A kasp molecular marker primer for detecting a bright green trait of brassica rapa and application thereof

Abstract

The present application relates to the field of molecular biology, and particularly relates to a KASP molecular marker primer for detecting the bright green trait of Chinese cabbage and application. The KASP molecular marker primer comprises a forward primer 1 shown in SEQ ID NO. 6, a forward primer 2 shown in SEQ ID NO. 7 and a reverse primer shown in SEQ ID NO. 8. The present application identifies the bright green trait of Chinese cabbage through the KASP molecular marker primer, and provides a theoretical basis for Chinese cabbage breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to a KASP molecular marker primer for detecting the bright green trait in Chinese cabbage and its application. Background Technology

[0002] Chinese cabbage is one of the most important leafy vegetables globally. With rising living standards and increasing consumer demand for high-quality vegetables, appearance traits have become a key determinant of the commercial value of Chinese cabbage. Among these traits, leaf gloss has become a crucial characteristic significantly influencing consumer preference. Therefore, cloning and functionally identifying the genes controlling the gloss of Chinese cabbage leaves provides valuable genetic resources for molecular breeding.

[0003] The glossiness of leaves is primarily determined by the accumulation of cuticle wax deposited on the plant surface. This wax is composed of long-chain fatty acids and their derivatives. The biosynthesis of cuticle wax is a complex process. In Arabidopsis thaliana, numerous genes involved in the wax biosynthesis pathway have been identified. LACSs , CER1 , KCS1 , LTPG2 and ABCG32 It plays a key role in the formation of cuticle wax in Arabidopsis thaliana.

[0004] The genetic patterns of the glossy, wax-free trait in Brassica crops are complex, exhibiting significant differences between different populations. The presence or absence of wax in Brassica crops is often a crucial indicator of their commercial quality. Therefore, developing specific molecular markers related to the wax-free trait is of great importance for breeding new varieties of Brassica rapa with glossy green leaves and no wax. Summary of the Invention

[0005] To uncover genes associated with the bright green leaf trait in Chinese cabbage, this invention provides a KASP molecular marker primer for detecting the bright green trait in Chinese cabbage and its application. This invention uses KASP molecular marker primers to identify Chinese cabbage with the bright green trait, providing a theoretical basis for Chinese cabbage breeding.

[0006] This invention provides a KASP molecular marker primer for detecting the bright green trait in Chinese cabbage, comprising: The forward primer 1 shown in SEQ ID NO.6, the forward primer 2 shown in SEQ ID NO.7, and the reverse primer shown in SEQ ID NO.8.

[0007] This invention uses KASP molecular marker primers to identify Chinese cabbage with a bright green trait (without wax powder) and Chinese cabbage with a grayish-green trait (with wax powder), providing a theoretical basis for Chinese cabbage breeding. Furthermore, the 5' end of the forward primer 1 is given a HEX fluorescent adapter sequence, and the 5' end of the forward primer 2 is given a FAM fluorescent adapter sequence.

[0008] This invention also provides a method for identifying the bright green trait of Chinese cabbage, comprising the following steps: DNA was extracted from the cabbage to be tested; Using the DNA of the cabbage to be tested as a template, PCR amplification was performed using the KASP molecular marker primers described in claim 2; The amplified products were subjected to endpoint fluorescence signal detection. The genotype showing only the fluorescent marker color corresponding to the forward primer 2 was homozygous dominant, i.e., the waxy gray-green cabbage; the genotype showing only the fluorescent marker color corresponding to the forward primer 1 was homozygous recessive, i.e., the wax-free bright green cabbage; and the genotype showing a mixture of the fluorescent marker colors corresponding to both the forward primer 1 and the forward primer 2 was heterozygous waxy gray-green cabbage.

[0009] Furthermore, the PCR products were detected using a real-time PCR instrument and analyzed using LGC_OMEGA software. Genotypes aggregated near the X-axis were homozygous recessive genes, i.e., non-waxygenated Chinese cabbage; genotypes aggregated near the Y-axis were homozygous dominant genes, i.e., waxygenated Chinese cabbage; and genotypes in the middle were heterozygous waxygenated Chinese cabbage. Here, the X-axis represents the relative value of the FAM fluorescence signal, and the Y-axis represents the relative value of the HEX fluorescence signal.

[0010] The present invention also provides an application of the KASP molecular marker primers described above in screening Chinese cabbage or Arabidopsis thaliana with bright green trait.

[0011] This invention also provides an application of the KASP molecular marker primers described above in the breeding of bright green Chinese cabbage or Arabidopsis thaliana.

[0012] The present invention also provides BrAAE4 The application of genes in regulating the bright green trait of Chinese cabbage, the aforementioned BrAAE4 The gene nucleotide sequence is shown in SEQ ID NO.1. BrAAE4 The mutation of C to T at the 557th base in the CDS region of the gene changes the appearance of Chinese cabbage from being covered with wax powder and grayish-green to having a bright green appearance with no wax crystals.

[0013] This invention uses mutation BrAAE4 Genes that give Chinese cabbage its bright green color provide a theoretical basis for Chinese cabbage breeding.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention identifies bright green Chinese cabbage using KASP molecular marker primers, providing a theoretical basis for Chinese cabbage breeding.

[0015] This invention is the first discovery BrAAE4 The gene has the function of regulating the glossy leaf phenotype of Chinese cabbage. The discovery of the novel function of this mutant gene enriches the research of functional genomics and promotes the progress of molecular breeding in cruciferous plants.

[0016] This invention discloses the KASP molecular marker, as shown in SEQ ID NO.1. When the base at position 557 is C, the leaf surface is covered with a layer of wax powder, exhibiting a grayish-green appearance. When the base at position 557 is T, the wax crystals on the leaf surface are absent, exhibiting a bright green appearance. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 For 'FT' and wdm22 Phenotypic characteristics and micrographs of the plant; In the diagram, A represents 'FT' and wdm22 Phenotype of the plant, scale bar: 5 cm; B shows the shape of water droplets on the surface of the leaves of the 'FT' plant, highlighted with a white box. Scale bar: 1 cm. C is wdm22 The morphology of water droplets on the leaf surface of the mutant plant is highlighted with white squares. Scale bar: 1 cm. D is a magnified image of the water droplet area on the leaf surface of the 'FT' plant. The contact angle is marked by a white line. Scale bar: 2mm. E is wdm22 Enlarged image of the water droplet area on the leaf surface of the mutant plant, with the contact angle marked by white lines. Scale bar: 2 mm. F shows the wax crystal deposition in the leaves of the 'FT' plant under a cryo-scanning electron microscope. G represents observation under a cryo-scanning electron microscope. wdm22 The deposition of wax crystals on the leaf epidermis.

[0019] Figure 2This is a distribution chart of SNP indices in MutMap for Chinese cabbage; the horizontal axis represents the name and length of each chromosome, the vertical axis represents the SNP-index value, and each point is the SNP-index. The red line is the mean of the SNP-index under the window, the pink line is the threshold line corresponding to the 99th percentile, the orange line is the threshold line corresponding to the 95th percentile, and the blue line is the threshold line corresponding to the 90th percentile.

[0020] Figure 3 The results of single nucleotide polymorphism (SNP) genotyping based on KASP technology; A represents the genotyping result of the single nucleotide polymorphism (SNP) (A07: 21,594,625). B represents the genotyping result of single nucleotide polymorphisms (SNPs) (A07: 37,091,419); blue dots, red dots, and green dots represent the T:T genotype, C:C genotype, and C:T genotype, respectively.

[0021] Figure 4 for BrAAE4 Gene cloning and sequence analysis; In the diagram, A represents 'FT' and wdm22 of BrAAE4 CDS sequence alignment results; B is 'FT' and wdm22 The sequence alignment results of the BrAAE4 protein; C represents the three-dimensional structure of the BrAAE4 protein with 'FT'. D is wdm22 The three-dimensional structure of the BrAAE4 protein.

[0022] Figure 5 For identification using the three-primer method aae4 Gel image of a homozygous Arabidopsis thaliana mutant.

[0023] Figure 6 For Arabidopsis thaliana BrAAE4 The results of gene function verification; In the diagram, A represents a 4-week-old Col-0 infant. aae4 And the morphological characteristics of transgenic plants, Pro35S::BrAAE4 in aae4 express Pro35S::BrAAE4 Carrier infection aae4 Positive plants obtained from homozygous mutants; B shows the surface morphology of leaves of Col-0 plants observed using a low-temperature scanning electron microscope; C represents observation using a low-temperature scanning electron microscope. aae4 Surface morphology of plant leaves; D represents low-temperature scanning electron microscopy observation of transgenic plants. Pro35S::BrAAE4 in aae4 The surface morphology of the blade; E shows the stem of a Col-0 Arabidopsis thaliana plant observed using a stereomicroscope. F represents observation using a stereomicroscope. aae4 Arabidopsis thaliana plant stem; G is for observation using a stereomicroscope. Pro35S::BrAAE4 in aae4 Stem of a transgenic Arabidopsis thaliana plant.

[0024] Figure 7 The contact angle measurements are for 'FT' and wdm22. Detailed Implementation

[0025] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0026] Example 1: I. Materials and Methods 1. Plant materials In this experiment, the wild-type 'FT' was a double haploid strain with a layer of wax powder on its surface, giving it a grayish-green appearance. wdm22 The mutant was a stably inherited plant obtained by mutagenesis of 'FT' seeds using 0.8% EMS. It lacked wax crystals and exhibited glossy leaves. All plants were grown in the greenhouse of the Vegetable Breeding Base of Shenyang Agricultural University.

[0027] 'FT' is a double haploid obtained in June 2004 using the Chinese cabbage hybrid 'Futian 50' through free microspore culture technology. It is a truly pure line in a genetic sense. It is recorded in the graduation thesis "Research on Free Microspore Embryo Induction and Plant Regeneration Technology of Chinese Cabbage".

[0028] wdm22 The specific steps for obtaining the mutants were as follows: 'FT' seeds were soaked in water at 25°C for 12 hours to germinate. The germinated seeds were then soaked in 0.8% ethyl methanesulfonate (EMS) as an alkylating agent in a shaker at 50 rpm for 12 hours. Subsequently, the treated seeds were thoroughly rinsed in running water for 12 hours and sown in trays in a greenhouse (25°C), thus constructing a diverse Chinese cabbage mutant library. After multiple generations of self-pollination and identification, 46 stable, bright-leaf mutants were screened. One of these was named... wdm22It is recorded in the graduation thesis "Identification and Cloning of Related Genes of Glossy Leaf Mutant in Chinese Cabbage".

[0029] 2. Leaf Water Drop Experiment Gently place a 5 μL drop of distilled water on the adaxial surface of a fully unfolded Chinese cabbage leaf. Photograph the droplet morphology and measure the contact angle. A larger contact angle indicates more wax deposition and higher hydrophobicity on the leaf surface. A smaller contact angle indicates less wax deposition and higher hydrophilicity. A contact angle < 90° indicates hydrophilicity, and a contact angle > 90° indicates hydrophobicity.

[0030] 3. Cryo-electron scanning microscope During the bolting stage, take 'FT' and... wdm22 Fresh plant leaves were used. The leaves were cut into 1mm × 3mm rectangular pieces using a sharp blade. They were fixed with 2% glutaraldehyde. The pieces were then rapidly frozen in liquid nitrogen, dried, and sprayed with gold (Balzers UnionSputtering Device, 25 mA, 300 s).

[0031] 4. Genetic analysis To study the inheritance patterns of genes controlling the bright leaf trait, this invention combines 'FT' with... wdm22 The F1 population was obtained by crossbreeding. The F1 population was then backcrossed with both parents to obtain the BC1 population. The F1 population was then self-crossed to obtain the F2 population. The phenotypes of each generation were observed and statistically analyzed using the chi-square test (χ²). 2 The segregation ratios of the BC1 and F2 populations were analyzed using a test.

[0032] 5. Use MutMap analysis to locate candidate genes. MutMap is a method for rapidly locating mutant genes in plants based on high-throughput sequencing technology. Fifty plants with the bright leaf phenotype from the F2 population were selected, and equal amounts of DNA were extracted and mixed to construct a bright leaf mutant library (F2-pool). 'FT', wdm22 DNA from F2-pool was sequenced using the Illumina NovaSeq platform. The quality of the raw high-throughput sequencing data was initially assessed and filtered to obtain high-quality data. The filtered high-quality data was then aligned to the reference genome using the bwamem program. SNP detection was performed using GATK software. SNP sites were annotated using ANNOVAR software.

[0033] 6. SNP genotyping using KASP analysis KASP assay was used for SNP genotyping to further identify candidate genes. Ninety F2 bright-leaf mutant plants, two 'FT' plants, and two [other mutants] were selected. wdm22Two F1 plants were used. DNA was extracted and KASP was performed. Specific primers for KASP analysis are shown in Table 2.

[0034] The specific steps are as follows: (1) DNA extraction was performed using the magnetic bead method. (2) DNA quality control: Several DNA working solutions were randomly selected and their concentrations were measured using NanoDrop2000. The A260 / A280 ratio was approximately 1.8, indicating that the samples were qualified. (3) Dilution: The primer powder was diluted to 100 μmol / ml, and the DNA was uniformly diluted to 20 ng / ul. (4) PCR amplification: SNP site detection used a set of thermal cycling conditions involving two temperature steps. In this protocol, the DNA was denatured at a higher temperature and then annealed and extended at the same lower temperature. The amplification procedure is shown in Table 1.

[0035] Table 1 Amplification Procedure (5) Fluorescence signal reading: After PCR amplification, fluorescence values ​​were read using a quantitative PCR instrument at a temperature below 40°C. In this method, SNP loci detection uses the fluorophores FAM and VIC to distinguish between two isogenetic loci. The passive reference dye ROX was used to correct for signal differences between wells due to reaction volume errors. We used LGC_OMEGA's genotyping software to analyze the above results. In this software, VIC and FAM data were plotted on the y-axis and x-axis, respectively. The VIC and FAM values ​​of each reaction well were corrected by the value of the reference dye (ROX) for that specific well, and the fluorescence values ​​were standardized to obtain the relative fluorescence values ​​of VIC and FAM for each PCR reaction well. Based on the relative fluorescence values, the samples were clustered, and the genotype was further determined based on the sample clusters and fluorescence types. (6) Genotyping results can be exported.

[0036] Table 2 KASP genotyping primer sequences SNP (A07:21,594,625) GAAGGTCGGAGTCAACGGATTGACAATCTCACCCTCTGGACTTC (SEQ ID NO.3) GAAGGTGACCAAGTTCATGCTGACAATCTCACCCTCTGGACTTT (SEQ IDNO.4) AGATATATTCATTCTTAATCTCAGATAAACC (SEQ IDNO.5) SNP (A07:37,091,419) GAAGGTCGGAGTCAACGGATTCTAGCAGCGAGTGGAACCC (SEQ ID NO.6) GAAGGTGACCAAGTTCATGCTCCTAGCAGCGAGTGGAACCT (SEQ IDNO.7) ATAGTACTCATGAAAACGGCACG (SEQ ID NO.8) Note: BraA07g041890.4C In this invention, genes are referred to as BrAAE4 The genes, with double underscores representing the fluorescent adapter sequences of HEX and FAM, are as follows: HEX fluorescent adapter sequence: GAAGGTCGGAGTCAACGGATT (SEQ ID NO.16); FAM fluorescent adapter sequence: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.17).

[0037] 7. Candidate gene cloning and sequence alignment BraA07g041890.4CThe gene sequence was obtained from the BRAD database (http: / / brassicadb.cn / #) and used as the PCR template. Specific primers were designed using Primer Premier 5.0. (For cloning...) BraA07g041890.4C The primer list for CDS is shown in Table 3. The target amplified fragment was separated by 1.5% agarose gel electrophoresis. The DNA fragment was purified and ligated into the pGEM-T Easy vector and transformed into *E. coli* DH5α cells. Positive clones were identified by colony PCR and sequenced. Sequence alignment was performed using DNAMAN. The three-dimensional structure of the protein was predicted using SWISS-MODEL.

[0038] Table 3. Used for cloning BraA07g041890.4C ( BrAAE4 CDS primer information 8. Vector construction and Arabidopsis genetic transformation Purchased from the Arabidopsis thaliana website AT1G77240 Mutant seeds, with the SALK number SALK_134426C, were used. Homozygous Arabidopsis mutant plants were identified using a three-primer method; the primers used are shown in Table 4. Wild-type Arabidopsis Col-0 and mutant Arabidopsis were used respectively. aae4 Using DNA as a template, amplification was performed using two pairs of primers (LP, RP) and (BP, RP). The position of the electrophoretic bands was used to determine whether the mutant was homozygous. BamHI and SalI The pSuper1300-GFP vector (manufacturer: Protech, catalog number: ZT5518) was double-digested using restriction enzymes. Subsequently, the candidate gene was... BraA07g041890.4C The CDS sequence was ligated with a double-digested vector to construct Pro35S::BrAAE4 The specific steps are as follows: The pSuper1300-GFP vector is used... BamHI and SalI Linearize the vector with restriction endonuclease (manufacturer: Novizan, catalog number: C401, C416), following the enzyme digestion instructions. Then, use... Pro35S :: BrAAE4 -F / -R primers were used for PCR amplification of the CDS sequence, making BraA07g041890.4C CDS sequence band BamHI and SalI Homologous arms of the restriction enzyme sites. Finally, following the homologous recombination kit from Tiangen (catalog number: CU201), the candidate gene was ligated. BraA07g041890.4C The CDS sequence and double-digested vector were recombined to construct Pro35S::BrAAE4 Vector. Primers used to construct the vector are shown in Table 5. Agrobacterium-mediated flower-dipping method was used to infect Arabidopsis Col-0 plants and aae4 Homozygous mutant plants.

[0039] Table 4 Identification aae4 Three-primer sequence of Arabidopsis thaliana homozygous mutant The forward primer (LP) upstream of the T-DNA insertion site SEQ ID NO.11: CGGCAGCAATAATCTTTTTAAAG Forward primers (BP) flanking the T-DNA insertion site SEQ ID NO.12:ATTTTGCCGATTTCGGAAC The forward primer (RP) downstream of the T-DNA insertion site. SEQ ID NO.13: TCAAATCTGTCGTGAGCAGAG Table 5 Construction Pro35S::BrAAE4 Primer sequences used in the vector ::-F SEQ ID NO.14: GAGCTCGGTACCCGGGGATCCATGGAACTTTTACTCCCACACC ::-R SEQ ID NO.15: GCCCTTGCTCACCATGTCGACAGGCAAAGACTTAGCCA II. Results Analysis 1. wdm22 Phenotypic characteristics like Figure 1 As shown, the leaf surface of the 'FT' plant is grayish-white, while wdm22 The plant's leaves are bright green. wdm22 The mutant exhibited a glossy leaf phenotype throughout the entire developmental cycle, especially during the heading stage. Figure 1 (A). Further tests using water droplets on the leaf blades showed that the water droplets exhibited a larger contact angle (131°) on the 'FT' blades, indicating stronger hydrophobicity. Figure 1 (B and D). Water droplets on wdm22 The leaves exhibit a smaller contact angle (63.83°), indicating stronger hydrophilicity. Figure 1 (C and E). Contact angle measurement data are available in [see...] Figure 7 Cryo-scanning electron microscopy revealed that the leaf surface of 'FT' contained epidermal wax crystal deposits, covering a dense layer of lamellar wax crystals. wdm22 There is almost no wax crystal accumulation on the blade surface ( Figure 1 (F and G).

[0040] 2. wdm22 Genes associated with the glossy leaf trait were identified. The traits of the F1, F2, and BC1 populations were identified and statistically analyzed, and the results are recorded in Table 6. All F1 plants exhibited the wild-type phenotype. Plants produced by backcrossing F1 with 'FT' also exhibited the wild-type phenotype. wdm22 Among the plants produced by backcrossing, the ratio of wild-type phenotype plants to glossy-leaf phenotype plants was 1.14:1, χ² 2 The value was 0.53. A total of 700 F2 plants were identified, and the ratio of wild-type phenotype plants to glossy-leaf phenotype plants was 2.68:1. 2 The value is 1.71. From the above statistical results, we can conclude that... wdm22 The glossy leaf phenotype is controlled by a single recessive nuclear gene.

[0041] Table 6 Mutants wdm22 Genetic analysis of the glossy leaf phenotype <![CDATA[P1(‘FT’)]]> 50 50 0 <![CDATA[P2( wdm22 )]]> 50 0 50 <![CDATA[F1(P1×P2)]]> 45 45 0 <![CDATA[F1(P2×P1)]]> 45 45 0 <![CDATA[BC1(F1×P1)]]> 120 120 0 <![CDATA[BC1(F1×P2)]]> 120 64 56 1.14:1 0.53 <![CDATA[F2]]> 700 510 190 2.68:1 1.71 3. MutMap sequencing analysis to locate candidate genes For 'FT', wdm22 MutMap sequencing was performed on mutant and F2-pool samples, yielding 175,935,758, 125,415,808, and 200,837,534 high-quality reads, respectively (Table 7). Compared to the original reads, 'FT', wdm22 The percentages of high-quality reads for the F2-pool macrosamples were 95.25%, 95.86%, and 95.88%, respectively. The percentages of successful mappings to the reference genome were 98.96%, 98.82%, and 98.86%, respectively (Table 8). This alignment identified a total of 1,778,570 single nucleotide polymorphisms (SNPs). A sliding window analysis was performed to calculate the SNP index. Genomic regions with SNP indices exceeding the 95th percentile threshold were defined as candidate regions (SNPs). Figure 2 These single nucleotide polymorphisms were selected based on the following criteria: located in an exon region, resulting in a nonsynonymous mutation, and having an SNP index of 1. After screening, only two single nucleotide polymorphisms remained on chromosome A07.

[0042] Table 7. Statistics of high-quality data in MutMap sequencing analysis 'FT' 175935758 95.25% 25884192632 92.81% 125415808 95.86% 18669470137 94.50% <![CDATA[F2-pool]]> 200837534 95.88% 29896177332 94.52% Note: During MutMap sequencing, the raw sequencing data was filtered using fastp (v0.20.0) and a sliding window method. This table displays relevant statistics for high-quality data. High-quality read count: The number of high-quality reads; High-quality read percentage: The proportion of high-quality read fragments relative to the raw read fragments; High-quality data (bp): The total number of base pairs that passed quality screening; High-quality data (%): The proportion of high-quality bases relative to the total raw bases.

[0043] Table 8. Statistics of sequence alignment results in MutMap sequencing analysis 'FT' 175935758 174110348 98.96% 125415808 123939637 98.82% <![CDATA[F2-pool]]> 200837534 198552522 98.86% Note: Total reads: The total number of high-quality reads in the bam file; Alignment reads: The number of reads aligned to the reference genome; Alignment rate: The percentage of reads aligned to the reference genome.

[0044] Table 9. Statistics of SNP annotation results in MutMap sequencing analysis total 1,774,492 100.0 UTR5; UTR3 1133 0.06 UTR5 34746 1.95 UTR3 49172 2.76 Upstream; Downstream 46574 2.62 Upstream 194127 10.91 Synonymous mutation 216707 12.18 SNPs that cause the loss of stop codons 596 0.03 SNPs that lead to the acquisition of stop codons 2285 0.13 shearing region 1247 0.07 Non-synonymous mutation 141157 7.94 Introns 324889 18.27 Intergenic regions 604803 34.01 Exon regions 366867 20.63 Downstream 155012 8.72 Unknown function area 6122 0.34 Note: Upstream: The region 1 kb upstream of the transcription start site; Downstream: The region 1 kb downstream of the transcription termination site; Upstream; Downstream: The regions upstream and downstream of the transcription start site.

[0045] 4. KASP analysis for screening candidate genes To verify the two candidate single nucleotide polymorphisms (SNPs), we analyzed a population of 90 bright-leaved F2 plants, 2 F1 plants, 2 'FT' plants, and 2 plants... wdm22 The mutant was genotyped using the KASP gene. Genotyping results showed that only the SNP (A07: 37,091,419) co-segregated with the bright leaf phenotype. Figure 3 A and Figure 3 The analysis of B) included 90 bright-leaved F2 plants, 2 F1 plants, 2 'FT' plants, and 2 plants. wdm22 Plants, with blue, red, and green dots representing the T:T, C:C, and C:T genotypes, respectively. Cosegregation data between SNP (A07: 21,594,625; A07: 37,091,419) genotypes and the population are shown in Table 10. Based on these results, this invention selects plants located in... BraA07g041890.4C The SNP (A07: 37,091,419) in the data is... wdm22 Candidate mutation sites for the medium-bright leaf phenotype. Because BraA07g041890.4C Homologous genes in Arabidopsis thaliana are AT1G77240 ( AtAAE4 Therefore, this invention will BraA07g041890.4C Named BrAAE4 .

[0046] Table 10 KASP genotyping results (SNP loci: A07: 21,594,625; A07: 37,091,419) 5. BrAAE4 Gene cloning and sequence analysis Cloning candidate genes in 'FT' BrAAE4 The CDS sequence, 1635 bp in length, is shown in SEQ ID NO.1. wdm22 Cloning candidate genes BrAAE4 The CDS sequence, 1635 bp in length, is shown in SEQ ID NO.2. Sequencing results indicate that... wdm22 mutants in BrAAE4 A C-to-T mutation occurred at the 557th base of the CDS region. Figure 4 The base substitution resulted in an amino acid substitution from proline to histidine (A). Figure 4(B). The cloning results validated the KASP genotyping results. The nonsynonymous mutation at this site caused a change in the three-dimensional structure of the BrAAE4 protein (B). Figure 4 (C and D).

[0047]

[0048]

[0049] 6. Verification through Arabidopsis thaliana genetic transformation BrAAE4 Gene function To verify BrAAE4 The present invention will have the following functions. Pro35S::BrAAE4 Vector transferred into Arabidopsis homozygous mutant aae4 In the middle, a replacement experiment was conducted. The three-primer method was used to identify... aae4 The homozygous mutant of Arabidopsis thaliana, the agarose gel electrophoresis results are as follows: Figure 5 As shown, the band position of the Col-0 plant is 1201 bp at LP+RP, and there is no band at BP+RP. The homozygous mutant plant shows no band at LP+RP, and the BP+RP position is between 592 and 892. The heterozygous mutant plant shows 1201 bp at LP+RP, and the BP+RP position is between 592 and 892. Compared to Col-0, aae4 The mutant exhibits a bright leaf phenotype (Figure 5, A). Through Pro35S::BrAAE4 Transgenic plants infected with the vector reverted to the wild-type phenotype. Figure 6 (A). Cryo-electron microscopy observation of the leaves of these three Arabidopsis thaliana strains revealed that... aae4 The mutant leaves had almost no wax crystals, while the leaves of Col-0 and the recombinant transgenic plants had a large amount of wax crystal deposits. Figure 6 B~ Figure 6 (D). We also observed the stems of Arabidopsis thaliana and found that the stem phenotype was consistent with that of the leaves. aae4 The stems of the mutants were shiny, while the stems of the Col-0 and replenished transgenic plants had a grayish-white appearance. Figure 6 E~ Figure 6 (G).

[0050] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments.

[0051] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A KASP molecular marker primer for detecting the bright green trait in Chinese cabbage, characterized in that, include: The forward primer 1 shown in SEQ ID NO.6, the forward primer 2 shown in SEQ ID NO.7, and the reverse primer shown in SEQ ID NO.

8.

2. The KASP molecular marker primers for detecting the bright green trait of Chinese cabbage according to claim 1, characterized in that, The forward primer 1 has a HEX fluorescent adapter sequence added to its 5' end, and the forward primer 2 has a FAM fluorescent adapter sequence added to its 5' end.

3. A method for identifying the bright green trait of Chinese cabbage, characterized in that, Includes the following steps DNA was extracted from the cabbage to be tested; Using the DNA of the cabbage to be tested as a template, PCR amplification was performed using the KASP molecular marker primers described in claim 2; The amplified products were subjected to endpoint fluorescence signal detection. The genotype showing only the fluorescent marker color corresponding to the forward primer 2 was homozygous dominant, i.e., the waxy gray-green cabbage; the genotype showing only the fluorescent marker color corresponding to the forward primer 1 was homozygous recessive, i.e., the wax-free bright green cabbage; and the genotype showing a mixture of the fluorescent marker colors corresponding to both the forward primer 1 and the forward primer 2 was heterozygous waxy gray-green cabbage.

4. The method for identifying the bright green trait of Chinese cabbage according to claim 3, characterized in that, PCR products were detected using a real-time PCR instrument and analyzed using LGC_OMEGA software. Genotypes clustered near the X-axis were homozygous recessive genes, i.e., non-waxygenated Chinese cabbage; genotypes clustered near the Y-axis were homozygous dominant genes, i.e., waxygenated Chinese cabbage; and genotypes in the middle were heterozygous waxygenated Chinese cabbage. The X-axis represents the relative value of the FAM fluorescence signal, and the Y-axis represents the relative value of the HEX fluorescence signal.

5. The application of the KASP molecular marker primer as described in claim 1 or 2 in screening Chinese cabbage or Arabidopsis thaliana for the bright green trait.

6. The application of the KASP molecular marker primer as described in claim 1 or 2 in the breeding of Chinese cabbage or Arabidopsis thaliana with the bright green trait.

7. BrAAE4 The application of genes in regulating the bright green trait of Chinese cabbage is characterized by, The BrAAE4 The gene nucleotide sequence is shown in SEQ ID NO.

1. BrAAE4 The mutation of C to T at the 557th base in the CDS region of the gene changes the appearance of Chinese cabbage from being covered with wax powder and grayish-green to having a bright green appearance with no wax crystals.

Images