Enhanced crisper / lbcas12a hairpin probe combination and its application in rapid detection of xanthomonas oryzae pv. oryzae

Abstract

The present application relates to the technical field of plant pathogen molecular diagnosis, and particularly relates to a hairpin probe combination for enhancing CRISPR / LbCas12a and application thereof in rapid detection of rice bacterial blight, taking Xoo-specific sequence Xogt1 gene as a target, realizing high-efficiency isothermal amplification of the target nucleic acid through recombination enzyme-assisted amplification (RAA), combining with the engineered hairpin DNA report probe to enhance the LbCas12a trans-cleavage activity, and constructing a "RAA-CRISPR / LbCas12a" double-module detection system; key parameters such as amplification time, enzyme concentration and probe concentration are optimized, two result reading modes of fluorescence visualization and lateral flow test strip (LFS) are developed, the detection limit reaches 100 aM, the specificity can distinguish Xoo from other five common rice pathogenic bacteria, the whole process takes less than or equal to 25 minutes, and no complex instrument is needed. The present application solves the problems of the existing detection methods, such as insufficient sensitivity, complicated operation, high false positive risk and unsuitability for field scenes, and can be directly applied to early diagnosis of rice bacterial blight, seedling quarantine and disease epidemic monitoring.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostic technology for plant pathogens, specifically to a hairpin probe combination that enhances CRISPR / LbCas12a and its application in the rapid detection of rice bacterial blight pathogen. Background Technology

[0002] Rice is the staple food source for nearly half of the world's population. Rice bacterial blight (BLB), caused by *Xanthomonas oryzae* pv. oryzae (Xoo), is one of the most destructive bacterial diseases affecting rice production, causing yield losses of 20%-50% in major rice-growing areas, and in severe cases, even total crop failure. Currently, the control of rice bacterial blight mainly relies on chemical fungicides. Long-term use not only easily leads to the development of fungal resistance but also causes environmental pollution and pesticide residues. Therefore, achieving early and rapid detection of *Xanthomonas oryzae* is of great significance for timely targeted control measures, reducing pesticide use, and ensuring food security.

[0003] Existing methods for detecting rice bacterial blight pathogens have many limitations: traditional morphological identification is highly subjective and easily confused with rice bacterial leaf streak; culture methods are time-consuming and labor-intensive, requiring several days to obtain results; immunoassay methods such as ELISA lack sufficient sensitivity and specificity, easily resulting in false positives; nucleic acid amplification technologies such as PCR and qPCR, while highly accurate, rely on expensive thermal cycling equipment, professional operators, and laboratory environments, failing to meet the needs of field testing; conventional isothermal amplification techniques (such as LAMP and RPA), while requiring no complex instruments, are susceptible to aerosol contamination leading to false positives, limiting their field application.

[0004] CRISPR / Cas systems, as novel molecular detection tools, have attracted significant attention in the field of pathogen detection due to their high specificity and sensitivity. Among them, the CRISPR / LbCas12a system, upon recognizing target DNA, activates its non-specific trans-cleavage activity, efficiently cleaving surrounding single-stranded DNA (ssDNA) probes. Detection technologies developed based on this mechanism have shown broad application prospects. However, the binding stability of conventional linear ssDNA probes to LbCas12a is insufficient, resulting in limited trans-cleavage efficiency. This necessitates prolonged target amplification time to accumulate sufficient product, further increasing the risk of contamination and detection time. Therefore, developing probe designs that enhance the trans-cleavage activity of LbCas12a, combined with isothermal amplification technology to construct a rapid, sensitive, and field-applicable detection platform, has become crucial for solving the problem of efficient detection of rice bacterial blight pathogens.

[0005] In view of the above-mentioned defects, the inventors of this invention have finally obtained this invention after a long period of research and practice. Summary of the Invention

[0006] The purpose of this invention is to address the problems of insufficient sensitivity, complex operation, high false positive risk, and unsuitability for field scenarios in existing Xoo detection methods. This invention provides an enhanced CRISPR / LbCas12a hairpin probe combination and its application in the rapid detection of rice bacterial blight pathogen.

[0007] To achieve the above objectives, this invention discloses a hairpin probe assembly that enhances CRISPR / LbCas12a, comprising a hairpin probe Hairpin-FQ for fluorescence visualization detection and a hairpin probe Hairpin-FB for lateral flow chromatography test strip detection, a RAA primer pair designed based on Xogt1, and crRNA. The nucleotide sequence of the hairpin probe Hairpin-FQ is shown in SEQ ID NO.2, and the nucleotide sequence of the hairpin probe Hairpin-FB is shown in SEQ ID NO.3.

[0008] The hairpin probe Hairpin-FQ has a fluorescent reporter group 6-FAM at its 5' end and a fluorescent quencher group BHQ1 at its 3' end; the hairpin probe Hairpin-FB has a fluorescent reporter group 6-FAM at its 5' end and a biotin group Biotin at its 3' end.

[0009] Xogt1 is the glycosyltransferase-1 encoding gene specifically present in *Bacillus oryzae*, the causal agent of rice bacterial blight, and its nucleotide sequence is shown in SEQ ID NO.1. The RAA primer pair designed based on Xogt1 is any one of primer pair 1, primer pair 2, and primer pair 3 targeting *Bacillus oryzae*.

[0010] The first primer pair includes an upstream primer Xoo-F1, whose nucleotide sequence is shown in SEQ ID NO.4, and a downstream primer Xoo-R1, whose nucleotide sequence is shown in SEQ ID NO.5.

[0011] The primer pair 2 includes an upstream primer Xoo-F2, the nucleotide sequence of which is shown in SEQ ID NO.6, and a downstream primer Xoo-R2, the nucleotide sequence of which is shown in SEQ ID NO.7;

[0012] The primer pair 3 includes an upstream primer Xoo-F3, whose nucleotide sequence is shown in SEQ ID NO.8, and a downstream primer Xoo-R4, whose nucleotide sequence is shown in SEQ ID NO.9.

[0013] The crRNA is any one of crRNA1, crRNA2, and crRNA3, the nucleotide sequence of crRNA1 is shown in SEQ ID NO.10, the nucleotide sequence of crRNA2 is shown in SEQ ID NO.11, and the nucleotide sequence of crRNA3 is shown in SEQ ID NO.12.

[0014] This invention also discloses a kit comprising two independent reaction systems: a RAA amplification reaction system and a CRISPR / LbCas12a detection reaction system. The RAA amplification reaction system comprises RAA primer pairs designed based on Xogt1, Buffer V, template DNA, lyophilized enzyme powder, and Mg(OAc)2. The CRISPR / LbCas12a detection reaction system comprises the hairpin probe combination as described above, reaction buffer, LbCas12a enzyme, crRNA, RNase inhibitor, and RAA reaction product.

[0015] The reaction buffer is 10×Super Buffer 1.0, and its composition is: 100 mM MCl, 20 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH 8.5, and reaction temperature 25℃.

[0016] The total volume of the RAA amplification reaction system is 50 μL, including: 2 μL 10 μM upstream primer, 2 μL 10 μM downstream primer, 25 μL Buffer V, 14 μL ddH2O, 2 μL template DNA, and lyophilized enzyme powder. 5 μL 50 mM Mg(OAc)2 is added at the start of the reaction. The total volume of the CRISPR / LbCas12a detection reaction system is 50 μL, including: 5 μL reaction buffer, 2 μL 1 μM LbCas12a enzyme, 1 μL 2 μM crRNA, 2 μL 10 μM hairpin probe combination, 1 μL 40 U / μL RNase inhibitor, 2 μL RAA reaction product, and ddH2O to bring the total volume to 50 μL.

[0017] This invention also discloses the application of an enhanced CRISPR / LbCas12a hairpin probe combination in the rapid detection of rice bacterial blight pathogen. The method for rapid detection of rice bacterial blight pathogen using the kit described above includes the following steps:

[0018] S1, Extract genomic DNA from the rice sample to be tested;

[0019] S2, using the DNA obtained in step S1 as a template, react at 37°C for 15 minutes in the RAA amplification reaction system of the kit to obtain the RAA product;

[0020] S3. Add the RAA product obtained in step S2 to the CRISPR / LbCas12a detection reaction system and react at 37°C for 10 minutes. Then interpret the results.

[0021] In step S1, the specific process of extracting genomic DNA from the rice sample to be tested is as follows: take the diseased leaves of the sample to be tested, cut them into pieces and place them in a centrifuge tube, add 0.5 M NaOH solution to grind them, let them stand at room temperature for 1 min, and use them as templates after dilution with TE Buffer.

[0022] In step S3, the result interpretation method is as follows: observe the green fluorescence by holding a UV lamp, or use a side-flow chromatography test strip for visual reading. If green fluorescence appears or both the test line (T line) and the control line (C line) appear on the test strip, it is judged as positive; if no green fluorescence appears or neither the test line nor the control line appears on the test strip, it is judged as negative.

[0023] Compared with existing technologies, the advantages of this invention are as follows: This invention uses the Xoo-specific sequence Xogt1 gene as a target, achieving efficient isothermal amplification of the target nucleic acid through recombinase-assisted amplification (RAA). Combined with an engineered hairpin DNA reporter probe to enhance the trans-cleavage activity of LbCas12a, a dual-module detection system of "RAA-CRISPR / LbCas12a" is constructed. Key parameters such as amplification time, enzyme concentration, and probe concentration are optimized, and two result reading modes—fluorescence visualization and lateral flow strip (LFS)—are developed. The detection limit reaches 100 aM, and the specificity can distinguish Xoo from five other common rice pathogens. The entire process takes ≤25 minutes and requires no complex instruments. This invention solves the problems of insufficient sensitivity, cumbersome operation, high false-positive risk, and unsuitability for field scenarios in existing detection methods. It can be directly applied to the early diagnosis, seedling quarantine, and epidemic monitoring of rice bacterial blight. Attached Figure Description

[0024] Figure 1 This is a schematic diagram illustrating the principle and operation process of the detection method of the present invention;

[0025] Figure 2 The results of screening and validation of RAA primer pairs and crRNA are shown. A is a schematic diagram of primer and crRNA target sites; B is an agarose gel electrophoresis diagram of the amplification efficiency of the three RAA primer pairs; C is the fluorescence detection specificity of the three crRNAs; and D is the real-time fluorescence kinetic curve of the three crRNAs.

[0026] Figure 3 This section compares the performance of hairpin probes and linear probes. A shows the structural diagrams of the two probes; B shows the comparison of the fluorescence signal intensities produced by the two probes under the same reaction conditions; and C shows the Michaelis-Menten equation fitting curves for the two probes.

[0027] Figure 4 The results show the optimization of key reaction conditions for the RAA-CRISPR / LbCas12a system. A represents the optimized LbCas12a concentration; B represents the optimized molar ratio of LbCas12a to crRNA; C represents the optimized hairpin reporter probe concentration; and D represents a comparison of different reaction buffers.

[0028] Figure 5 For the sensitivity and specificity analysis of the detection platform, AC represents the agarose gel electrophoresis, fluorescence visual inspection, and real-time fluorescence curves for sensitivity detection, respectively; D represents the linear relationship between fluorescence signal and template concentration; and EF represents the specificity detection results for six different rice pathogens.

[0029] Figure 6 This paper presents the results of actual field sample testing and the application of lateral flow chromatography (LFS) test strips. A shows the fluorescence detection results of 46 field samples; B shows the results of simultaneous PCR verification; C shows the statistical concordance rate between the results of this method and PCR; D shows a schematic diagram of the LFS detection principle; and E shows the LFS detection results of some positive samples. Detailed Implementation

[0030] The above-mentioned and other technical features and advantages of the present invention will be described in more detail below with reference to the accompanying drawings.

[0031] Example 1

[0032] Probe design:

[0033] Hairpin-FQ (SEQ ID NO.2): Based on the characteristic of LbCas12a's preference for non-specific cleavage of T-rich nucleotide sequences, the hairpin is based on a circular sequence of 15 consecutive Ts. The 5′ end is CCTCA and the 3′ end is AGAGAG, respectively. It was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The 5′ end is modified with the fluorescein group 6-FAM, and the 3′ end is modified with the fluorescence quencher group BHQ1 for use in fluorescence signal detection systems. The 3′ end is modified with biotin for use in test strip detection systems.

[0034] Linear probe Linear-FQ: Based on the preference of LbCas12a for efficient non-specific cleavage of T-rich nucleotide sequences, 5′–TTTATTT-3′ was designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd., wherein the 5′ end is modified with a fluorescein group 6-FAM and the 3′ end is modified with a fluorescence quencher group BHQ1.

[0035] Specific target gene screening and sequence design:

[0036] The glycosyltransferase-1 encoding gene Xogt1 (SEQ ID NO.1), specifically present in *Xoo*, was identified through comparison with the NCBI Nucleotide database. Three pairs of RAA primers (SEQ ID NO.4–SEQ ID NO.9) were designed based on the conserved region of this gene using SnapGene software. Three crRNAs (SEQ ID NO.10–SEQ ID NO.12) targeting the flanking region of the PAM sequence (5'-TTTV-3') within the amplicon were designed using the online tool CRISPOR. All oligonucleotides were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0037] The sequence of the gene Xogt1 is as follows:

[0038] ACAAGCACTCATTGACTTCGAAGTAGCCAATGCACGCGTGATGGACCTCACTTCGCGTCTGACCTCTATGAGTCGGGAGCTGATCCAGACTCGATCGGAATTGGAGCGCTTACGTATCGGTGCAGCGCCCATTTCGTACTCAGTCACCAATTTTGAGGGCTACGACGATGTCCATAATCGTTATGCGCAGATACC TGCATCGCGTTTGGTGAAGTTTGCTTCGATGTTTAACAGTAAGCTGCGTCGGTGTCTGTAATGGACCGTCCTCGTATTCTTCATTGCATCACGGTGTATAACGGGGGGCATTCGTACCTGCCGCAATCAAAAGTGCGCTGCGCCTAGATCAGCCAGGAAGCACAAATAGATGTATAAGTCCTGGATGACG (SEQ ID NO.1).

[0039] The sequences of probes, primers, and crRNA used in the examples are shown in Table 1 below.

[0040] Table 1. Sequences of probes, primers, and crRNA

[0041]

[0042] Example 2

[0043] Establishment of the RAA-CRISPR / LbCas12a detection platform:

[0044] RAA amplification reaction system: Using 10 nM Xoo-pUC57 plasmid (containing the full-length Xogt1 target sequence) as a template, the RAA kit was prepared according to the instructions of Qitian Biotech (Wuxi Qitian). The 50 μL reaction mixture contained: 25 μL Buffer V, 2 μL forward primer (10 μM), 2 μL reverse primer (10 μM), 14 μL ddH2O, 2 μL template, and finally, lyophilized enzyme powder was added. The reaction was initiated with 5 μL 50 mM Mg(OAc)2. The reaction was carried out in a 37℃ metal bath for 20 minutes. 5 μL of the product was analyzed by 2% agarose gel electrophoresis. The results are as follows: Figure 2 As shown in B, primer pair F3 / R3 (corresponding to SEQ ID NO.8 and SEQ ID NO.9) had the highest amplification efficiency, with a single bright band, and the negative control (using ddH2O as a template) showed no non-specific bands. Therefore, F3 / R3 was selected for all subsequent experiments.

[0045] CRISPR / LbCas12a detection reaction system: The RAA amplification products of the above three primer pairs were used as templates for CRISPR / LbCas12a reaction. The 20 μL reaction system contained: 2 μL 10× NEBuffer r2.1, 1 μL LbCas12a (1 μM; NEB), 1 μL crRNA (2 μM, corresponding to SEQ ID NO.10-12), 2 μL linear reporter probe (Linear-FQ, 10 μM) or hairpin probe (Hairpin-FQ, 10 μM, corresponding to SEQ ID NO.2), 1 μL RNasin®Plus Ribonuclease Inhibitor (40 U / μL; Promega), 2 μL RAA amplification product, and 11 μL ddH2O. The reaction was performed on a Bio-Rad CFX96 real-time fluorescence PCR instrument, incubated at 37℃ for 20 minutes, with fluorescence signals (FAM channel) acquired every 30 seconds. By comparing the trans-cleavage efficiency of LbCas12a against linear ssDNA probes and hairpin ssDNA probes, we can identify their potential applications in CRISPR nucleic acid diagnostics.

[0046] Example 3

[0047] Verification of the hairpin probe enhancement effect:

[0048] Under the same reaction conditions, CRISPR / LbCas12a detection was performed using linear ssDNA probes and hairpin ssDNA probes, respectively. Fluorescence kinetics were monitored using a microplate reader, and the initial reaction rate (V0) was calculated. The Michaelis-Menten equation was fitted to the V0 values ​​at different substrate concentrations using GraphPad Prism software, and the Michaelis constant (K0) was calculated. m The results showed that the fluorescence signal intensity of the hairpin probe group was significantly higher than that of the linear probe group, and its K... m Value (1.800×10) -6 M) is much lower than that of linear probes (6.117×10). -6 M), demonstrating that the hairpin probe can effectively improve the cutting efficiency of LbCas12a. The results are as follows: Figure 2 As shown in C and 2D, when crRNA3 (SEQ ID NO.12) is used as the guide RNA, the fluorescence signal intensity is the highest, the signal-to-noise ratio is the best, and the kinetic curve rises the fastest. Therefore, crRNA3 was selected as the optimal guide RNA.

[0049] Example 4

[0050] Optimization of the reaction system:

[0051] Key parameters in the CRISPR / LbCas12a detection procedure were systematically optimized. All optimization experiments used the RAA product of 10 fM Xoo-pUC57 plasmid as a positive template and the RAA product of ddH2O as a negative control. The signal-to-noise ratio (positive signal / negative signal) was used as the evaluation criterion.

[0052] 1. Optimization of LbCas12a concentration:

[0053] The performance of LbCas12a at final concentrations of 1, 10, 20, 40, 80, and 160 nM was tested at fixed crRNA concentrations (160 nM) and probe concentrations (0.8 μM). Figure 4 As shown in Figure A, the signal-to-noise ratio reaches its peak when the concentration is increased to 80 nM. Further increasing the concentration does not significantly improve the signal. Therefore, 80 nM is selected as the optimal working concentration.

[0054] 2. Optimization of LbCas12a:crRNA molar ratio:

[0055] With the LbCas12a concentration fixed at 80 nM, the molar ratios of crRNA to Cas protein were tested (1:0.1, 1:0.5, 1:1, 1:2, 1:3, 1:4). Figure 4As shown in B, the signal-to-noise ratio is highest when the ratio is 1:2 (i.e., crRNA is 160 nM), indicating that the assembly of the ribonucleoprotein complex is most efficient at this ratio.

[0056] 3. Hairpin report probe concentration optimization:

[0057] The effect of probe concentrations (0.01, 0.1, 0.4, 0.8, 1.6, 3.2 μM) was tested under optimal Cas protein and crRNA conditions. Figure 4 As shown in Figure C, the signal-to-noise ratio is highest at 0.8 μM. Excessively high concentrations may lead to substrate inhibition.

[0058] 4. Optimization of reaction buffer:

[0059] Five commonly used buffer solutions were compared: NEBuffer r1.1, r2.1, r3.1, rCutSmart Buffer, and a laboratory-prepared Super Buffer 1.0 (40 mM Tris-HCl, 30 mM KCl, 20 mM (NH4)2SO4, 5 mM MgSO4, 0.1% Tween-20, pH 8.0). Figure 4 As shown in D, Super Buffer 1.0 provided the highest fluorescence signal and signal-to-noise ratio, and was therefore selected as the final reaction buffer.

[0060] Therefore, the optimal reaction system was finally determined to be: 80 nM LbCas12a, 160 nM crRNA, 0.8 µM hairpin probe, reacted in Super Buffer 1.0 at 37℃ for 10 min.

[0061] Example 5

[0062] Sensitivity and specificity tests:

[0063] Sensitivity: Plasmids containing the XooGtf1 gene were serially diluted 10-fold (10... 1 aM to 10 6 The method, with a limit of detection of 100 aM, was performed using an optimized platform. Results showed that the detection limit was 100 aM, and a good linear relationship existed between the fluorescence signal and the logarithm of the template concentration (R² = 0.9629).

[0064] Specificity: To verify the specificity of this method, five common rice pathogens were selected: Rhizoctonia solani (Rs, rice sheath blight fungus), Ustilaginoidea virens (Uv, rice false smut fungus), Fusarium fujikuroi (Ff, bakanae disease fungus), Magnaporthe oryzae (Mo, rice blast fungus), and X. oryzae pv. oryzicola (Xoc, bacterial leaf streak fungus). Genomic DNA was extracted from each pathogen (concentration uniformly 10 ng / μL) and used as a template for RAA-CRISPR / LbCas12a detection. Figure 5 As shown in E and 5F, only the Xoo template produced a strong fluorescence signal, while the signals of the other pathogens and the negative control (ddH2O) showed no statistical difference (P > 0.05), demonstrating that the method has extremely high specificity.

[0065] Example 6

[0066] Field sample testing and LFS application:

[0067] Forty-six rice samples exhibiting suspected bacterial blight symptoms were collected from six cities in Anhui Province (Anqing, Chizhou, Tongling, Wuhu, Ma'anshan, and Xuancheng). DNA from all 46 samples was analyzed using an optimized RAA-CRISPR / LbCas12a platform. Simultaneously, conventional PCR was performed using specific primers designed for the XooGtf1 gene (GSPP-F: 5'-ATCATGCCGCCCACATT-3'; GSPP-R: 5'-ACGCATGACGCACTCC-3') as the "gold standard" for comparison. Results are as follows: Figure 6 As shown in A and 6B, this method detected 22 positive samples and 24 negative samples, which is completely consistent with the PCR results. Figure 6 C), the diagnostic sensitivity and specificity are both 100%.

[0068] To verify its field application capability, the aforementioned 22 positive samples and 5 randomly selected negative samples were used for LFS detection using a FAM-Biotin-labeled hairpin probe. The 20 μL CRISPR reaction system consisted of: 2 μL 10× SuperBuffer 1.0, 1 μL LbCas12a (1 μM), 1 μL crRNA3 (2 μM), 2.5 μL FAM-Biotin hairpin probe (100 nM), 1 μL RNasin inhibitor, 2 μL RAA product, and 10.5 μL ddH2O. After reacting at 37℃ for 10 minutes, 50 μL of the reaction solution was pipetted into the sample application area of ​​the Worbio (Nanjing Wobo) LFS test strip. The results were interpreted after 5 minutes. Figure 6 As shown in D and 6E, all 22 positive samples showed clear red bands on the test line (T line) and control line (C line), while the negative samples only showed the C line. The results were completely consistent with those of the fluorescence method and PCR method.

[0069] The above description is merely a preferred embodiment of the present invention and is illustrative rather than restrictive. Those skilled in the art will understand that many changes, modifications, and even equivalents can be made within the spirit and scope defined by the claims of the present invention, all of which will fall within the protection scope of the present invention.

Claims

1. A hairpin probe assembly for enhancing CRISPR / LbCas12a, characterized in that, The device includes a hairpin probe Hairpin-FQ for fluorescence visualization detection and a hairpin probe Hairpin-FB for lateral flow chromatography test strip detection, a RAA primer pair designed based on Xogt1, and crRNA. The nucleotide sequence of the hairpin probe Hairpin-FQ is shown in SEQ ID NO.2, and the nucleotide sequence of the hairpin probe Hairpin-FB is shown in SEQ ID NO.

3.

2. The hairpin probe assembly for enhancing CRISPR / LbCas12a as described in claim 1, characterized in that, The hairpin probe Hairpin-FQ has a fluorescent reporter group 6-FAM at its 5' end and a fluorescent quencher group BHQ1 at its 3' end; the hairpin probe Hairpin-FB has a fluorescent reporter group 6-FAM at its 5' end and a biotin group Biotin at its 3' end.

3. The hairpin probe assembly for enhancing CRISPR / LbCas12a as described in claim 1, characterized in that, Xogt1 is the glycosyltransferase-1 encoding gene specifically present in *Bacillus oryzae*, the causal agent of rice bacterial blight, and its nucleotide sequence is shown in SEQ ID NO.

1. The RAA primer pair designed based on Xogt1 is any one of primer pair 1, primer pair 2, or primer pair 3 targeting *Bacillus oryzae*. The first primer pair includes an upstream primer Xoo-F1, whose nucleotide sequence is shown in SEQ ID NO.4, and a downstream primer Xoo-R1, whose nucleotide sequence is shown in SEQ ID NO.

5. The primer pair 2 includes an upstream primer Xoo-F2, the nucleotide sequence of which is shown in SEQ ID NO.6, and a downstream primer Xoo-R2, the nucleotide sequence of which is shown in SEQ ID NO.7; The primer pair 3 includes an upstream primer Xoo-F3, whose nucleotide sequence is shown in SEQ ID NO.8, and a downstream primer Xoo-R4, whose nucleotide sequence is shown in SEQ ID NO.

9.

4. The hairpin probe assembly for enhancing CRISPR / LbCas12a as described in claim 1, characterized in that, The crRNA is any one of crRNA1, crRNA2, and crRNA3, the nucleotide sequence of crRNA1 is shown in SEQ ID NO.10, the nucleotide sequence of crRNA2 is shown in SEQ ID NO.11, and the nucleotide sequence of crRNA3 is shown in SEQ ID NO.

12.

5. A test kit, characterized in that, It includes two independent reaction systems: a RAA amplification reaction system and a CRISPR / LbCas12a detection reaction system. The RAA amplification reaction system includes RAA primer pairs designed based on Xogt1, Buffer V, template DNA, lyophilized enzyme powder, and Mg(OAc)2. The CRISPR / LbCas12a detection reaction system includes the hairpin probe combination as described above, reaction buffer, LbCas12a enzyme, crRNA, RNase inhibitor, and RAA reaction product.

6. The detection kit as described in claim 5, characterized in that, The reaction buffer is 10×SuperBuffer 1.0, and its composition is: 100 mM KCl, 20 mM Tris-HCl, 10 mM MgCl2, 1 mM MTT, pH 8.5, and reaction temperature 25℃.

7. The detection kit as described in claim 5, characterized in that, The total volume of the RAA amplification reaction system is 50 μL, including: 2 μL 10 μM forward primer, 2 μL 10 μM reverse primer, 25 μL Buffer V, 14 μL ddH2O, 2 μL template DNA, and lyophilized enzyme powder. 5 μL 50 mM Mg(OAc)2 is added at the start of the reaction. The total volume of the CRISPR / LbCas12a detection reaction system is 50 μL, including: 5 μL reaction buffer, 2 μL 1 μM LbCas12a enzyme, 1 μL 2 μM crRNA sequence combination, 2 μL 10 μM hairpin probe combination, 1 μL 40 U / μL RNase inhibitor, 2 μL LAA reaction product, and ddH2O to bring the total volume to 50 μL.

8. The application of an enhanced CRISPR / LbCas12a hairpin probe assembly in the rapid detection of rice bacterial blight pathogen, characterized in that, The method for rapid detection of rice bacterial blight pathogen using the kit described in any one of claims 5 to 7 includes the following steps: S1, Extract genomic DNA from the rice sample to be tested; S2, using the DNA obtained in step S1 as a template, react at 37°C for 15 minutes in the RAA amplification reaction system of the kit to obtain the RAA product; S3. Add the RAA product obtained in step S2 to the CRISPR / LbCas12a detection reaction system and react at 37°C for 10 minutes. Then interpret the results.

9. The application of the enhanced CRISPR / LbCas12a hairpin probe assembly as described in claim 8 in the rapid detection of rice bacterial blight pathogen, characterized in that, In step S1, the specific process of extracting genomic DNA from the rice sample to be tested is as follows: take the diseased leaves of the sample to be tested, cut them into pieces and place them in a centrifuge tube, add 0.5 M NaOH solution to grind them, let them stand at room temperature for 1 min, and use them as templates after dilution with TE Buffer.

10. The application of the enhanced CRISPR / LbCas12a hairpin probe assembly as described in claim 8 in the rapid detection of rice bacterial blight pathogen, characterized in that, In step S3, the result interpretation method is as follows: observe the green fluorescence by holding a UV lamp, or use a side-flow chromatography test strip for visual reading. If green fluorescence appears or both the test line and the control line appear on the test strip, it is judged as positive. If no green fluorescence appears or the test line and control line do not appear simultaneously on the test strip, the result is considered negative.

Images