A field cuscuta TaqMan real-time fluorescent PCR detection primer probe set, kit and detection method

Abstract

The application discloses a kind of field Cuscuta chinensis TaqMan real-time fluorescent PCR detection primer probe group, kit and detection method, the probe primer group includes: upstream primer C.CamF, its nucleotide sequence is as shown in SEQ ID NO.1;Downstream primer C.Cam R, its nucleotide sequence is as shown in SEQ ID NO.2;And TaqMan probe C.Cam P, its nucleotide sequence is as shown in SEQ ID NO.3.The primer probe group of the present application is designed based on the specific region of field Cuscuta chinensis rbcL gene, by combining optimized real-time fluorescent PCR reaction system and condition, field Cuscuta chinensis can be realized fast, accurate detection.The method of the present application also has the characteristics that specificity is strong (no cross reaction), repeatability is good (CV<3%), operation is simple, detection period is short (about 2.5 hours in whole process) and the like, so it is suitable for the rapid screening and identification of field Cuscuta chinensis in the scene such as port inspection and quarantine, field monitoring.

Description

Technical Field

[0001] This invention belongs to the field of identification of quarantine weeds, and specifically relates to a TaqMan real-time fluorescent PCR detection primer and probe set, kit and detection method for dodder in the field. Background Technology

[0002] Dodder (Cuscuta campestris) is a noxious parasitic weed belonging to the genus *Cuscuta*. As a typical invasive alien plant, it poses a serious threat to agricultural production, forestry ecology, and the natural environment. Its spread primarily occurs through the transport of host plants, and it spreads rapidly and over a wide area. In farmland ecosystems, a single dodder plant can quickly entangle and infect large areas of crops. By parasitizing and depriving the host plant of water, nutrients, and photosynthetic products, it leads to stunted growth, reduced yields, and even crop failure—for example, parasitized soybean plants often exhibit problems such as underdeveloped grains and deteriorated quality, significantly reducing their economic value.

[0003] Because dodder in the field tightly intertwines with its host plants, traditional methods of manual and chemical control are not only difficult and costly to implement, but also prone to causing secondary damage to the host and the environment. At the same time, due to its similar morphological characteristics to other dodder closely related species (such as Chinese dodder and southern dodder), traditional morphological identification methods have drawbacks such as long cycles, low accuracy, and reliance on professional experience, making it difficult to meet the needs of "rapid screening and accurate identification" in scenarios such as port quarantine and field monitoring.

[0004] Currently, rapid detection technologies for field dodder are not yet perfect, lacking standardized detection methods that are highly specific, sensitive, and easy to operate, resulting in delays in the prevention and control of its invasion risks. Therefore, developing a detection technology that can quickly and accurately distinguish field dodder from closely related species and common host crops is of great practical significance for strengthening port inspection and quarantine, curbing its spread, and ensuring agricultural production safety and ecological environment stability. Summary of the Invention

[0005] To address the problems existing in the background art, the purpose of this invention is to provide a TaqMan real-time fluorescent PCR detection primer and probe set, kit, and detection method for field dodder.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides a primer and probe set for TaqMan real-time fluorescence PCR detection of field dodder, comprising: an upstream primer C. cam F, a downstream primer C. cam R, and a TaqMan probe C. cam P, wherein, The nucleotide sequence of the upstream primer C.cam F is shown in SEQ ID NO.1. 5'-AAATCCGTCGATTTGAAAAATT-3'; The nucleotide sequence of the downstream primer C.cam R is shown in SEQ ID NO.2, which is 5'-TCAGTCCTCTGCTCTACCGC-3'; The nucleotide sequence of the TaqMan probe C.cam P is shown in SEQ ID NO.3. The probe is 5'-CCAACAAACTACTCTCTTAATCTCG-3', with the 5' end modified with a FAM fluorescent group and the 3' end modified with a BHQ1 quencher group.

[0007] A second aspect of the present invention provides a kit for TaqMan real-time fluorescence PCR detection of field dodder, comprising the above-described probe and primer set.

[0008] Preferably, it also includes: 2×TaqMan Universal PCR Master Mix, a positive control template, and a negative control template; The positive control template was the genomic DNA template of Cuscuta chinensis. The negative control templates were selected from European dodder genomic DNA templates, Japanese dodder genomic DNA templates, Chinese dodder genomic DNA templates, southern dodder genomic DNA templates, five-pointed dodder genomic DNA templates, soybean genomic DNA templates, wheat genomic DNA templates, and barley genomic DNA templates.

[0009] A third aspect of the present invention provides a TaqMan real-time fluorescence PCR detection method for field dodder, comprising the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the genomic DNA of the sample to be tested as a template, perform TaqMan real-time fluorescent PCR reaction using the above probe and primer set; S3. After the reaction is complete, analyze the PCR amplification curve and the cycle threshold Ct value to determine whether the sample to be tested is Cuscuta chinensis.

[0010] Preferably, the PCR reaction system consists of: 12.5 μL of 2×TaqMan Universal PCR Master Mix, 0.5 μL of 10 μM upstream primer C.cam F, 0.5 μL of 10 μM downstream primer C.cam R, 0.5 μL of 10 μM TaqMan probe C.cam P, 1 μL of DNA template, and 10 μL of ddH2O, with a total system volume of 25 μL.

[0011] Preferably, the PCR reaction procedure is as follows: pre-denaturation at 95°C for 10 min; followed by 40 cycles, each cycle including: denaturation at 95°C for 15 s, annealing / extension at 60°C for 1 minute, and acquisition of FAM channel fluorescence signal during the annealing / extension stage; and finally incubation at 4°C for 30 min.

[0012] Preferably, the result determination criterion of step S3 is: (1) If the sample to be tested shows a typical S-type amplification curve and the cycle threshold Ct value is <35, then the sample to be tested is determined to be Cuscuta chinensis. (2) If the sample to be tested does not have a typical amplification curve, or the cycle threshold Ct value is ≥35, then the sample to be tested is determined to be not Cuscuta chinensis.

[0013] Preferably, a blank control is set up simultaneously during the PCR reaction, and the blank control uses ddH2O as a template; if the blank control shows a typical S-shaped amplification curve, the experimental results are invalid and the test needs to be repeated.

[0014] Compared with the prior art, the present invention has the following beneficial effects: (1) High specificity and high identification accuracy: This invention designs a real-time fluorescent PCR primer and TaqMan probe combination (specifically, upstream primer C.pan F, downstream primer C.pan R, and TaqMan probe C.pan P) targeting the conserved specific region of the rbcL gene in *Cuscuta chinensis*. This primer and probe target a specific fragment of the *Cuscuta chinensis* rbcL gene sequence, achieving specific recognition of *Cuscuta chinensis* through sequence complementarity matching. This avoids false positive results caused by cross-reactions with closely related species and host plants (soybean, wheat, etc.) at the molecular targeting level. Experimental verification results show that only *Cuscuta chinensis* samples showed specific amplification, while other closely related species and host plant samples such as soybean and wheat did not show amplification. Therefore, the method of this invention can achieve specific recognition of *Cuscuta chinensis*.

[0015] (2) High detection efficiency and short time consumption: Compared with traditional morphological identification, the method of the present invention integrates DNA extraction, amplification and result determination, and performs fluorescence signal acquisition and annealing / extension steps simultaneously, which not only ensures the specific binding of primers and probes and the chain extension efficiency, but also simplifies the operation process and improves the detection timeliness.

[0016] This invention utilizes a primer and probe set designed based on the specific region of the rbcL gene of Cuscuta chinensis, combined with an optimized real-time fluorescent PCR reaction system and conditions, to rapidly and accurately detect Cuscuta chinensis. This method exhibits high specificity (no cross-reactivity), good reproducibility (CV < 3%), and is simple to operate with a short detection cycle (approximately 2.5 hours). It is suitable for rapid screening and identification of Cuscuta chinensis in scenarios such as port inspection and quarantine and field monitoring. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 For specific experimental results; where 1 represents field dodder, 2 represents European dodder, 3 represents Japanese dodder, 4 represents Chinese dodder, 5 represents southern dodder, 6 represents five-pointed dodder, 7 represents soybean, 8 represents wheat, 9 represents barley, and 10 represents blank control (sterile deionized water). Detailed Implementation

[0019] In the following description, specific details such as particular system architectures and techniques are set forth for illustrative purposes and not for limitation, in order to provide a thorough understanding of the embodiments of the invention. However, those skilled in the art will understand that the invention may be implemented in other embodiments without these specific details.

[0020] Example 1 1. Experimental materials and equipment 1.1 Experimental Samples The samples used in this experiment were plant materials collected by Tianjin Customs from different entry channels in recent years. After preliminary morphological identification, they were classified and preserved, totaling 9 samples (including 6 species of dodder (field dodder, European dodder, Japanese dodder, Chinese dodder, southern dodder, and five-pointed dodder) and 3 kinds of crops (soybean, wheat, and barley)). The specific information is shown in Table 1 below.

[0021] Table 1. Sample Information

[0022] 1.2 Main Reagents and Instruments 2×TaqMan Universal PCR Master Mix (Thermo Fisher, Cat. No. 4304437), Plant Tissue Genomic DNA Extraction Kit (Tiangen Biotech, Cat. No. DP305-02), Forward Primer C. cam F (10 μM), Reverse Primer C. cam R (10 μM), TaqMan Probe C. cam P (10 μM) (Shanghai Sangon Biotech); TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0, autoclaved), sterile deionized water (ddH2O, resistivity ≥18.2 MΩ) cm), real-time quantitative PCR instrument.

[0023] 2. Experimental Methods 2.1 Design of probes and primers: Design Basis: Complete rbcL gene sequences of *Cuscuta chinensis* and its closely related species (e.g., *Cuscuta chinensis*, *Cuscuta sinensis*, etc.) and host plants (e.g., soybean) were downloaded from GenBank. ClustalX alignment was performed using MEGA 11 software to screen for specific regions (approximately 150 bp in length) in the *Cuscuta chinensis* rbcL gene that are conserved and have stable base differences from other species. The core fragment (numbered to correspond to the original sequence position) is shown below. This sequence is a conserved region unique to *Cuscuta chinensis*, and its homology with the rbcL gene sequences of other dodder species and common crops (soybean, wheat, barley) is less than 85%, ensuring the specificity of the detection.

[0024] 241AAATTTTCAGTAAGAA GAAAATCCGTCGAT TTGAAAAATT GTGAGGGTTC AAGTCCCTCT ↑Upstream primer binding region 301 ATCCCCAAAA GC CCAACAAA CTACTCTCTT AATCTCG AAT TTGAATCTAC AGTGGGAAAT↑ Probe binding region 361GGGTCGGGATAGCTCAG GCGGTAGAGCAGAGGACTGA AAATCCT ↑Downstream primer binding region Based on the rbcL-specific DNA sequence of *Cuscuta chinensis* published in GenBank, a set of primers (target amplification fragment length 145 bp) was designed using Beacon Designer software in the aforementioned specific region. Specifically, the upstream primer *C. cam F* and the downstream primer *C. cam R*, with nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, were used. A TaqMan probe, *C. cam P*, was also used. This probe has a 5′ modified FAM fluorescent group and a 3′ modified BHQ1 quencher group, and contains no continuous G bases or hairpin structures. Its nucleotide sequence is shown in SEQ ID NO.3. Specific sequence information is shown in Table 2 below. Verification using NCBI Primer-BLAST showed that the primers and probes completely matched only the *Cuscuta chinensis* rbcL sequence and did not specifically bind to other species.

[0025] Table 2. Information on probes and PCR amplification primers

[0026] 2.2 Detection of dodder in the field 2.2.1 Genomic DNA Extraction (1) Sample pretreatment: Take about 50 mg of mature seeds of each sample (field dodder, European dodder, Japanese dodder, Chinese dodder, southern dodder, five-pointed dodder, soybean, wheat, barley) and grind them into powder. Place them in a 2 mL centrifuge tube, add 600 μL of lysis buffer preheated to 65 ℃, vortex for 1 min, and then in a 65 ℃ water bath for 30 min. (2) Follow the instructions of the plant tissue genomic DNA extraction kit, add phenol-chloroform-isoamyl alcohol (25:24:1) sequentially for extraction, centrifuge to collect the supernatant, adsorb DNA onto the column, and wash away impurities with washing solution; (3) Elute the DNA with 50 μL TE buffer, and test the DNA purity (A260 / A280 ratio 1.8-2.0) and concentration with Nanodrop 2000. Adjust the concentration to 10 ng / μL and store at -20 ℃ for later use.

[0027] 2.2.2 PCR reaction 2.2.2.1 Preparation of PCR reaction system The following controls were set up: a positive control (genomic DNA of known field dodder), a negative control (genomic DNA of European dodder, Japanese dodder, Chinese dodder, southern dodder, five-pointed dodder, soybean, wheat, and barley), and a blank control (sterile deionized water to replace template DNA). Each group had 3 replicate wells to ensure the reliability of the results.

[0028] Preparation of the PCR reaction system: In a clean bench, add the components in the following proportions, vortex to mix, and centrifuge (3000 rpm, 1 min) to avoid bubble formation. The total volume of the PCR reaction system is 25 μL. The specific amounts of each component are as follows: 2×TaqMan Universal PCR Master Mix 12.5 μL, 10 μM upstream primer C.cam F 0.5 μL, 10 μM downstream primer C.cam R 0.5 μL, 10 μM TaqMan probe C.cam P 0.5 μL, DNA template 1 μL, ddH2O 10 μL.

[0029] 2.2.2.2 Reaction Program Setup Place the prepared PCR reaction system into a real-time fluorescence PCR instrument, and set the program as follows: (1) Pre-denaturation: 95 ℃, 10 min; (2) Cyclic Phase (40 cycles): Denaturation: 95 ℃, 15 s; Annealing / Extension: 60 ℃, 1 min (primers specifically bind to the template and extend, while simultaneously acquiring FAM channel fluorescence signals) Incubation: 4 ℃, 30 min (to prevent product degradation and facilitate subsequent analysis).

[0030] (3) Fluorescence acquisition settings: After the annealing / extension stage of each cycle, the fluorescence signal is acquired. The fluorescence threshold is set to 10 times the average value of the fluorescence signal within 3-15 cycles, and the Ct value is automatically calculated.

[0031] 3. Result Judgment and Verification 3.1 Judgment Criteria: Quality control requirements: Blank control (sterile deionized water) and negative control (European dodder, Japanese dodder, Chinese dodder, southern dodder, five-pointed dodder, soybean, wheat, barley) must meet the following requirements: no typical S-shaped amplification curve, Ct value showing "Undetermined" (not detected), and the coefficient of variation (CV) of Ct values ​​in 3 replicate wells <5% for the experiment to be valid; otherwise, the experiment is invalid and must be repeated.

[0032] (1) Positive determination: If the sample shows a typical S-type amplification curve and the Ct value is <35, then the sample is determined to be Cuscuta chinensis. (2) Negative determination: If the sample has no amplification curve or the Ct value is ≥35, the sample is determined to be not Cuscuta chinensis.

[0033] 3.2 Specificity Experimental Validation Results Figure 1 The results showed that only the *Cuscuta chinensis* sample exhibited specific amplification, displaying a typical S-shaped amplification curve with a Ct value < 35, meeting the criteria for a positive result. However, samples from *Cuscuta pentaphyllum*, *Cuscuta japonica*, *Cuscuta chinensis*, *Cuscuta stenoptera*, *Cuscuta sinensis*, *Cuscuta chinensis*, soybean, wheat, barley, and sterile deionized water (blank control) did not show S-shaped amplification curves, and Ct values ​​were not detected in any of them. These results indicate that the detection method of this invention can effectively distinguish *Cuscuta chinensis* from other closely related species and crops, avoiding false positive results caused by cross-reactions; that is, this method can achieve specific identification of *Cuscuta chinensis*.

[0034] In summary, this invention uses multiple sequence alignment of the rbcL gene sequences of *Cuscuta chinensis* and its closely related species and common host plants to screen for species-specific conserved regions in the *Cuscuta chinensis* rbcL gene. Based on these regions, upstream primers, downstream primers, and TaqMan fluorescent probes are designed using primer and probe design software to ensure that the primers and probes can specifically recognize the *Cuscuta chinensis* rbcL gene sequence, without cross-hybridization with closely related *Cuscuta chinensis* species or host plants such as soybean, wheat, and barley, thereby achieving highly specific detection of *Cuscuta chinensis*.

[0035] This invention is not limited to the specific embodiments described above. Any modifications made by those skilled in the art based on the above concept without creative effort are within the scope of protection of this invention.

Claims

1. A primer and probe set for TaqMan real-time fluorescent PCR detection of field dodder, characterized in that, include: The upstream primer is C. cam F, the downstream primer is C. cam R, and the TaqMan probe is C. cam P. The nucleotide sequence of the upstream primer C.cam F is shown in SEQ ID NO.

1. 5'-AAATCCGTCGATTTGAAAAATT-3'; The nucleotide sequence of the downstream primer C.cam R is shown in SEQ ID NO.2, which is 5'-TCAGTCCTCTGCTCTACCGC-3'; The nucleotide sequence of the TaqMan probe C.cam P is shown in SEQ ID NO.

3. The probe is 5'-CCAACAAACTACTCTCTTAATCTCG-3', with the 5' end modified with a FAM fluorescent group and the 3' end modified with a BHQ1 quencher group.

2. A kit for TaqMan real-time fluorescence PCR detection of dodder in the field, characterized in that, It includes the probe primer set as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, Also includes: 2×TaqMan Universal PCRMaster Mix, positive control template, and negative control template.

4. A TaqMan real-time fluorescence PCR detection method for dodder in the field, characterized in that, Includes the following steps: S1. Extract genomic DNA from the sample to be tested; S2. Using the genomic DNA of the sample to be tested as a template, perform a TaqMan real-time fluorescence PCR reaction using the probe and primer set as described in claim 1; S3. After the reaction is complete, analyze the PCR amplification curve and the cycle threshold Ct value to determine whether the sample to be tested is Cuscuta chinensis.

5. The detection method according to claim 4, characterized in that, The PCR reaction system consisted of: 12.5 μL of 2×TaqMan Universal PCR Master Mix, 0.5 μL of 10 μM upstream primer C.cam F, 0.5 μL of 10 μM downstream primer C.cam R, 0.5 μL of 10 μM TaqMan probe C.cam P, 1 μL of DNA template, and 10 μL of ddH2O, for a total volume of 25 μL.

6. The detection method according to claim 4, characterized in that, The PCR reaction procedure was as follows: pre-denaturation at 95 °C for 10 min; followed by 40 cycles, each cycle consisting of: denaturation at 95 °C for 15 s, annealing / extension at 60 °C for 1 min, with FAM channel fluorescence signal collected during the annealing / extension phase; and finally, incubation at 4 °C for 30 min.

7. The detection method according to claim 4, characterized in that, The result determination criteria for step S3 are as follows: (1) If the sample to be tested shows a typical S-type amplification curve and the cycle threshold Ct value is <35, then the sample to be tested is determined to be Cuscuta chinensis. (2) If the sample to be tested does not have a typical amplification curve, or the cycle threshold Ct value is ≥35, then the sample to be tested is determined to be not Cuscuta chinensis.

Images