KASP molecular marker primer related to fiber length and strength of gossypium hirsutum and application thereof

Abstract

The application discloses a KASP molecular marker significantly related to cotton fiber length and strength and an application thereof. The KASP molecular marker is located in a region of D08_660059-659344 bp upstream of a GhFAR4 gene promoter on a chromosome D08 of a cotton reference genome, and is composed of a haplotype block of five closely linked SNP sites. By determining the correlation between two haplotypes of Hap1 and Hap2 in the block and the fiber length and strength, a KASP detection system is constructed. The marker and the detection system are used in high-throughput genotyping of cotton seedlings or early generation materials, and have high stability and high accuracy of phenotype prediction in a complex genetic background. The application can realize quality screening without waiting for fiber maturation, greatly shortens a breeding cycle, and reduces breeding cost.

Description

Technical Field

[0001] This invention relates to the field of molecular genetic breeding technology, specifically to a KASP molecular marker primer related to the fiber length and strength of upland cotton and its application. Background Technology

[0002] Cotton is the world's most important natural textile fiber crop, and improving fiber length and strength has always been a core objective of cotton breeding. In recent years, genome-wide association analysis (GWAS) and haplotype analysis have become effective means of uncovering superior natural variations in cotton. Related studies have successfully identified superior allelic variations with breeding application value in multiple fiber quality-related genes.

[0003] Natural variation in promoter regions is a key genetic basis for regulating gene expression levels. Nucleotide variations in transcriptional regulatory regions (such as promoters) can finely regulate the tissue-specific or spatiotemporal expression levels of target genes by affecting the binding efficiency of transcription factors or altering chromatin accessibility, thereby leading to significant variations in crop phenotypes. Therefore, in the field of cotton fiber quality improvement, the discovery of superior haplotypes based on promoter variation has become an important strategy for molecular marker-assisted breeding. Competitive allele-specific PCR (KASP) technology, with its advantages of high specificity, low cost, and high throughput, has also become a core tool for transforming superior allelic variations into practically usable markers for breeding.

[0004] However, the following technical bottlenecks still exist in existing molecular breeding practices for cotton quality:

[0005] 1. Lack of core key genes and excellent variant sites: Although GWAS has located a large number of phenotypic associated regions, most major genes controlling fiber quality and their key variant sites in promoter regions have not been accurately identified, and there is a lack of effective targets that can directly guide the development of molecular markers.

[0006] 2. Conventional molecular markers are not accurate enough in complex genetic backgrounds: Most existing markers are developed based on single SNP sites. When faced with complex genetic backgrounds or diverse germplasm resources, they often have problems such as loose linkage, low phenotypic prediction accuracy and poor stability, making it difficult to directly apply them to high-throughput screening of early generation materials.

[0007] Therefore, in-depth exploration of key promoter haplotype blocks that control cotton fiber length and strength, and the development of haplotype KASP molecular markers that are highly stable, high-throughput, and suitable for early screening, are of great significance for overcoming the shortcomings of existing breeding markers, such as low prediction accuracy and long breeding cycles, and for achieving precise and efficient improvement of cotton fiber quality. Summary of the Invention

[0008] The purpose of this invention is to provide a haplotype KASP molecular marker that is significantly correlated with cotton fiber length and strength, and its application. Using the haplotype KASP molecular marker, specific primers, and detection system provided by this invention, rapid and non-destructive detection of cotton fiber length and strength can be achieved. This marker can be directly applied to early screening of early-generation cotton breeding materials, effectively overcoming the interference of complex genetic backgrounds on phenotypic prediction, improving breeding selection efficiency, and significantly reducing breeding and field screening costs.

[0009] To achieve the above objectives, the present invention provides the following technical solution:

[0010] First, this invention provides a molecular marker related to cotton fiber length and strength. This molecular marker is a haplotype marker, composed of a combination of genotypes from five SNP loci located within the region from 660059bp to 659344bp on chromosome D08 of the cotton reference genome TM-1_V2.1. Its specific genomic physical location and polymorphism are as follows:

[0011] SNP1 is located at physical position 660059 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of T / C;

[0012] SNP2 is located at physical position 660054 bp on chromosome TM-1_V2.1D08 of the reference genome, with polymorphism A / C;

[0013] SNP3 is located at physical position 659533 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of A / G;

[0014] SNP4 is located at physical position 659412 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of G / A;

[0015] SNP5 is located at physical position 659344 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of T / G;

[0016] The flanking sequences of the five SNP sites are shown in SEQ ID NO.4: TTTAGCATTTCTATGCATTGAATTTTAAAAAAAAAAAGTTTGGCAATTCATATGAAACAAATTCACGTGTTCTCACTTAACTTCTTTG[ T / C] TTCT[ A / C]TAAAGATCAAAGATCAAATTGATTATTTCTGCTAAAAATTTAATCTATTTGTACTGTTAAAAATTAATGTGACTAACGAAATAATTAAACAGTGACATGCCCATGCCACGTGTACCTCATGCTACCGTACAATAACAAATTTTTAACAGTAGAAATAGATGGAAGTTTTAACAGAATGCCCAGTTTACTCTTTGATCTAACGTAAAATGACTAATTTACCATTAGAACAAAGTTCAATCTGACTCTTAGGGTCTGTTTGATTGCCAGTAAAATATTTTCCGTAAAATAATTTCTGAAAAATGTTTTACTTTTCTGTAAAATGATTTACTGGAAAATATTTTCTGGTGTTTGATTGAATCTGTGTAAAATATTTTCTGCTGCTTGGCAGATTTTTTGAAAATATTTTTCGGAAAAGTTGTTTTTACATATATTAATATATATTAATAAATTTTTATATTTTAAATTATTTTTACTTATATTGCAATGATTTATTTATAATAATACTCAATTATTAAGCTACA A / G] TATTAATCGTTATAAATTGAAAAAAACAAGTATTGAATAATTAAAAAAACAAGTTACTAGAAAATCGATAAACAGAAGCAGTTTTCTACCGGAAATGAAGGAAGGAATGAAGGAGGCGACA G / A] AGAGGAGAGCACGGAAAATGTCTTACAGAAATTGAAAGGGTAAGACATTTTCCCTAAAATGTAACTCA T / G] TTTCCCTTGTTTTGGAGTTCATTTTCCAAATGGAAAATGTTTTCCGCCAATCAAACACTGGAAAAGTTGGAAATGATTTTCCGGAAAATCAATTCT.

[0017] For the molecular marker described above, further, the haplotypes constituted by the genotype combination of the 5 SNP loci include haplotype Hap1 and haplotype Hap2:

[0018] Haplotype Hap1: Its genotype combination is TAAGT;

[0019] Haplotype Hap2: Its genotype combination is CCGAG;

[0020] Among them, individuals carrying the haplotype Hap1 had significantly higher fiber length and fiber strength than individuals carrying the haplotype Hap2.

[0021] Furthermore, the present invention also provides a KASP primer set for detecting the molecular marker, the primer set comprising:

[0022] The nucleotide sequence is as shown in SEQ ID NO.1 for upstream specific primer 1;

[0023] The nucleotide sequence is as shown in SEQ ID NO.2 for upstream specific primer 2;

[0024] The nucleotide sequence is shown in SEQ ID NO.3. Universal downstream primer.

[0025] The primer set wherein the 5' end of the upstream specific primer 1 is modified with a first fluorescent group (preferably FAM), and the 5' end of the upstream specific primer 2 is modified with a second fluorescent group (preferably HEX).

[0026] The present invention also provides a detection formulation, kit, or chip containing the primer set.

[0027] This invention also provides the use of the molecular marker, the KASP primer set, the detection reagent, the kit, or the chip in any of the following:

[0028] (1) To detect or assist in the detection of cotton fiber length and / or fiber strength quality;

[0029] (2) To prepare products for testing or assisting in testing the quality of cotton fiber length and / or fiber strength;

[0030] (3) Screening or assisting in the breeding of superior cotton germplasm resources with high fiber length and / or high fiber strength;

[0031] (4) Prepare products for screening and breeding high-quality cotton germplasm resources.

[0032] The present invention also provides a method for detecting or assisting in the detection of cotton fiber length and strength, comprising the following steps:

[0033] Using the genomic DNA of the cotton sample as a template, PCR amplification and fluorescence signal scanning were performed on the template using the KASP primers to obtain genotyping results. Haplotypes were then determined based on the genotyping results.

[0034] If the genotyping result corresponds to haplotype Hap1 (TAAGT), the cotton material has a better fiber length and strength phenotype; if it corresponds to haplotype Hap2 (CCGAG), its fiber length and strength phenotype is weaker.

[0035] The method further includes the following: the cotton sample to be tested is cotyledon or true leaf tissue of cotton seedlings, or segregating generation material from hybridization breeding.

[0036] Compared with the prior art, the present invention has the following significant advantages:

[0037] Precise targeting and extremely high correlation: This invention uses genome-wide association analysis (GWAS) to deeply explore superior variations in upland cotton, precisely locating molecular markers in the promoter region of the key candidate gene (GhFAR4) that regulates cotton fiber development. This region consists of a strongly linked haplotype block composed of five closely linked SNP sites, which has a highly significant statistical association with cotton fiber length and strength traits, greatly improving the accuracy of phenotypic prediction.

[0038] Overcoming interference from complex genetic backgrounds and exhibiting high stability: Conventional single SNP markers are prone to recombination and separation when faced with different cotton populations or complex genetic backgrounds, leading to inaccurate predictions. This invention performs overall genotyping based on a "haplotype block" composed of 5 SNPs. The linkage between the marker and quality traits is extremely tight, and it still has extremely high stability and repeatability even in complex genetic backgrounds.

[0039] High-throughput, ultra-early screening significantly shortens the breeding cycle: Conventional quality breeding requires waiting for cotton boll opening and fiber maturity before field sampling and yield measurement (which takes at least 1-2 growing seasons). Based on the KASP detection system developed in this invention, high-throughput genotyping can be performed through non-destructive sampling during the cotton seedling stage (cotyledon stage or true leaf stage). This enables rapid and accurate selection of superior and inferior materials from a large number of samples in early generations (such as F2 and F3), greatly saving field planting and screening costs and shortening the breeding cycle by more than 2-3 years.

[0040] Simple and economical to operate, and conducive to large-scale promotion: The primer and reagent kit system developed in this invention can achieve automatic closed-tube interpretation of fluorescence signals based on a conventional quantitative PCR instrument. The detection cost per sample is low, the throughput is high, and the human error is small, which is very convenient for large-scale assisted breeding applications by cotton breeding units and seed companies. It has significant application value for achieving synergistic improvement of cotton yield and quality. Attached Figure Description

[0041] Figure 1 The process of discovering the key candidate gene GhFAR4 in this invention is demonstrated.

[0042] In this diagram, A is the Manhattan plot of GWAS association analysis for the fiber length trait in the colocalized region of chromosome D08; B is the QQ plot of fiber length trait based on SNPs; C is the Manhattan plot of GWAS association analysis for the fiber strength trait in the colocalized region of chromosome D08; D is the QQ plot of fiber length trait based on SNPs; EF is the local Manhattan plot and LD block analysis of the major effect site of D08; G is the linkage disequilibrium heatmap of significantly associated sites within the target region of chromosome D08; H shows the tissue transcriptome expression level of the core candidate gene Ghi_D08G0081 (GhFAR4) at four key stages of cotton fiber development (10DPA, 15DPA, 20DPA, 25DPA); and IJ is the scatter plot of the association analysis between the gene expression level of the core candidate gene Ghi_D08G0081 (GhFAR4) and the fiber quality phenotype.

[0043] Figure 2 The haplotype division and phenotypic variation analysis of the promoter region of the GhFAR4 gene are presented.

[0044] In this diagram, A shows the base combination distribution of the five closely linked SNP sites of the GhFAR4 promoter in the superior haplotype Hap1 and the non-superior haplotype Hap2; B and C show the highly significant differences in average fiber length and average fiber strength between cotton materials carrying the Hap1 and Hap2 genotypes in natural populations, respectively.

[0045] Figure 3 The detection and validation results of the KASP molecular marker developed for the core tag site SNP3 are presented. A shows a genotyping scatter plot of fluorescence signals from 100 individual plants, clearly clustered into FAM channel homozygous (Hap1, AA), HEX channel homozygous (Hap2, GG), and a blank control with no signal. B shows a highly significant quality difference in actual fiber strength and length at final maturity between Hap1 homozygous and Hap2 homozygous plants distinguished by KASP detection.

[0046] Figure 4 This paper demonstrates the application and improvement effects of the KASP molecular markers of this invention in actual breeding backcrossing and conversion. Among them, A is a flowchart of the breeding technology route for using KASP markers to perform early prospect selection of backcross segregating populations and construct near-isogenic lines (NILs); B and C respectively show the extremely significant directional improvement effect of the selected near-isogenic line (Hap1) in fiber length and fiber strength compared with the conventional maternal parent (Xiangmian 13). Detailed Implementation Plan

[0047] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0048] Example 1: Identification of key genes and superior promoter haplotypes regulating cotton fiber length and strength

[0049] Using a large-scale natural population constructed from 769 upland cotton germplasm resources preserved by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences as an association population, quality traits such as fiber length and strength were investigated under multiple environmental (or multi-site) conditions. Genome-wide association analysis (GWAS) detected a signal peak strongly associated with both fiber length and fiber strength in the 0.35-0.75 Mb region of chromosome D08 in the upland cotton reference genome (TM-1_V2.1). Figure 1 The region contains 266 core SNPs (lead SNPs), forming a genomic co-localization region associated with the bidirectional traits of fiber length and fiber strength. Figure 1 (EF). The chained unbalanced (LD) block was resolved for this co-location interval. Figure 1 Based on the systemic functional prediction of candidate genes within the co-localization interval (G) and other parameters, 45 candidate genes were ultimately selected through annotation and screening. To further pinpoint target genes within the co-localization interval, this embodiment combined RNA-seq data from fiber tissues of 100 representative upland cotton materials from this natural population at four key stages of fiber development (10 DPA, 15 DPA, 20 DPA, and 25 DPA, where DPA represents days after flowering). Figure 1 H), a joint association analysis of gene expression levels and fiber quality phenotypes was performed. The results showed that only one gene showed a highly significant association between its expression level and both fiber length and strength during the critical period of fiber development (H). Figure 1 (IJ). This gene encodes fatty acyl-CoA reductase, and its accession number in the reference genome is Ghi_D08G0081. Here it is named GhFAR4 and identified as a core candidate gene regulating cotton fiber length and strength.

[0050] Sequencing data from 769 upland cotton populations were resequencing and compared to reveal natural variations in the GhFAR4 gene promoter region. Results showed five highly linked single nucleotide polymorphisms (SNPs) upstream of the GhFAR4 gene promoter (physical location 660059-659344 bp on chromosome D08). Their specific locations and base variation morphologies are: D08_660059 (T / C), D08_660054 (A / C), D08_659533 (A / G), D08_659412 (G / A), and D08_659344 (T / G).

[0051] Based on the above 5 closely linked SNP loci, genotypic combinations (i.e., haplotype analysis) can be performed to clearly classify the upland cotton material in this natural population into two main haplotypes. Figure 2 (A)

[0052] Haplotype Hap1 (n=575): Its genotype combination is (TAAGT);

[0053] Haplotype Hap2 (n=194): Its genotype combination is (CCGAG).

[0054] Association analysis and significance tests were performed between haplotype genotype and population phenotypic data. The results showed that in the natural population, cotton materials carrying the haplotype Hap1 had significantly higher average fiber length and average fiber strength (P<0.0001) than those carrying the haplotype Hap2. Figure 2 (B and C). This confirms that the haplotype block consisting of 5 SNPs in the promoter region is closely related to cotton fiber quality traits. Among them, haplotype Hap1 is an excellent allelic variant block that controls high fiber length and high strength, and has a positive promoting effect on cotton fiber quality improvement.

[0055] Example 2: Development and Application of KASP Molecular Markers Based on Haplotypes

[0056] 2.1 Design and Synthesis of Specific KASP Primers

[0057] To greatly simplify the detection process for large-scale breeding populations, this embodiment, based on the sequence specificity within the haplotype region of the GhFAR4 gene promoter identified in Example 1, selected SNP3 (D08_659533, base polymorphism A / G) located in the functional core region from five linked SNPs as the core tag marker site (Tag-SNP) representing the superior haplotype (Hap1). The flanking sequence information of the upland cotton genome containing this site is shown in SEQ ID NO.5: TTTAGCATTTCTATGCATTGAATTTTAAAAAAAAAAAGTTTGGCAATTCATATGAAACAAATTCACGTGTTCTCACTTAACTTCTTTG T TTCT A TAAAGATCAAAGATCAAATTGATTATTTCTGCTAAAAATTTAATCTATTTGTACTGTTAAAAATTAATGTGACTAACGAAAATAATTAAACAGTGACATGCCCATGCCACGTGTACCTCATGCTACCGTAC AATAACAAATTTTTAACAGTAGAAATAGATGGAAGTTTTAACAGAATGCCCAGTTTACTCTTTGATCTAACGTAAAATGACTAATTTACCATTAGAACAAAGTTCAATCTGACTCTTAGGGTCTGTTTGA TTGCCAGTAAAATATTTTCCGTAAAATAATTTCTGAAAAATGTTTTACTTTTCTGTAAAATGATTTACTGGAAAATATTTTCTGGTGTTTGATTGAATCTGTGTAAAATATTTTCTGCTGCTTGGCAGAT TTTTTGAAAATATTTTTCGGAAAAGTTGTTTTTACATATATTAATATATATTAATAAATTTTTATATTTTAAATTATTTTTACTTATATTGCAATGATTTATTTATAATAATACTCAATTATTAAGCTACA A TATTAATCGTTATAAATTGAAAAAAACAAGTATTGAATAATTAAAAAAACAAGTTACTAGAAAATCGATAAACAGAAGCAGTTTTCTACCGGAAATGAAGGAAGGAATGAAGGAGGCGACA GAGAGGAGAGCACGGAAAATGTCTTACAGAAATTGAAAGGGTAAGACATTTTCCCTAAAATGTAACTCA T TTTCCCTTGTTTTGGAGTTCATTTTCCAAATGGAAAATGTTTTCCGCCAATCAAACACTGGAAAAGTTGGAAATGATTTTCCGGAAAATCAATTCT.

[0058] Based on the flanking sequence of this locus, this invention designed and synthesized two sets of allele-specific forward primers and one shared reverse universal primer. Specifically, the forward primer corresponding to the superior haplotype Hap1 (A allele) has a FAM fluorescent group attached to its 5' end (sequence: 5'-GAAGGTGACCAAGTTCATGCT-3'), and the forward primer corresponding to the non-superior haplotype Hap2 (G allele) has a HEX fluorescent group attached to its 5' end (sequence: 5'-GAAGGTCGGAGTCAACGGATT-3'). Specific primer sequence information is shown in Table 1.

[0059] Table 1. Design of KASP molecular marker-specific primer sets

[0060] ;

[0061] 2.2 Optimization of KASP reaction system and PCR amplification program

[0062] This invention has deeply optimized the KASP-PCR reaction system and amplification thermal cycling program. The optimized standard liquid phase reaction system (total system volume 10 μL) is shown in Table 2, and the optimized touchdown PCR amplification program is shown in Table 3.

[0063] Table 2 KASP-PCR reaction system

[0064] ;

[0065] Table 3. KASP-PCR reaction procedure

[0066] ;

[0067] After PCR amplification, the 96-well PCR reaction plate was placed in a LightCycler 480 real-time quantitative PCR instrument, and the endpoint fluorescence signal was read at 37°C using the accompanying software (version 1.5).

[0068] FAM channel (excitation wavelength 485nm, emission wavelength 520nm), used to detect superior haplotype Hap1;

[0069] HEX channel (excitation wavelength 538nm, emission wavelength 560nm) is used to detect non-superior haplotype Hap2.

[0070] Genotype interpretation criteria: The software automatically clusters fluorescence signals and plots scatter plots. Samples with only FAM fluorescence signals (scatter plots clustered on the X-axis) are identified as superior haplotype homozygotes (Hap1, genotype AA); samples with only HEX fluorescence signals (scatter plots clustered on the Y-axis) are identified as non-superior haplotype homozygotes (Hap2, genotype GG); samples with both FAM and HEX dual-color fluorescence signals (scatter plots clustered at the center of the diagonal) are identified as heterozygotes (genotype AG); blank controls (NTC) with no fluorescence signals are clustered at the origin of the coordinate axis.

[0071] 2.3 Practical breeding application and phenotypic verification results

[0072] To verify the phenotypic prediction accuracy of the developed KASP molecular markers in actual cotton breeding, this embodiment uses 100 validation plants from the population material for application verification.

[0073] During the cotyledon stage after cotton emergence, a small amount of leaf tissue was excised for high-throughput DNA extraction. Blind-sample high-throughput genotyping was performed using the primers in Table 1 and the reaction systems in Tables 2 and 3. Genotyping scatter plot (e.g.) Figure 3 As shown in Figure A, 100 individual plants were clearly clustered into two groups, with 82 plants carrying the Hap1 / Hap1 homozygous type and 18 plants carrying the Hap2 / Hap2 homozygous type. The genotyping success rate reached 100%, proving that the marker has extremely high genotyping efficiency in complex breeding populations.

[0074] After the seeds matured, individual plants were harvested, and the fiber length and strength phenotypes of each plant were measured. The combined phenotypic and genotypic analysis results showed (e.g.) Figure 3 As shown in Figure B), the fiber length and fiber strength of individuals identified by KASP as homozygous for Hap1 were significantly superior to those of Hap2 individuals (P<0.01). These results conclusively demonstrate that the KASP molecular marker and its detection system developed in this invention can accurately screen a large number of materials during the seedling stage, eliminating inferior individuals and retaining superior ones, thereby significantly improving selection efficiency and shortening the breeding cycle by more than two years.

[0075] Example 3: Improving cotton fiber quality through KASP molecular marker-mediated backcrossing.

[0076] To further verify the practical application value of the KASP molecular marker developed in this invention in cotton hybridization backcross improvement and precise transfer of superior alleles, this embodiment uses the marker to carry out marker-assisted selection (MAS) breeding.

[0077] In this embodiment, the upland cotton variety "Xiangmian 13" (genotype Hap2 homozygous, G:G), which has conventional fiber quality, was used as the recipient parent (female, ♀), and the high-quality upland cotton germplasm "Jinmian 2" (genotype Hap1 homozygous, A:A), which carries an excellent haplotype, was used as the superior gene donor parent (male, ♂) for hybridization to obtain F1 generation materials.

[0078] Subsequently, using F1 individuals as the male parent, a backcross was performed with the recipient parent "Xiangmian 13" (Hap2) to construct the backcross population BC1F1. Genomic DNA was extracted from individual cotton leaves during the seedling stage, and foreground selection of the backcross population was performed using the KASP molecular marker detection system constructed in Example 2 of this invention. Through endpoint fluorescence signal scanning, homozygous Hap2 plants without superior allelic variations were precisely eliminated, while heterozygous Hap1 / Hap2 plants exhibiting FAM / HEX dual-color fluorescence signals and carrying superior haplotype blocks were specifically retained.

[0079] Superior BC1F1 heterozygous plants were selected for field self-pollination to obtain the BC1F2 self-pollinating segregating population. The breeding technical route and screening process are as follows: Figure 4 As shown in Figure A. During the seedling stage of the BC1F2 population, genotyping was performed using the aforementioned KASP molecular markers, successfully screening out homozygous single plants exhibiting pure FAM fluorescence signal (A:A) and stable inheritance of the superior haplotype Hap1 / Hap1. Through backcrossing supplemented by molecular marker selection, near-isogenic lines (NILs) with "Xiangmian 13" as the genetic background and only the superior haplotype (Hap1) block of the GhFAR4 gene promoter were successfully constructed.

[0080] After the cotton bolls opened and matured, rigorous fiber quality phenotypic tests were conducted on individual plants of the BC1F2 segregating population and the original recipient parent (Xiangmian 13). Results (as shown in...) Figure 4 B and Figure 4 As shown in Figure C, the Hap1 homozygous lines (near isogenetic lines) obtained through marker screening showed that the final measured fiber length and fiber strength were significantly higher (P<0.01) than the maternal parent Xiangmian 13, successfully achieving targeted, precise, and efficient improvement of cotton fiber quality.

Claims

1. A molecular marker related to cotton fiber length and strength, characterized in that, The molecular marker is a haplotype molecular marker, consisting of a combination of genotypes from five SNP loci located in the region from 660059bp to 659344bp on chromosome D08 of the cotton reference genome TM-1_V2.

1. Its specific genomic physical location and polymorphism are as follows: SNP1 is located at physical position 660059 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of T / C; SNP2 is located at physical position 660054 bp on chromosome TM-1_V2.1D08 of the reference genome, with polymorphism A / C; SNP3 is located at physical position 659533 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of A / G; SNP4 is located at physical position 659412 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of G / A; SNP5 is located at physical position 659344 bp on chromosome TM-1_V2.1D08 of the reference genome, with a polymorphism of T / G; The flanking sequences of the five SNP sites are shown in SEQ ID NO.

4.

2. The molecular marker according to claim 1, characterized in that, The haplotypes formed by the genotype combinations of the five SNP loci include haplotype Hap1 and haplotype Hap2: Haplotype Hap1: Its genotype combination is TAAGT; Haplotype Hap2: Its genotype combination is CCGAG; Among them, individuals carrying the haplotype Hap1 had significantly higher fiber length and fiber strength than individuals carrying the haplotype Hap2.

3. A KASP primer set for detecting the molecular marker of claim 1 or 2, characterized in that, The primer set includes: The nucleotide sequence is as shown in SEQ ID NO.1 for upstream specific primer 1; The nucleotide sequence is as shown in SEQ ID NO.2 for upstream specific primer 2; The nucleotide sequence is shown in SEQ ID NO.

3. Universal downstream primer.

4. The primer set according to claim 3, characterized in that, The 5' end of the upstream specific primer 1 is modified with a first fluorescent group (preferably FAM), and the 5' end of the upstream specific primer 2 is modified with a second fluorescent group (preferably HEX).

5. A detection formulation, kit, or chip comprising the primer set of claim 3 or 4.

6. The application of the molecular marker of claim 1 or 2, the primer set of claim 3 or 4, or the detection reagent, kit or chip of claim 5 in detecting cotton fiber quality, preparing products for detecting cotton fiber quality, identifying cotton fiber quality or breeding high-quality cotton germplasm resources.

7. A method for high-throughput detection or auxiliary identification of cotton fiber length and strength, characterized in that, The procedure includes the following steps: using the genomic DNA of the cotton sample to be tested as a template, performing KASP-PCR amplification using the primer set described in claim 3 or 4; scanning the fluorescence signal of the amplification product and determining the genotype, thereby determining the haplotype of the cotton sample to be tested; determining the fiber length and fiber strength of the cotton based on the haplotype, wherein the fiber length and fiber strength of individuals carrying the haplotype Hap1 are significantly higher than those of individuals carrying the haplotype Hap2.

8. The method according to claim 7, characterized in that, The cotton samples to be tested are cotyledon or true leaf tissues from cotton seedlings, or segregating generation materials from hybrid breeding.

9. The method according to claim 7, characterized in that, The method is applied to the prospect selection of superior single plants in marker-assisted backcrossing and breeding of cotton, or to the construction of near-isogenic lines of high-quality cotton.

Images