6. The method of implementation scheme 5, wherein the target nucleic acid specifically targeting Staphylococcus aureus is spa.

[0167] 7. The method of embodiment 6, wherein the first primer pair consists of a first primer comprising SEQ ID NO:1 and a second primer comprising SEQ ID NO:2.

[0168] 8. The method of embodiment 7, wherein the second primer pair consists of a first primer comprising SEQ ID NO:4 and a second primer comprising SEQ ID NO:6.

[0169] 10. The method of embodiment 8, wherein the third primer pair consists of a first primer comprising SEQ ID NO:7 and a second primer comprising SEQ ID NO:9.

[0170] 11. The method of embodiment 6, wherein the spa primer-probe contains a fluorescein amide fluorophore and the mecA and mecC primer-probes contain an oxane dye that fluoresces in the red region of the visible spectrum.

[0171] 12. A kit for determining the presence or absence of methicillin-resistant Staphylococcus aureus (MRSA) in biological samples, comprising:

[0172] (i) The first primer pair that specifically hybridizes to the target nucleic acid region specifically targeting Staphylococcus aureus under stringent conditions.

[0173] (ii) The second primer pair that specifically hybridizes to the target mecA nucleic acid segment under stringent conditions, and

[0174] (iii) A third primer pair that specifically hybridizes to the target mecC nucleic acid segment under stringent conditions.

[0175] One primer in each primer pair is a primer-probe that contains a probe sequence element at the 5' end of the primer, wherein the probe sequence element also contains a fluorophore and a quencher, and wherein the fluorophores of the mecA primer and the mecC primer are identical.

[0176] 13. The kit according to implementation scheme 12, which further includes primer pairs that specifically hybridize with control gene sequences under stringent conditions.

[0177] 14. The kit of embodiment 13, wherein all primer pairs are present together in the amplification master mixture, the mixture further comprising DNA polymerase, dNTPs and PCR buffer.

[0178] 15. The kit according to embodiment 12, wherein the target nucleic acid specifically targeting Staphylococcus aureus is selected from the group consisting of: spa, agr, ssp protease, sir, sodM, cap, coa, α-hemolysin, γ-hemolysin, femA, Tuf, sorting enzyme, fibrinogen-binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthase, sar, sbi, rpoB, gyrase A, and orfX.

[0179] 16. The kit according to embodiment 15, wherein the target nucleic acid specifically targeting Staphylococcus aureus is spa.

[0180] 17. The kit of embodiment 16, wherein the first primer pair consists of a first primer comprising SEQ ID NO:1 and a second primer comprising SEQ ID NO:2.

[0181] 18. The kit of embodiment 17, wherein the second primer pair comprises a first primer comprising SEQ ID NO:4 and a second primer comprising SEQ ID NO:6.

[0182] 19. The kit of embodiment 18, wherein the third primer pair consists of a first primer comprising SEQ ID NO:7 and a second primer comprising SEQ ID NO:9.

[0183] 20. The kit of embodiment 19, wherein the spa primer-probe contains a fluorescein amide fluorophore and the mecA and mecC primer-probes contain an oxane dye that fluoresces in the red region of the visible spectrum.

[0184] 21. The kit according to implementation scheme 12, which also includes printed or electronic instructions.

[0185] Other embodiments are shown in the appended claims.

Claims

1. A direct amplification kit for determining the presence or absence of methicillin-resistant Staphylococcus aureus (MRSA) in untreated biological samples, the kit comprising: (a) Amplification master mix, wherein the amplification master mix comprises DNA polymerase, dNTPs, PCR buffer, and: (i) The first primer pair that specifically hybridizes under stringent conditions to a segment of the target nucleic acid against Staphylococcus aureus (if present). (ii) a second primer pair that specifically hybridizes to a segment of the target mecC nucleic acid (if present) under stringent conditions, wherein the second primer pair consists of a first primer comprising SEQ ID NO: 4 and a second primer comprising SEQ ID NO: 6, and (iii) A third primer pair that specifically hybridizes to a segment of the target mecA nucleic acid (if present) under stringent conditions, wherein the third primer pair consists of a first primer comprising SEQ ID NO: 7 and a second primer comprising SEQ ID NO:

9. The biological sample is in direct contact with the amplification master mixture without the need for extraction or purification steps prior to amplification, and the amplification of the target nucleic acid generates a fluorescent signal. (b) Assay instructions for determining the presence or absence of MRSA by comparing the amount of fluorescence from the target nucleic acid.

2. The kit of claim 1, wherein the kit further comprises a direct amplification disk having a plurality of designated areas for receiving the untreated biological sample and the amplification master mix.

3. The kit according to claim 1, wherein the assay instructions include: (i) When fluorescence signals of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acid are detected, and: (1) The cycling threshold (Ct) of Staphylococcus aureus-specific target nucleic acids minus the Ct of mecA and / or mecC nucleic acids ≤ 1.9, or (2) The Ct from Staphylococcus aureus-specific target nucleic acid minus the Ct from mecA and / or mecC nucleic acids > 1.9 and the Ct from mecA and / or mecC nucleic acids plus 1.9 < the Ct from Staphylococcus aureus-specific target nucleic acid, This confirms the presence of MRSA in the biological sample; (ii) When the Ct values ​​of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acids are detected, and the Ct value from the Staphylococcus aureus-specific target nucleic acid minus the Ct value from mecA and / or mecC nucleic acids is < 1.9, and the Ct value from the Staphylococcus aureus-specific target nucleic acid plus 1.9 is < the Ct value from mecA and / or mecC nucleic acids, the presence of Staphylococcus aureus and methicillin resistance genes in the biological sample is determined; and (iii) If a fluorescence signal of a Staphylococcus aureus-specific target nucleic acid sequence is detected but no fluorescence signal of mecA and / or mecC is detected, then Staphylococcus aureus is confirmed to be present in the biological sample and MRSA is confirmed to be absent. The biological sample is in direct contact with the amplification master mixture without the need for extraction or purification steps prior to amplification.

4. The kit according to claim 1, wherein one primer of each primer pair is a primer-probe containing a probe sequence element at the 5' end of the primer, wherein the probe sequence element further comprises a fluorophore and a quencher, and wherein the fluorophores of the mecA primer and the mecC primer are identical.

5. The kit according to claim 1, further comprising a fourth primer pair that specifically hybridizes with the control target nucleic acid segment under stringent conditions.

6. The kit according to claim 4, wherein the target nucleic acid specifically targeting Staphylococcus aureus comprises all or part of the gene sequences selected from the group consisting of: spa, agr, ssp protease, sir, sodM, cap, coa, α-hemolysin, γ-hemolysin, femA, Tuf, sorting enzyme, fibrinogen-binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthase, sar, sbi, rpoB, gyrase A, and orfX.

7. The kit according to claim 6, wherein the target nucleic acid specifically targeting Staphylococcus aureus is spa.

8. The kit according to claim 7, wherein the first primer pair comprises a first primer comprising SEQ ID NO: 1 and a second primer comprising SEQ ID NO:

3.

9. The kit according to claim 7, wherein the spa primer-probe contains a fluorescein amide (FAM) fluorophore, and the mecA and mecC primer-probes contain an oxane dye that fluoresces in the red region of the visible spectrum.

10. Use of the amplification master mix in the preparation of a direct amplification kit for determining the presence or absence of methicillin-resistant Staphylococcus aureus (MRSA) in untreated biological samples, wherein the amplification master mix comprises DNA polymerase, dNTPs, PCR buffer, and: (i) The first primer pair that specifically hybridizes under stringent conditions to a segment of the target nucleic acid against Staphylococcus aureus (if present). (ii) a second primer pair that specifically hybridizes to a segment of the target mecC nucleic acid (if present) under stringent conditions, wherein the second primer pair consists of a first primer comprising SEQ ID NO: 4 and a second primer comprising SEQ ID NO: 6, and (iii) A third primer pair that specifically hybridizes to a segment of the target mecA nucleic acid (if present) under stringent conditions, wherein the third primer pair consists of a first primer comprising SEQ ID NO: 7 and a second primer comprising SEQ ID NO:

9. The biological sample is in direct contact with the amplification master mixture without the need for extraction or purification steps prior to amplification, and the amplification of the target nucleic acid generates a fluorescent signal.

11. The use according to claim 10, wherein the kit further comprises a direct amplification disk having a plurality of designated areas for receiving the untreated biological sample and the amplification master mix.

12. The use according to claim 10, wherein the kit further comprises assay instructions for determining the presence or absence of MRSA by comparing the amount of fluorescence from the target nucleic acid.

13. The use according to claim 12, wherein the measurement description includes: (i) When fluorescence signals of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acid are detected, and: (1) The cycling threshold (Ct) of Staphylococcus aureus-specific target nucleic acids minus the Ct of mecA and / or mecC nucleic acids ≤ 1.9, or (2) The Ct from Staphylococcus aureus-specific target nucleic acid minus the Ct from mecA and / or mecC nucleic acids > 1.9 and the Ct from mecA and / or mecC nucleic acids plus 1.9 < the Ct from Staphylococcus aureus-specific target nucleic acid, This confirms the presence of MRSA in the biological sample; (ii) When the Ct values ​​of both Staphylococcus aureus-specific target nucleic acid and mecA and / or mecC nucleic acids are detected, and the Ct value from the Staphylococcus aureus-specific target nucleic acid minus the Ct value from mecA and / or mecC nucleic acids is < 1.9, and the Ct value from the Staphylococcus aureus-specific target nucleic acid plus 1.9 is < the Ct value from mecA and / or mecC nucleic acids, the presence of Staphylococcus aureus and methicillin resistance genes in the biological sample is determined; and (iii) If a fluorescence signal of a Staphylococcus aureus-specific target nucleic acid sequence is detected but no fluorescence signal of mecA and / or mecC is detected, then Staphylococcus aureus is confirmed to be present in the biological sample and MRSA is confirmed to be absent. The biological sample is in direct contact with the amplification master mixture without the need for extraction or purification steps prior to amplification.

14. The use according to claim 10, wherein one primer of each primer pair is a primer-probe containing a probe sequence element at the 5' end of the primer, wherein the probe sequence element further comprises a fluorophore and a quencher, and wherein the fluorophore of the mecA primer and the fluorophore of the mecC primer are identical.

15. The use according to claim 10, further comprising a fourth primer pair that specifically hybridizes with a control target nucleic acid segment under stringent conditions.

16. The use according to claim 14, wherein the target nucleic acid specifically targeting Staphylococcus aureus comprises all or part of a gene sequence selected from the group consisting of: spa, agr, ssp protease, sir, sodM, cap, coa, α-hemolysin, γ-hemolysin, femA, Tuf, sorting enzyme, fibrinogen-binding protein, clfB, srC, sdrD, sdrE, sdrF, sdrG, sdrH, NAD synthase, sar, sbi, rpoB, gyrase A, and orfX.

17. The use according to claim 16, wherein the target nucleic acid specifically targeting Staphylococcus aureus is spa.

18. The use according to claim 17, wherein the first primer pair comprises a first primer comprising SEQ ID NO: 1 and a second primer comprising SEQ ID NO:

3.

19. The use according to claim 17, wherein the spa primer-probe contains a fluorescein amide (FAM) fluorophore, and the mecA and mecC primer-probes contain an oxane dye that fluoresces in the red region of the visible spectrum.

Images