Multiplex taqman fluorescent quantitative PCR primer and probe composition, use and pathogenic bacteria detection method

Abstract

The application discloses a multiplex TaqMan fluorescent quantitative PCR primer and probe composition, application and detection method of pathogenic bacteria. The multiplex TaqMan fluorescent quantitative PCR primer and probe composition of the application comprises composition I, composition II and composition III; wherein the composition I is composed of an upstream primer nuc -F, a downstream primer nuc -R and a probe nuc -P; the composition II is composed of an upstream primer oprL -F, a downstream primer oprL -R and a probe oprL -P; and the composition III is composed of an upstream primer rpoD -F, a downstream primer rpoD -R and a probe rpoD -P. The multiplex TaqMan fluorescent quantitative PCR primer and probe composition of the application has high specificity, sensitivity and anti-interference capability.

Description

Technical Field

[0001] This invention relates to a multiplex TaqMan real-time PCR primer and probe composition, its uses, and a method for detecting pathogenic bacteria. Background Technology

[0002] With the rapid development of the cosmetics industry, risk assessment-based microbial quality control strategies are constantly being improved. In the field of cosmetics testing, Staphylococcus aureus (Staphylococcus aureus) is a key microbial contaminant. Staphylococcus aureus ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) are mandatory pathogenic microorganisms for testing in cosmetics. Meanwhile, Burkholderia cepacia (… Burkholderia cepacia Bcc complexes can survive in nutrient-poor environments, have inherent resistance to disinfectants and antibiotics, and are prone to causing infection in immunocompromised individuals. They are also receiving increasing attention in the field of cosmetic testing.

[0003] In existing testing standards for cosmetics, the detection of Burkholderia cepacia uses traditional isolation and culture methods and digital PCR. However, routine detection of pathogens in cosmetics still relies on traditional isolation and culture methods, which are time-consuming, have low throughput, are easily affected by antibacterial components, and require separate detection of three different bacteria, making them time-consuming and labor-intensive. While digital PCR offers high sensitivity, its high cost and complex operation make it difficult to meet the urgent need for low-cost and simple detection in modern cosmetics. Therefore, there is an urgent need to develop a new screening technology that can simultaneously detect multiple pathogens in cosmetics and offers both detection efficiency and cost advantages.

[0004] CN119162353A discloses a quadruple Taqman qPCR reagent for detecting foodborne pathogens in aquatic products. This quadruple Taqman qPCR reagent includes specific primers and Taqman probes for four foodborne pathogens: Vibrio parahaemolyticus, Vibrio vulnificus, Shigella, and Staphylococcus aureus, and features high efficiency, accuracy, sensitivity, and speed. However, this quadruple Taqman qPCR reagent is intended for the quality and safety testing of aquatic products and their processed products, and does not cover the detection of specific pathogens in cosmetics, nor does it cover the detection of Pseudomonas aeruginosa and Burkholderia cepacia.

[0005] CN119842942A discloses a method for real-time fluorescence PCR detection of Staphylococcus aureus. This method involves using TaqMan qPCR to detect Staphylococcus aureus from animal sources. This method does not involve the detection of specific pathogens in cosmetics, nor does it involve the simultaneous detection of Pseudomonas aeruginosa and Burkholderia cepacia. Summary of the Invention

[0006] In view of this, one object of the present invention is to provide a multiplex TaqMan real-time PCR primer and probe composition that can simultaneously and rapidly detect Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia, exhibiting high specificity, sensitivity, and anti-interference ability. Another object of the present invention is to provide the uses of the above-mentioned primer and probe composition. A further object of the present invention is to provide a method for detecting pathogenic bacteria.

[0007] The present invention achieves the above objectives using the following technical solutions.

[0008] On one hand, the present invention provides a multiplex TaqMan real-time PCR primer and probe composition, comprising composition I, composition II, and composition III; wherein, The composition I is derived from the upstream primer. nuc -F, downstream primer nuc -R and probe nuc -P composition; the upstream primer nuc The nucleotide sequence of -F is shown in SEQ ID No. 1, and the downstream primer... nuc The nucleotide sequence of -R is shown in SEQ ID No. 2, and the probe... nuc The nucleotide sequence of -P is shown in SEQ ID No. 3; Composition II is derived from the upstream primer. oprL -F, downstream primer oprL -R and probe oprL -P composition; the upstream primer oprL The nucleotide sequence of -F is shown in SEQ ID No. 4, and the downstream primer... oprL The nucleotide sequence of -R is shown in SEQ ID No. 5, and the probe... oprL The nucleotide sequence of -P is shown in SEQ ID No. 6; Composition III is derived from the upstream primer. rpoD -F, downstream primer rpoD -R and probe rpoD -P composition; the upstream primer rpoD The nucleotide sequence of -F is shown in SEQ ID No. 7, and the downstream primer... rpoD The nucleotide sequence of -R is shown in SEQ ID No. 8, and the probe... rpoD The nucleotide sequence of -P is shown in SEQ ID No. 9.

[0009] According to the primer and probe composition of the present invention, preferably, the probe... nuc -P, probe oprL -P and probe rpoD The nucleotide sequence of -P is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end.

[0010] According to the primer and probe composition of the present invention, preferably, the fluorescent reporter group is selected from at least one of VIC, FAM, Cy5, TET, JOE, HEX and Texas Red; and the fluorescent quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, QSY7, QSY21, IBFQ and IBRQ.

[0011] According to the primer and probe composition of the present invention, preferably, the fluorescent reporter group is selected from at least one of VIC, FAM, Cy5, TET, JOE and HEX; and the fluorescent quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, QSY7 and QSY21.

[0012] On the other hand, the present invention also provides the use of any of the above-described primer and probe compositions in the preparation of bacterial detection products.

[0013] According to the intended use described in this invention, preferably, the bacterial detection product is a bacterial detection kit.

[0014] The present invention also provides a multiplex TaqMan real-time PCR kit for bacterial detection, comprising any of the primer and probe compositions described above. Furthermore, the present invention also provides a method for detecting pathogenic bacteria, comprising the following steps: 1) Extract genomic DNA from pathogenic bacteria in the sample to be tested; 2) Using the genomic DNA of the pathogenic bacteria as a template, and employing the primer and probe composition described in any one of claims 1 to 4, multiplex TaqMan quantitative PCR amplification is performed, and fluorescence signals are collected during the extension phase to achieve the detection of the pathogenic bacteria; wherein, the reaction system for the TaqMan quantitative PCR amplification includes: The total volume of the reaction system is 20–50 μL; the amount of 2× premixed buffer added is 10–13 μL, the amount of Taq enzyme added is 0.05–0.2 μL, the amount of upstream and downstream primers added is 0.2–1 μL, the amount of probe added is 0.1–0.5 μL, and the amount of template added is 1–5 μL.

[0015] According to the detection method of the present invention, preferably, in step 2), the procedure for multiplex TaqMan quantitative PCR amplification includes the following steps: A) Treat with UNG enzyme at 35–40℃ for 1–10 min; B) Pre-denaturate at 94–98℃ for 1–5 min; C) Perform 25 to 45 cycles; each cycle includes, in sequence: denaturation at 94 to 98°C for 5 to 15 seconds, annealing and extension at 50 to 60°C for 10 to 20 seconds.

[0016] According to the detection method of the present invention, preferably, the sample to be tested is a cosmetic; the pathogenic bacteria are selected from at least one of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia. The reaction system for the multiplex TaqMan quantitative PCR amplification includes: The total volume of the reaction system is 20–30 μL; the amount of 2× premixed buffer added is 11–12.8 μL, the amount of Taq enzyme added is 0.08–0.15 μL, the amount of upstream and downstream primers added is 0.3–0.8 μL, the amount of probe added is 0.15–0.4 μL, and the amount of template added is 2–4 μL.

[0017] The multiplex TaqMan quantitative PCR primer and probe composition of this invention exhibits high specificity, sensitivity, and anti-interference ability. When combined with a quantitative PCR amplification reaction system, it allows for the simultaneous and rapid detection of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia in test samples, especially cosmetics. Attached Figure Description

[0019] Figure 1 The image shows the fluorescence signal of the quantitative PCR in Experiment Example 2; where a represents Staphylococcus aureus, b represents Pseudomonas aeruginosa, c represents Burkholderia cepacia, and dj represents d, e, f, g, h, i, and j, where d represents Salmonella paratyphi B, e represents Escherichia coli, f represents Staphylococcus epidermidis, g represents Roldstone's piracetam, h represents Klebsiella pneumoniae, i represents Cronobacter malonic acid, and j represents the blank control; due to the high overlap of the curves of dj, they are not all marked in the figure, which does not affect the conclusion of this invention.

[0020] Figure 2 This is a fluorescence signal diagram of quantitative real-time PCR for Staphylococcus aureus in Experiment Example 3.

[0021] Figure 3 This is a fluorescence signal diagram of quantitative real-time PCR for Pseudomonas aeruginosa in Experiment Example 3.

[0022] Figure 4 This is a fluorescence signal diagram of Burkholderia cepacia in Experiment Example 3, obtained through real-time quantitative PCR. Detailed Implementation

[0023] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0024] ​​ <Primer and Probe Composition> This invention provides a multiplex TaqMan real-time PCR primer and probe composition, comprising composition I, composition II and composition III.

[0025] According to one embodiment of the present invention, composition I is composed of an upstream primer. nuc -F, downstream primer nuc -R and probe nuc -P composition. Upstream primer nuc The nucleotide sequence of -F is shown in SEQ ID No. 1, and the downstream primer... nuc The nucleotide sequence of -R is shown in SEQ ID No. 2. The probe... nuc The nucleotide sequence of -P is shown in SEQ ID No. 3.

[0026] In this invention, SEQ ID No. 1 is GGTTCTGAAGATCCAACAG, SEQ ID No. 2 is GGTGTATCAACTAATAATAGTCTGAA, and SEQ ID No. 3 is AACCGTATCACCATCAATCGCTT.

[0027] According to one embodiment of the present invention, composition II is derived from the upstream primer. oprL -F, downstream primer oprL -R and probe oprL -P composition. Upstream primer oprL The nucleotide sequence of -F is shown in SEQ ID No. 4, and the downstream primer... oprL The nucleotide sequence of -R is shown in SEQ ID No. 5. The probe... oprL The nucleotide sequence of -P is shown in SEQ ID No. 6.

[0028] In this invention, SEQ ID No. 4 is GCGATCACCACCTTCTAC, SEQ ID No. 5 is TGCCTTTCAAGTCTTTCG, and SEQ ID No. 6 is CGAGTACGACAGCTCCGACCTG.

[0029] According to one embodiment of the present invention, composition III is derived from the upstream primer. rpoD -F, downstream primer rpoD -R and probe rpoD -P composition. Upstream primer rpoD The nucleotide sequence of -F is shown in SEQ ID No. 7, and the downstream primer... rpoD The nucleotide sequence of -R is shown in SEQ ID No. 8. The probe... rpoD The nucleotide sequence of -P is shown in SEQ ID No. 9.

[0030] In this invention, SEQ ID No. 7 is GTTCAACCGGCTGTCGTCC, SEQ ID No. 8 is TCGCTCTGATTTGCGTCGTC, and SEQ ID No. 9 is AGCCGGTACGGCGAACTCCATGAC.

[0031] According to one embodiment of the present invention, the probe nuc -P, probe oprL -P and probe rpoD The nucleotide sequence of -P is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end.

[0032] According to one embodiment of the present invention, preferably, the fluorescent reporter group may be selected from at least one of VIC (2'-chloro-7'-phenyl-1,4-dichloro-6-carboxyfluorescein), FAM (carboxyfluorescein), Cy5 (anthocyanin 5'), TET (tetrachloro-6-carboxyfluorescein), JOE (carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein'), HEX (hexachlorofluorescein), and Texas Red, preferably selected from at least one of VIC, FAM, Cy5, TET, JOE, and HEX, and more preferably selected from at least one of VIC, FAM, and Cy5.

[0033] The fluorescence quenching group may be selected from at least one of BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), QSY7 (dark quencher QSY7), QSY21 (dark quencher QSY7)), IBFQ (Iowa Black FQ) and IBRQ (Iowa Black RQ), preferably selected from at least one of BHQ1, BHQ2, BHQ3, QSY7 and QSY21, and more preferably selected from at least one of BHQ1, BHQ2 and BHQ3.

[0034] According to a preferred embodiment of the present invention, the nucleotide sequence of probe nuc-P is labeled with VIC at the 5' end and BHQ1 at the 3' end. The nucleotide sequence of probe oprL-P is labeled with FAM at the 5' end and BHQ1 at the 3' end. The nucleotide sequence of probe rpoD-P is labeled with Cy5 at the 5' end and BHQ2 at the 3' end.

[0035] This invention targets conserved genes in Staphylococcus aureus. nuc (Thermonuclease gene), conserved genes of Pseudomonas aeruginosa oprL (Outer membrane lipoprotein L gene) and protective genes of Burkholderia cepacia rpoD Specific primers and probes were designed for the RNA polymerase σ70 factor gene. This invention reveals that such primer and probe combinations can achieve multiplex TaqMan quantitative PCR detection of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia, exhibiting high specificity, high sensitivity, good repeatability, and strong anti-interference ability.

[0036] The multiplex TaqMan real-time PCR primer and probe compositions of the present invention can be designed and screened using any gene database, gene alignment tool, and primer and probe design tool known in the art, without particular limitation. For example, GenBank database, EMBL-EBI database, NGDC database, BLAST tool, Clustal Omega tool, BioEdit tool, MegAlign software, Primer Express software, Primer-BLAST tool, PrimerPremier software, Oligo software, etc. can be used, preferably GenBank database, BLAST tool, MegAlign software, Primer-BLAST tool, and PrimerExpress software.

[0037] <Uses and Kits for Primer and Probe Combinations> The present invention also provides the use of the above primer and probe composition in the preparation of bacterial detection products.

[0038] According to one embodiment of the present invention, the bacterial detection product may be selected from products used for at least one of the following purposes: (a) Identification or auxiliary identification of at least one of Staphylococcus aureus, Pseudomonas aeruginosa and Burkholderia cepacia; (b) To detect or assist in the detection of whether the sample contains at least one of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia.

[0039] In this invention, the bacterial detection product can be any type of product known in the art for bacterial detection, and no particular limitation is made here. According to a preferred embodiment of the invention, the bacterial detection product can be a bacterial detection kit.

[0040] The present invention also provides a multiplex TaqMan real-time PCR kit for bacterial detection, which may include the above-described primer and probe composition.

[0041] According to one embodiment of the present invention, the multiplex TaqMan real-time PCR kit may also include other components required for the kit as known in the art, which will not be described in detail here.

[0042] According to one embodiment of the present invention, the bacteria used for detection may be selected from at least one of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia, preferably Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia.

[0043] According to one embodiment of the present invention, using a Ct value ≤ 35 as a positive criterion, the sensitivity of the primer and probe composition of the present invention can be 10. 2 Copy number / μL or less, preferably 10 1.5 Copy number / μL or less, more preferably 10 1 Copy number below 10 ...

[0044] According to one embodiment of the present invention, the primer and probe composition of the present invention is in 10 5 Copy number / μL, 10 4 Copy number / μL, 10 3 Copy number / μL, 10 2 Copy number / μL and 10 1 In repeatability tests across five concentration ranges with copy number / μL, the intra-assay coefficient of variation (IVC) can be 1.8% or less, preferably 1.75% or less, more preferably 1.7% or less; the inter-assay coefficient of variation (IVC) can be 2.3% or less, preferably 2.2% or less, more preferably 2.15% or less. According to a preferred embodiment of the invention, the number of replicates in the repeatability test can be 2 to 6, preferably 2 to 5, more preferably 3 to 5.

[0045] <Detection Methods for Pathogenic Bacteria> This invention also provides a method for detecting pathogenic bacteria, including a step of extracting genomic DNA and a step of TaqMan quantitative PCR amplification. This is described in detail below.

[0046] Steps for extracting genomic DNA Genomic DNA of pathogenic bacteria was extracted from the sample to be tested.

[0047] In this invention, genomic DNA extraction can be achieved using any extraction method and extraction product known in the art, and no particular limitation is made herein. For example, commercially available genomic DNA extraction kits can be used.

[0048] In this invention, the sample to be tested can be of any type, but is preferably a cosmetic. This invention is applicable to various types of cosmetics; specific types of cosmetics are well-known in the art and will not be elaborated upon here.

[0049] According to one embodiment of the present invention, the pathogenic bacteria may be selected from at least one of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia, preferably Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia.

[0050] Multiplex TaqMan Real-Time PCR Amplification Steps Using the genomic DNA of pathogenic bacteria as a template, multiplex TaqMan real-time PCR amplification was performed using the primer and probe combination described above. Fluorescent signals were collected during the extension phase to detect pathogenic bacteria.

[0051] According to one embodiment of the present invention, the reaction system for multiplex TaqMan real-time PCR amplification may include: The total volume of the reaction system can be 20–50 μL, preferably 20–30 μL, and more preferably 20–25 μL. The amount of 2× premixed buffer added can be 10–13 μL, preferably 11–12.8 μL, and more preferably 11.5–12.5 μL. The concentration of Taq enzyme solution before addition can be 1–10 U / μL, preferably 2–8 U / μL, and more preferably 3–6 U / μL; the amount of Taq enzyme solution added can be 0.05–0.2 μL, preferably 0.08–0.15 μL, and more preferably 0.1–0.13 μL. The concentration of both upstream and downstream primers before addition can be 3–18 μM, preferably 4–16 μM, more preferably 5–15 μM, and even more preferably 8–12 μM; the volume of both upstream and downstream primer solutions added can be 0.2–1 μL, preferably 0.3–0.8 μL, and more preferably 0.4–0.65 μL. The concentration of the probe solution before addition can be 6–18 μL, preferably 7–15 μL, and more preferably 8–12 μL; the volume of the probe solution added can be 0.1–0.5 μL, preferably 0.15–0.4 μL, and more preferably 0.2–0.3 μL. The volume of the template solution added can be 1–5 μL, preferably 2–4 μL, and more preferably 2.5–3.5 μL. The remaining volume is made up with water.

[0052] In this invention, the concentration of the template solution is not particularly limited, and the solution obtained from extracting genomic DNA can be used directly as the template solution. According to a preferred embodiment of the invention, the concentration of the template solution before addition can be 5 copies / μL or higher, preferably 10 copies / μL or higher, and more preferably 10¹ to 10¹⁰. 5 Copy / μL.

[0053] In this invention, the water used can be any type of water known in the art that can be used for PCR amplification, and no particular limitation is made here. According to a preferred embodiment of the invention, the water used can be selected from at least one of sterile deionized water and anhydrous double-distilled water (ddH2O).

[0054] According to a preferred embodiment of the present invention, the reaction system for multiplex TaqMan real-time PCR amplification may include: The total volume of the reaction system was 25 μL; the amount of 2× premixed buffer added was 12.5 μL; the concentration of Taq enzyme solution before addition was 5 U / µL; the amount of Taq enzyme solution added was 0.125 μL; the concentration of upstream and downstream primer solutions before addition could be 5–15 nM; the amount of upstream and downstream primer solutions added was 0.5 μL; the concentration of probe solution before addition was 10 nM; the amount of probe solution added was 0.25 μL; the concentration of template solution before addition could be 10 copies / μL; the amount of template solution added was 3 μL; and the remaining volume was made up with ddH2O.

[0055] Limiting the reaction system to the above-mentioned ranges is beneficial for further improving the specificity, sensitivity, and anti-interference ability of the primer and probe combination for the detection of pathogenic bacteria. Exceeding the above-mentioned ranges in the amount of each substance in the reaction system will adversely affect the detection of pathogenic bacteria.

[0056] According to one embodiment of the present invention, the procedure for multiplex TaqMan real-time PCR amplification includes the following steps: A) Treat with UNG enzyme at 35–40℃ for 1–10 min; B) Pre-denaturate at 94–98℃ for 1–5 min; C) Perform 25 to 45 cycles; each cycle includes, in sequence: denaturation at 94 to 98°C for 5 to 15 seconds, annealing and extension at 50 to 60°C for 10 to 20 seconds.

[0057] According to one embodiment of the present invention, in step A), the temperature of the UNG enzyme (uracil-N-glycosylation enzyme) treatment can be 35-40°C, preferably 36-39°C, more preferably 37-38°C. The treatment time can be 1-10 min, preferably 3-7 min, more preferably 4-6 min.

[0058] According to one embodiment of the present invention, in step B), the pre-denaturation temperature can be 94–98°C, preferably 95–97°C, and more preferably 95–96°C. The pre-denaturation time can be 1–5 min, preferably 1–4 min, and more preferably 2–4 min.

[0059] In this invention, the number of cycles for quantitative real-time PCR can be 25 to 45, preferably 30 to 45, and more preferably 40 to 45.

[0060] According to one embodiment of the present invention, in each cycle of step C), the denaturation temperature can be 94–98°C, preferably 95–97°C, more preferably 95–96°C. The denaturation time can be 5–15 s, preferably 8–13 s, more preferably 9–12 s. The annealing and extending temperature can be 50–60°C, preferably 52–58°C, more preferably 55–57°C. The annealing and extending time can be 10–20 s, preferably 12–18 s, more preferably 13–16 s.

[0061] In this step, the specific details of the primer and probe composition are the same as those described above, and will not be repeated here.

[0062] Reasonable program parameters for multiplex TaqMan real-time PCR amplification can help improve the specificity, sensitivity, and anti-interference ability of primer and probe combinations for the detection of pathogenic bacteria.

[0063] According to a preferred embodiment of the present invention, the detection method of the present invention can detect Staphylococcus aureus and Pseudomonas aeruginosa in a maximum of 12 hours of incubation; and can detect Burkholderia cepacia in a maximum of 48 hours of incubation, which significantly shortens the detection time and improves the accuracy.

[0064] <Raw Material Description> Unless otherwise specified, all raw materials used in the following examples are commercially available products.

[0065] The sources of the nine standard strains used are as follows: Staphylococcus aureus CMCC(B)26003 ( Staphylococcus aureus Pseudomonas aeruginosa CMCC(B)10104 ( Pseudomonas aeruginosa Burkholderia cepacia CMCC(B)23005 Burkholderia cepacia Salmonella paratyphi B CMCC(B) 50094 Salmonella paratyphi B ), Escherichia coli CMCC(B)44102 ( Escherichia coli ) and Staphylococcus epidermidis CMCC(B) 26069 ( Staphylococcus epidermidis Purchased from the China National Institutes for Food and Drug Control.

[0066] Roldstonella pylori ( Ralstonia pickettii ), Klebsiella pneumoniae ( Klebsiella pneumoniae ) and Cronobacter malonic acid ( Cronobacter malonaticus The samples were collected and cultured independently by the Fujian Provincial Institute for Food and Drug Control.

[0067] The main sources of reagents and culture media are as follows: The bacterial genomic DNA extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0068] All qPCR reaction reagents were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.

[0069] Tryptic soybean peptone liquid medium (TSB) was purchased from Beijing Sanyao Technology Co., Ltd.

[0070] SCDLP liquid culture medium was purchased from Guangdong Huankai Microbial Technology Co., Ltd.

[0071] pUC57 plasmid was purchased from Shanghai Sangon Biotech Co., Ltd.

[0072] The main instruments are as follows: The SLAN-96P real-time fluorescence quantitative PCR instrument was purchased from Shanghai Hongshi Medical Technology Co., Ltd.

[0073] Example 1 1. Primer and probe composition According to General Chapter 1109 of Part IV of the 2025 edition of the Chinese Pharmacopoeia, 25 representative strains of Burkholderia cepacia (Bcc) were identified, and conserved genes of Staphylococcus aureus were downloaded from GenBank. nuc Sequence, conserved genes of Pseudomonas aeruginosa oprL Sequences and conserved genes of 25 Burkholderia strains of onion rpoD The sequences and gene information are shown in Table 1. Multiple sequence alignment was performed using MegAlign software to screen for highly conserved regions in each gene. Subsequently, PrimerExpress 3.01 software was used to design specific primers and TaqMan probes for these regions; the specific sequences are shown in Table 2. All primers and probes were synthesized by Shanghai Sangon Biotech Co., Ltd., forming the corresponding primer and probe compositions.

[0074] Table 1

[0075] Table 2

[0076] Note: F represents the upstream primer; R represents the downstream primer; P represents the probe.

[0077] 2. Detection of pathogenic bacteria The method for detecting pathogenic bacteria using the primer and probe combinations in Table 1 includes the following steps: 1) Genomic DNA of pathogenic bacteria in the test samples was extracted using a genomic DNA extraction kit; 2) Using the genomic DNA of pathogenic bacteria as a template, and employing the primer and probe combinations in Table 1, perform multiplex TaqMan real-time PCR amplification under the following conditions. Collect fluorescence signals during the extension phase to detect pathogenic bacteria. The reaction system for multiplex TaqMan real-time PCR amplification included: a total reaction volume of 25 μL; 12.5 μL of 2× premixed buffer; 0.125 μL of Taq enzyme (5 U / µL); 0.5 μL each of forward and reverse primers (10 μM); 0.25 μL of probe (10 μM); 3 μL of template (10 copies / μL); and ddH2O to a final volume of 25 μL. The amplification program was as follows: UNG enzyme treatment at 37℃ for 5 min; pre-denaturation at 95℃ for 2 min; followed by 45 cycles, each cycle consisting of denaturation at 95℃ for 10 s and annealing and extension at 56℃ for 15 s.

[0078] Examples 2-3 The only difference from Example 1 is the primer concentration, as shown in Table 3 below.

[0079] Comparative Examples 1-12 The only difference from Example 1 is that the primer concentration and / or probe concentration are different, as shown in Table 3 below.

[0080] Table 3

[0081] Experimental Example 1 Conserved genes of artificially synthesized Staphylococcus aureus were separately nuc Sequence, conserved genes of Pseudomonas aeruginosa oprL Sequence and conserved genes of Burkholderia cepacia rpoD The sequences were ligated into the pUC57 plasmid to construct three recombinant plasmids containing specific fragments of each target bacterium. The recombinant plasmids were serially diluted 10-fold with sterile water. The three conserved gene sequences are shown in Table 4.

[0082] Table 4

[0083] The three diluted recombinant plasmids were mixed in equal amounts as templates, and TaqMan qPCR amplification was performed in a 25 μL reaction system using the methods of Examples 1-3 and Comparative Examples 1-12, respectively. The Ct values ​​of the amplification results are shown in Tables 5-7 below.

[0084] Table 5 rpoD Ct value

[0085] Note: Each group has 3 parallels (n=3), and the results are expressed as mean ± standard deviation of Ct.

[0086] Table 6 nuc Ct value

[0087] Note: Same as Table 5 above.

[0088] Table 7 oprL Ct value

[0089] Note: Same as Table 5 above.

[0090] As shown in Tables 5-7, Examples 1-3 have lower Ct values, indicating higher sensitivity of TaqMan qPCR amplification.

[0091] Experiment Example 2 Specificity tests were performed on the primer and probe combinations and the multiplex TaqMan real-time PCR system, including the following steps: 1) Staphylococcus aureus, Pseudomonas aeruginosa, Burkholderia cepacia, Salmonella paratyphi B, Escherichia coli, Staphylococcus epidermidis, Ralstonia pinnatifida, Klebsiella pneumoniae, and Cronobacter malondioxymics were inoculated into TSB medium and cultured at 33°C for 24 h. 1 mL of the culture medium was taken, and genomic DNA of each bacterium was extracted using a bacterial genomic DNA extraction kit. The extracted genomic DNA was then labeled as group a, group b, group c, group d, group e, group f, group g, group h, and group i.

[0092] 2) Mix the bacterial genomic DNA from each group in step 1) to obtain mixed genomic DNA. Using the mixed genomic DNA as a template, detect the pathogenic bacteria using the detection method in Example 1. At the same time, set up a blank control group without template, denoted as group j.

[0093] Test results as follows Figure 1 As shown. By Figure 1 It was found that the three target bacteria (Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia) all showed good specific amplification curves, while the other six non-target bacteria and the blank control did not show obvious fluorescence signals. This indicates that the primer and probe composition of the present invention has good specificity, can accurately distinguish target bacteria in multiplex reactions, and has no cross-reactivity.

[0094] Experimental Example 3 Multiplex qPCR amplification was performed on each dilution of plasmid from Experiment 1 according to the pathogen detection method in Example 1 (using different cycle numbers). A standard curve was plotted with the logarithm of plasmid copy number concentration as the x-axis (X) and the corresponding cycle threshold (Ct value) as the y-axis (Y), and linear regression analysis was performed.

[0095] Standard curve analysis showed that the standard curve equation for Staphylococcus aureus was Y = -3.449X + 36.309, with a correlation coefficient R0. 2 =0.999, amplification efficiency of 94.97%; the standard curve equation for Pseudomonas aeruginosa is Y=-3.636X+36.599, R 2 =0.999, amplification efficiency of 88.37%; the standard curve equation for Burkholderia cepacia is Y = -3.612X + 37.132, R 2 =0.999, amplification efficiency of 89.19%. RA values ​​for the three standard curves. 2 The values ​​are all equal to 0.999, indicating a good linear relationship between the logarithmic value of plasmid copy number and the Ct value.

[0096] The fluorescence signal of qPCR (quantitative real-time PCR) amplification of the target gene is as follows: Figures 2-4 As shown. By Figures 2-4 It can be seen that, with a Ct value ≤ 35 as the criterion for a positive result, the detection sensitivity of this invention for the three target bacteria all reaches 10. 1 With a copy number per μL, it exhibits high sensitivity.

[0097] Experiment Example 4 The three recombinant plasmids from Experiment 1 were prepared to a concentration of 10. 5 Copy number / μL, 10 4 Copy number / μL, 10 3 Copy number / μL, 10 2 Copy number / μL and 10 1 Template at a copy number / μL was used for multiplex qPCR amplification according to the pathogen detection method in Example 1. Three replicates (n=3) were set up for each concentration both intra-batch and inter-batch. Intra-batch and inter-batch coefficients of variation were calculated, with inter-batch replicates performed every other day. SPSS 23.0 software was used for statistical analysis of the experimental data. The results are shown in Tables 8 and 9.

[0098] Table 8. Intra-batch repeatability of multiplex qPCR

[0099] Note: Ct is the cyclic threshold, and CV is the coefficient of variation.

[0100] Table 9. Inter-batch repeatability of multiplex qPCR

[0101] Note: Same as Table 8 above.

[0102] As shown in Tables 8 and 9, within the five plasmid concentration ranges, the intra-batch coefficient of variation ranged from 0.02% to 1.69% (all less than 5%), and the inter-batch coefficient of variation ranged from 0.25% to 2.13% (all less than 15%), indicating that the primer and probe compositions and detection methods of the present invention have good repeatability and stability.

[0103] Experimental Example 5 Artificial contamination sample detection test 5.1 Test Methods 5.1.1 Preparation and Detection Methods of Samples to be Tested Preparation of test samples: Six cosmetic samples were selected and divided into two major groups and six subgroups according to their antibacterial properties: Group A, Group B, and Group C were the non-antibacterial group (the samples in Group A, Group B, and Group C were respectively Poya Chamomile Hydrosol, Kiehl's New Calendula Soothing Moisturizing Mask, and L'Oréal Paris Strengthening and Smoothing Shampoo); Group D, Group E, and Group F were the antibacterial group (the samples in Group D, Group E, and Group F were respectively Yihanlan Brightening Seaweed Mask, EKONO Lightweight Oil Control Shampoo, and Chaojiang Anti-Dandruff Smoothing Shampoo). Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia were inoculated into the different products mentioned above, with the concentration of each bacterium in the product not exceeding 100 CFU / g or 100 CFU / mL (viable bacteria were counted simultaneously in the inoculated bacterial solution, and the actual concentrations of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia were 54, 56, and 53 CFU / g or CFU / mL, respectively), to obtain the test sample.

[0104] Weigh 10g of the sample to be tested, add 90mL of physiological saline, mix well, and prepare a 1:10 test solution. Take 10mL of the 1:10 test solution and inoculate it into 100mL of SCDLP liquid medium, then incubate at 36℃; Staphylococcus aureus and Pseudomonas aeruginosa are incubated for 24h, and Burkholderia cepacia are incubated for 72h to obtain enrichment broth.

[0105] After the culture is completed, pathogenic bacteria are detected using the following two methods: 5.1.1.1 Detection using traditional culture methods: Staphylococcus aureus and Pseudomonas aeruginosa were detected according to the "Cosmetic Safety Technical Specifications (2015 Edition)". Enrichment broth was streaked onto the appropriate selective plates for separation and detection. Burkholderia cepacia were detected according to General Chapter 1109 of Part IV of the "Chinese Pharmacopoeia (2025 Edition)". Enrichment broth was streaked onto BCCAS plates for separation and detection.

[0106] 5.1.1.2 qPCR detection: Take 1 mL of enrichment broth and extract genomic DNA using a bacterial genomic DNA extraction kit as a DNA template. The DNA template will then be used for multiplex qPCR detection according to the pathogen detection method described in Example 1.

[0107] 5.1.2 Early Warning Capability Assessment For the non-inhibitory samples in groups A, B, and C of section 4.1.1, parallel sampling was conducted at two time points during the enrichment process: for Staphylococcus aureus and Pseudomonas aeruginosa with a specified incubation time of 24 hours, sampling was performed at 12 hours (half-cycle) and 24 hours (standard endpoint). For Burkholderia cepacia with a specified incubation time of 72 hours, sampling was performed at 24 hours (early point) and 72 hours (standard endpoint). After sampling, the samples were tested according to the method in section 4.1.1.

[0108] 5.1.3 Evaluation of antibacterial elimination treatment and anti-interference ability For the antibacterial samples in groups D, E, and F, untreated and treated groups were set up for comparison. Samples in group D were treated using a dilution method, increasing the enrichment volume to 200 mL. Samples in groups E and F were treated using a combination of dilution and neutralization, increasing the enrichment volume to 500 mL, and adding 3 wt% Tween 80, 0.3 wt% soybean lecithin, and 0.1 wt% histidine to eliminate antibacterial activity. Other culture and detection methods were performed according to the method in 4.1.1.

[0109] 5.1.4 Data Statistics SPSS 23.0 software was used for statistical analysis of the experimental data. 5.2 Test Results 5.2.1 Early Warning Capability Assessment Results The results are shown in Table 10. As can be seen from Table 10, in the non-antibacterial samples (Groups A, B, and C), when cultured to the standard endpoint, the detection rate of the present invention (denoted as qPCR) was completely consistent with that of the traditional culture method, verifying the accuracy of the present invention. At the early enrichment monitoring point, the qPCR method showed a significant time advantage: for Staphylococcus aureus and Pseudomonas aeruginosa with a specified growth period of 24 hours, the qPCR method achieved complete detection within 12 hours, while the traditional culture method showed varying degrees of missed detection at this time. For Burkholderia cepacia with a specified growth period of 72 hours, the qPCR method achieved complete detection within 24 hours, while the traditional culture method still did not completely detect it at this time. The present invention shortens the detection period for Staphylococcus aureus and Pseudomonas aeruginosa by 12 hours and the detection period for Burkholderia cepacia by 48 hours. The above results indicate that the present invention has good early warning capabilities.

[0110] Table 10

[0111] 5.2.2 Results of Antibacterial Elimination Treatment and Anti-interference Ability Assessment The results are shown in Table 11. As can be seen from Table 11, in the antibacterial samples, the detection rate of the traditional culture method was severely suppressed without antibacterial elimination treatment: none of the three target bacteria were detected in groups E and F (0 / 3); in group D, the traditional culture method could only detect some of the target bacteria. The qPCR method, however, was completely unaffected, maintaining a 100% detection rate in all samples (3 / 3). After antibacterial elimination treatment, the detection results of the two methods were completely consistent. These results indicate that the traditional culture method heavily relies on the antibacterial elimination step; otherwise, false negatives are likely to occur. The qPCR method, on the other hand, has stronger tolerance to antibacterial components.

[0112] Table 11

[0113] This invention is not limited to the above-described embodiments. Any modifications, improvements, or substitutions that can be conceived by those skilled in the art without departing from the essential content of this invention fall within the scope of this invention.

Claims

1. A multiplex TaqMan real-time PCR primer and probe composition, characterized in that, The primer and probe composition includes composition I, composition II, and composition III; wherein... The composition I is derived from the upstream primer. nuc -F, downstream primer nuc -R and probe nuc -P composition; the upstream primer nuc The nucleotide sequence of -F is shown in SEQ ID No. 1, and the downstream primer... nuc The nucleotide sequence of -R is shown in SEQ ID No. 2, and the probe... nuc The nucleotide sequence of -P is shown in SEQ ID No. 3; Composition II is derived from the upstream primer. oprL -F, downstream primer oprL -R and probe oprL -P composition; the upstream primer oprL The nucleotide sequence of -F is shown in SEQ ID No. 4, and the downstream primer... oprL The nucleotide sequence of -R is shown in SEQ ID No. 5, and the probe... oprL The nucleotide sequence of -P is shown in SEQ ID No. 6; Composition III is derived from the upstream primer. rpoD -F, downstream primer rpoD -R and probe rpoD -P composition; the upstream primer rpoD The nucleotide sequence of -F is shown in SEQ ID No. 7, and the downstream primer... rpoD The nucleotide sequence of -R is shown in SEQ ID No. 8, and the probe... rpoD The nucleotide sequence of -P is shown in SEQ ID No.

9.

2. The primer and probe composition according to claim 1, characterized in that, The probe nuc -P, probe oprL -P and probe rpoD The nucleotide sequence of -P is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end.

3. The primer and probe composition according to claim 2, characterized in that, The fluorescent reporter group is selected from at least one of VIC, FAM, Cy5, TET, JOE, HEX and Texas Red; the fluorescent quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, QSY7, QSY21, IBFQ and IBRQ.

4. The primer and probe composition according to claim 3, characterized in that, The fluorescent reporter group is selected from at least one of VIC, FAM, Cy5, TET, JOE and HEX; the fluorescent quencher group is selected from at least one of BHQ1, BHQ2, BHQ3, QSY7 and QSY21.

5. Use of the primer and probe composition according to any one of claims 1 to 4 in the preparation of bacterial detection products.

6. The use according to claim 5, characterized in that, The bacterial detection product is a bacterial detection kit.

7. A multiplex TaqMan real-time PCR kit for bacterial detection, characterized in that, The kit comprises the primer and probe composition as described in any one of claims 1 to 4.

8. A method for detecting pathogenic bacteria, comprising the following steps: 1) Extract genomic DNA from pathogenic bacteria in the sample to be tested; 2) Using the genomic DNA of pathogenic bacteria as a template, multiplex TaqMan quantitative PCR amplification is performed using the primer and probe composition described in any one of claims 1 to 4, and fluorescence signals are collected during the extension phase to detect the pathogenic bacteria; wherein, the reaction system for the multiplex TaqMan quantitative PCR amplification includes: The total volume of the reaction system is 20–50 μL; the amount of 2× premixed buffer added is 10–13 μL, the amount of Taq enzyme added is 0.05–0.2 μL, the amount of upstream and downstream primers added is 0.2–1 μL, the amount of probe added is 0.1–0.5 μL, and the amount of template added is 1–5 μL.

9. The detection method according to claim 8, characterized in that, In step 2), the procedure for multiplex TaqMan quantitative PCR amplification includes the following steps: A) Treat with UNG enzyme at 35–40℃ for 1–10 min; B) Pre-denaturate at 94–98℃ for 1–5 min; C) Perform 25 to 45 cycles; each cycle includes, in sequence: denaturation at 94 to 98°C for 5 to 15 seconds, annealing and extension at 50 to 60°C for 10 to 20 seconds.

10. The detection method according to claim 8 or 9, characterized in that, The sample to be tested is a cosmetic product; the pathogenic bacteria are selected from at least one of Staphylococcus aureus, Pseudomonas aeruginosa, and Burkholderia cepacia. The reaction system for the multiplex TaqMan quantitative PCR amplification includes: The total volume of the reaction system is 20–30 μL; the amount of 2× premixed buffer added is 11–12.8 μL, the amount of Taq enzyme added is 0.08–0.15 μL, the amount of upstream and downstream primers added is 0.3–0.8 μL, the amount of probe added is 0.15–0.4 μL, and the amount of template added is 2–4 μL.

Images