Wheat ear number per plant related snp-c1216g and applications thereof

Abstract

The application discloses a wheat single plant ear number related SNP-C1216G and application thereof. The SNP site corresponds to the 1216th base of the sequence shown in SEQ ID NO. 1, when the site is C / C homozygous, the corresponding genotype is A; when the site is G / G homozygous, the corresponding genotype is B; and the single plant ear number size is that the wheat with genotype A homozygous is less than or candidate is less than the wheat with genotype B homozygous. The SNP has high effectiveness and potential application value, and the wheat with high single plant ear number can be found by detecting the SNP, and the application has important value in the research or application of cultivating high-yield wheat varieties.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to SNP-C1216G related to the number of ears per wheat plant and its applications. Background Technology

[0002] Wheat is one of my country's major food crops, accounting for 22% of the total grain crop planting area. With population growth and environmental changes, high yield has become one of the important goals of wheat breeding and grain production in my country. The number of ears per plant is an important yield-related trait in wheat, and its formation is influenced by a combination of factors, including genetics, cultivation management, and environmental conditions. Due to the complexity of this quantitative trait, research on the number of ears per plant in wheat is relatively limited. Therefore, identifying genetic loci controlling the number of ears per plant, developing molecular markers, and promoting the genetic improvement of wheat yield traits are of great significance for ensuring global food security.

[0003] The number of spikes per wheat plant is a typical quantitative trait, regulated by multiple genes. Currently, there are some reports on QTLs controlling this trait. Wang Xin et al., using segregating populations constructed from dwarf wheat germplasm, detected three QTLs controlling the number of spikes per plant on chromosomes 3A, 6A, and 4B. Shah et al., using a RIL population, located a pleiotropic QTL related to the number of spikes per plant on chromosome 3A. Li Junzhou, using 133 DH populations constructed from Zheng 8761 and Chuanyu 35050, detected five QTL loci on chromosomes 3A, 5A, and 7B, controlling the number of spikes per plant, with an explained phenotypic rate of 8.9%–12.1%. Hu Yangshan detected 26 QTLs related to the number of ears per plant in the RIL population constructed by CN18 / T1208, and located cQTN.sicau-2D.2 in the range of 70.45~81.75 Mb, with a phenotypic explanation rate of 3.91%~13.25%. Liu Lihua et al. detected 8 QTL loci related to the number of ears per plant in 248 bred varieties, among which the QTL located on chromosome 1B could explain 6.33%~8.73% of the phenotypic variation.

[0004] Although many QTLs related to the number of ears per wheat plant have been identified, most QTLs have a small phenotypic contribution, require additive effects to be expressed, and have poor repeatability across different years and environments. Therefore, these QTLs are difficult to apply to the genetic improvement of the number of ears per wheat plant. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a SNP-C1216G related to the number of ears per wheat plant and its application.

[0006] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0007] A SNP locus associated with the number of ears per wheat plant, wherein the SNP locus corresponds to the 1216th base from the 5' end of the sequence shown in SEQ ID NO: 1. When this locus is C / C homozygous, the corresponding genotype is A; when this locus is G / G homozygous, the corresponding genotype is B. The number of ears per plant is as follows: wheat homozygous for genotype A is less than or candidate less than wheat homozygous for genotype B.

[0008] On the other hand, the present invention also includes a reagent or kit for identifying or assisting in the identification of the number of ears per wheat plant, the reagent or kit being used for the above-mentioned SNP sites, the reagent or kit containing a PCR amplification specific primer combination and enzyme digestion components corresponding to the SNP sites, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

[0009] As a preferred embodiment of the present invention, the target DNA fragment for PCR amplification of the reagent or kit is designed to be 1190-1304 bp from the 5' end of SEQ ID NO: 1.

[0010] As a preferred embodiment of the present invention, the PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO: 2 and SEQ ID NO: 3, and primer pair 2F and 2R composed of SEQ ID NO: 4 and SEQ ID NO: 5.

[0011] As a preferred embodiment of the present invention, the enzyme digestion component is the restriction endonuclease BglII.

[0012] On the other hand, the present invention also includes a method for identifying or assisting in the identification of the number of ears per wheat plant in the early stage of breeding. Based on the above-mentioned SNP sites, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP sites in the genomic DNA of the wheat to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product. Based on the following correlation between genotype and phenotype, the wheat phenotype of the number of ears per plant is identified or assisted in the identification: the number of ears per wheat plant homozygous for genotype A is less than or candidate less than that of wheat homozygous for genotype B.

[0013] As a preferred embodiment of the present invention, the DNA fragment amplified by PCR is the 5' end 1190-1304bp of SEQ ID NO: 1; the specific primer pair for PCR amplification is primer pair 1F and 1R composed of SEQ ID NO: 2 and SEQ ID NO: 3 and primer pair 2F and 2R composed of SEQ ID NO: 4 and SEQ ID NO: 5; the restriction endonuclease BglII is used for enzyme digestion.

[0014] As a preferred embodiment of the present invention, the enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease BglII; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of ears per plant is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.

[0015] On the other hand, the present invention also includes the use of the above-mentioned wheat SNP sites, which is to screen or assist in screening the spike number phenotype of wheat plants in the early stage of molecular marker-assisted selection breeding.

[0016] Finally, the present invention also includes a primer combination comprising primer pairs 1F and 1R consisting of SEQ ID NO: 2 and SEQ ID NO: 3, and primer pairs 2F and 2R consisting of SEQ ID NO: 4 and SEQ ID NO: 5; this primer combination is used to detect the above-mentioned SNP sites.

[0017] The beneficial effects of adopting the above technical solution are as follows: Through genetic variation analysis of wheat natural variation populations, this invention discovered that the SNP corresponding to position 1216 of SEQ ID NO: 1 has two genotypes: genotype A (C) and genotype B (G). Association analysis showed that in the homozygous types of these two genotypes, the number of ears per plant is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting this SNP, wheat with a higher number of ears per plant can be identified. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in breeding high-yielding wheat varieties or in research. The SNP locus developed in this invention not only expands the genetic resource tools for wheat but also has good and broad application potential verified by scientific experiments and data statistics. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of the gene structure and a schematic diagram of the SNP sites of this invention.

[0019] Figure 2 The results of electrophoresis detection of the SNP-developed dCAPS-labeled enzyme digestion products of this invention are shown; wherein, lane G is the band cleaved by BglII, and lane C is the band that cannot be cleaved by BglII.

[0020] Figure 3This is a schematic diagram illustrating the correlation between gene polymorphism sites in a natural population and the number of ears per plant.

[0021] Figure 4 This is a schematic diagram of gene SNP sites and genotypes in the wheat population material of this invention.

[0022] Figure 5 These are photos of wheat field trait surveys in Example 2.

[0023] Figure 6 These are field photos of the wheat ear count survey conducted in Example 2. Detailed Implementation

[0024] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in the present invention are conventional commercially available products and can be directly obtained through market purchase. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. It should be understood that, as used in this specification and appended claims, the term "comprising" indicates the presence of the described feature, integral, step, operation, element, and / or component, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components, and / or collections thereof. It should also be understood that the term "and / or" as used in this specification and appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0025] As used in this specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrases "if determined" or "if [the described condition or event] is detected" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once [the described condition or event]," or "in response to detection." Furthermore, in the description of this specification and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" described in this specification mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms “including,” “comprising,” “having,” and variations thereof all mean “including but not limited to,” unless otherwise specifically emphasized.

[0026] Example 1: Detection of SNPs related to the number of ears per wheat plant and their PCR-enzyme digestion polymorphisms

[0027] 1.1 Specific primers and sequence analysis for amplifying the genomic fragment containing this wheat SNP

[0028] A SNP was found on chromosome 4B of the wheat genome, corresponding to position 1216 in SEQ ID NO: 1. Two genotypes were found at this locus in naturally occurring wheat populations.

[0029] Genotype A: C

[0030] Genotype B: G

[0031] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:

[0032] F1:AAATGGCAACCCTTGGGGGTG (SEQ ID NO: 2)

[0033] R1:ATGGCCATCTTCATGACAA (SEQ ID NO: 3)

[0034] F2: AACGAGACAGAAAAACATGA (SEQ ID NO: 4)

[0035] R2: TAGAGAGCGGCAGTACTGCT (SEQ ID NO: 5)

[0036] The target sequences for PCR amplification using primer pairs F1 and R1 are as shown in SEQ ID NO: 1 (positions 489-1740); the target sequences for PCR amplification using primer pairs F2 and R2 are as shown in SEQ ID NO: 1 (positions 1190-1304). Enzyme digestion analysis showed that this polymorphism could be recognized by BglII.

[0037] 1.2 Establishment of PCR-restriction polymorphism detection and genotyping methods

[0038] 1) Extract genomic DNA from the wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 7 μL ddH2O, 10 μL 2×Taq Mix, 1 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (20 ng / μL).

[0040] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 30 s, for 30 cycles; 72℃ for 10 min; and storage at 16℃.

[0041] 3) Dilute the PCR product from step 2) 10 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×Taq Mix 10 μL, primer F1 (10 μmol / L) and primer R1 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.

[0042] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 15 s, for 32 cycles; 72℃ for 10 min, and stored at 16℃.

[0043] 4) Digest the PCR product obtained in step 3) with BglII enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified site according to the following method:

[0044] If the enzyme digestion product is a single or large fragment, then the wheat being tested is homozygous for C at the specified site (represented as C / C). Figure 2 Lane C in the middle of the swimming lane;

[0045] If the enzyme digestion product consists of two or smaller fragments, then the wheat being tested is homozygous for G at the specified site (represented as G / G). Figure 2 Lane G in the middle of the swim.

[0046] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:

[0047] I: C / C (i.e., homozygous genotype A);

[0048] II: G / G (i.e., homozygous genotype B);

[0049] The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.

[0050] 1.3. Genotyping of natural populations using dCAPS markers and association analysis with the number of ears per plant trait.

[0051] Each wheat variety in a natural population consisting of 348 hexaploid wheat varieties was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of some wheat varieties were randomly sequenced for verification. The results are shown in Table 1.

[0052] Table 1. Information on the polymorphic sites described in natural wheat populations.

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 2: Association Analysis of Gene Polymorphism Sites and Number of Ears per Plant in Natural Populations

[0059] Our technical team conducted exon capture sequencing on 397 materials and performed specific genotyping on these materials. Genotyping included two cases: homozygous C / C genotype A and homozygous G / G genotype B. For example... Figure 4 Of the 397 materials, 372 materials could be clearly distinguished as homozygous C / C genotype A or homozygous G / G genotype B, while the remaining 25 materials could not be genotyped.

[0060] Furthermore, of these 397 materials, 348 had agronomic trait data from multiple years and locations, while the remaining 49 materials lacked sufficient data to meet the requirements for subsequent analysis. Therefore, as shown in Table 2 and... Figure 3 As shown, only these 348 data points were used in the association analysis between the genetic polymorphism sites in natural populations and the number of ears per plant. However, among these 348 data points, 17 materials did not have genotyping, so the actual number of samples used for association analysis was 331.

[0061] In 2019, wheat populations of the above-mentioned natural populations were planted in dry-hot and dry-hot and hydrothermal fields at the Third Branch Experimental Station of Hebei Agricultural University (Baoding, Hebei); in 2020, they were planted in dry-hot and dry-hot and hydrothermal and hydrothermal fields at the Hengshui Experimental Site of Hebei Agricultural University (Baoding and Hengshui, Hebei); and in 2021, they were planted in dry-hot and dry-hot fields at the Gaocheng Experimental Site of Hebei Agricultural University (Gaocheng Experimental Station). The number of spikes per plant for each wheat variety was investigated. The association between the number of spikes per plant and the polymorphic loci was analyzed using Tassel 2.1 software. A mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P < 0.05 considered significant. The results are shown in Table 2. Figure 3 As shown.

[0062] Table 2. Results of association analysis between gene polymorphism sites in natural populations and the number of ears per plant.

[0063]

[0064] The association analysis results in Table 2 show that the differences in the number of spikes per plant between the two types in the natural population composed of 348 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, the number of spikes per plant was lower in type I wheat than in type II wheat. In several environments, the number of spikes per plant was 0.53, 0.41, 0.35, 0.32, 0.77, 0.65, 0.45, 0.36, 0.28, and 0.62 fewer than in type II wheat, respectively. The study of the natural population indicates that type II is a superior genotype for increasing the number of spikes per plant in wheat.

[0065] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0066] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. A SNP locus associated with the number of ears per wheat plant, characterized in that: The SNP site corresponds to the 1216th base of the sequence shown in SEQ ID NO:

1. When this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B. The number of ears per plant is as follows: wheat homozygous genotype A is smaller or candidate smaller than wheat homozygous genotype B.

2. A reagent or kit for identifying or assisting in the identification of the number of ears per wheat plant, characterized in that: The reagent or kit is used to detect the SNP site described in claim 1. The reagent or kit contains a PCR amplification specific primer combination and enzyme digestion component corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection.

3. The reagent or kit according to claim 2, characterized in that: The target DNA fragment for PCR amplification using this reagent or kit is designed to be 1190-1304 bp from the 5' end of SEQ ID NO:

1.

4. The reagent or kit according to claim 2, characterized in that: The PCR amplification specific primer combination includes: primer pairs 1F and 1R consisting of SEQ ID NO: 2 and SEQ ID NO: 3, and primer pairs 2F and 2R consisting of SEQ ID NO: 4 and SEQ ID NO:

5.

5. The reagent or kit according to claim 2, characterized in that: The enzyme digestion component is the restriction endonuclease BglII.

6. A method for identifying or assisting in the identification of the number of ears per wheat plant in the early stages of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to amplify any DNA fragment containing the SNP site in the wheat genomic DNA to be tested by PCR. The wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat single-plant spike number phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: the single-plant spike number of wheat homozygous genotype A is less than or candidate less than that of wheat homozygous genotype B.

7. The method according to claim 6, characterized in that: The DNA fragment amplified by PCR is the 5' end 1190-1304bp of SEQ ID NO: 1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO: 2 and SEQ ID NO: 3 and primer pair 2F and 2R composed of SEQ ID NO: 4 and SEQ ID NO: 5; the restriction endonuclease BglII is used for enzyme digestion.

8. The method according to claim 6, characterized in that: The enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting this PCR product 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease BglII; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of ears per plant is: wheat homozygous for genotype A is smaller or candidate smaller than wheat homozygous for genotype B.

9. The use of the wheat SNP site according to claim 1, characterized in that: The purpose is to screen or assist in screening the spike number phenotype of wheat plants in the early stage of molecular marker-assisted selection breeding.

10. Primer combination, characterized in that: The primer pair comprises primers 1F and 1R consisting of SEQ ID NO: 2 and SEQ ID NO: 3, and primers 2F and 2R consisting of SEQ ID NO: 4 and SEQ ID NO: 5; this primer combination is used to detect the SNP site described in claim 1.

Images