A crisper-based herpes simplex virus typing detection method

Abstract

The application relates to the field of biotechnology, and particularly discloses a herpes simplex virus typing detection method based on CRISPR, provides a PRA primer and crRNA combination, a detection kit and a detection method thereof, the PRA primer and crRNA combination comprises HSV1 characteristic gene RPA forward and reverse primers, HSV2 characteristic gene RPA forward and reverse primers, and crRNA, the herpes simplex virus typing detection method is screened through a large number of RPA primers and crRNAs, a one-step CRISPR double detection system is established, RPA double amplification and CRISPR double detection are integrated into one reaction system, the operation steps are simplified, the reaction time is shortened, the risk of aerosol pollution is reduced, the detection specificity is high, the sensitivity is high, and therefore the typing detection efficiency, convenience and reliability are improved.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a CRISPR-based method for detecting herpes simplex virus typing. Background Technology

[0002] Herpes simplex virus (HSV) is a widespread and common virus that can cause a variety of diseases in humans, such as gingivostomatitis, keratoconjunctivitis, encephalitis, and infections of the reproductive system and newborns. It is characterized by clusters of blisters at the site of infection, and the virus remains latent in the body for life, waiting for an opportunity to recur. Humans are the only known primates to be infected with two different herpes simplex viruses: HSV-1 and HSV-2. Differentiating between HSV-1 and HSV-2 is clinically important. Although antiviral drugs are similar, they are significant in treatment regimens, prognosis, patient counseling, and public health. This is mainly because they differ fundamentally in their site of infection preference, recurrence frequency, transmission risk, and long-term health risks. These differences directly influence physicians' treatment strategies and patient health guidance.

[0003] Therefore, the rapid and accurate nucleic acid testing technology that distinguishes between HSV-1 and HSV-2 is a direct manifestation of modern precision medicine in the management of herpes virus infection, and is of great significance in helping doctors provide patients with the most optimized individualized medical plans.

[0004] Compared to traditional methods (such as virus culture and antigen detection), HSV nucleic acid testing has the advantages of high sensitivity and high specificity, especially for severe, atypical cases or central nervous system infections, where it is an indispensable diagnostic tool. PCR is the gold standard for nucleic acid testing, but it requires specialized laboratories and personnel, hindering its widespread application in resource-poor areas or primary healthcare institutions. Isothermal amplification technologies, represented by RPA and LAMP, offer advantages such as speed, convenience, and low equipment dependence for on-site applications, but non-specific amplification can easily lead to false positives. This is particularly true for testing systems requiring genotyping, where building a robust and highly specific genotyping system is even more challenging.

[0005] CRISPR-based molecular diagnostic technologies combine the accuracy of nucleic acid testing with the convenience of antigen testing, and are known as "next-generation molecular diagnostic technologies".

[0006] Therefore, this invention integrates the advantages of high sensitivity of RPA and high specificity of CRISPR to build a rapid HSV genotyping technology system, aiming to provide a novel solution for the accurate and rapid diagnosis of HSV infection. In early CRISPR detection methods, viral nucleic acid molecule amplification and CRISPR detection were two completely independent steps. These steps typically required opening the tube cap and pipetting, or pre-adding the CRISPR detection reagent to the tube cap or wall. After amplification, the mixture was briefly centrifuged to mix with the amplification product at the bottom of the tube, initiating the CRISPR reaction. Both strategies either significantly increased the risk of aerosol contamination or were complex to operate, hindering clinical translation.

[0007] Furthermore, there are no mature reports on a one-step dual CRISPR system for simultaneous HSV-1 and HSV-2 typing detection. The main challenge lies in how to be compatible with two sets of RPA primers, two Cas proteins (Cas12a and Cas13a) and their corresponding crRNA and reporter probes in the same reaction system, while balancing amplification efficiency and cleavage activity and avoiding mutual inhibition.

[0008] Therefore, developing a one-step CRISPR detection system that is easy to operate, allows for closed-tube testing, eliminates the risk of aerosol contamination, and can simultaneously perform highly specific and sensitive HSV-1 and HSV-2 typing is of significant clinical value and practical importance for promoting the translational application of HSV typing diagnosis in bedside and primary care settings. Summary of the Invention

[0009] The purpose of this invention is to provide a CRISPR-based method for detecting herpes simplex virus typing, in order to solve the problems mentioned in the background art, such as the poor efficiency and inconvenience of existing methods for detecting HSV-1 and HSV-2.

[0010] To achieve the above objectives, the present invention provides the following technical solution:

[0011] An RPA primer and crRNA combination, said combination comprising:

[0012] The nucleotide sequences of the forward and reverse primers for the HSV1 characteristic gene RPA are as follows:

[0013] 5'-TAATACGACTCACTATAGCTCAACATACCCCGCTGTTCTCGTTCCTCACT -3';

[0014] and 5'- CCATCGCACCAATACACAAAAACGATAAGGTG -3';

[0015] The nucleotide sequences of the forward and reverse primers for the HSV2 characteristic gene RPA are as follows:

[0016] 5'-TAAACGGTATCGTGTACCACTGTCACTGTC-3';

[0017] and 5'-TACCTTGATTTTGATTTTGATTTTGTGGCGTC-3';

[0018] And crRNA, whose nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:9.

[0019] A kit for detecting herpes simplex virus typing, comprising the RPA primer and crRNA combination as described in claim 1, wherein the crRNA shown in SEQ ID NO:3 is used to guide the LbuCas13a protein or LwaCas13a protein to specifically bind to HSV1 nucleic acid molecules; and the crRNA shown in SEQ ID NO:9 is used to guide the LbCas12a protein to specifically bind to HSV2 nucleic acid molecules.

[0020] It also contains LbCas12a and LbuCas13a or LwaCas13a proteins;

[0021] Nucleic acid probes include single-stranded DNA probes and single-stranded RNA probes; the nucleotide sequence of the single-stranded DNA probe is CCCCCCCC, with a fluorescent group ROX labeled at its 5' end and a quencher group BHQ2 labeled at its 3' end; the nucleotide sequence of the single-stranded RNA probe is UUUUUUUU, with a fluorescent group FAM labeled at its 5' end and a quencher group BHQ1 labeled at its 3' end.

[0022] A method for detecting the presence of HSV1 and HSV2 in a sample includes the following steps:

[0023] (i) Detecting the sample to be tested using the kit described in claim 2;

[0024] (ii) Detect the cutting status of the nucleic acid probes in the kit;

[0025] (iii) Based on the detection results of step (ii), the following determination is made: when the single-stranded RNA nucleic acid probe is cleaved, it indicates that HSV1 is present in the sample; when the single-stranded RNA nucleic acid probe is not cleaved, it indicates that HSV1 is not present in the sample; when the single-stranded DNA nucleic acid probe is cleaved, it indicates that HSV2 is present in the sample; when the single-stranded DNA nucleic acid probe is not cleaved, it indicates that HSV2 is not present in the sample.

[0026] Preferably, the cleavage status of the nucleic acid probe in step (ii) is detected by real-time monitoring of changes in fluorescence signal; when FAM fluorescence signal is detected, it indicates that the single-stranded RNA probe has been cleaved, and the sample is determined to contain HSV1 with a nucleic acid concentration of not less than 50 copies / test; when ROX fluorescence signal is detected, it indicates that the single-stranded DNA probe has been cleaved, and the sample is determined to contain HSV2 with a nucleic acid concentration of not less than 50 copies / test.

[0027] RPA primers and crRNA are used in the preparation of a herpes simplex virus (HSV) genotyping kit. The kit is used for HSV genotyping.

[0028] Compared with the prior art, the beneficial effects of the present invention are:

[0029] The herpes simplex virus typing detection method of this invention, after screening a large number of RPA primers and crRNA, established a one-step CRISPR dual detection system, which integrates RPA dual amplification and CRISPR dual detection into one reaction system. This simplifies the operation steps, shortens the reaction time, reduces the risk of aerosol contamination, and has high detection specificity and sensitivity, thereby improving the efficiency, convenience and reliability of typing detection. Attached Figure Description

[0030] Figure 1 RPA primer set screening results were detected by agarose gel electrophoresis.

[0031] Figure 2 Screening results for HSV1(A) and HSV2(B)crRNA.

[0032] Figure 3 The specific identification results of HSV1(A) and HSV2(B) are shown in the bar chart, which represents the fluorescence change value, and the curve chart represents the real-time detection curve. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0034] Example 1:

[0035] RPA primer design and screening

[0036] This invention selects the gG gene and UL55 gene as characteristic genes of HSV1 and HSV2, respectively. These genes are highly conserved and can be used for molecular identification. RPA primers are generally designed to be 30-35 bp in length, with other design requirements similar to those for PCR primers. Primer sequences are detailed in Table 1. The T7 promoter sequence (5' – TAATACGACTCACTATAG – 3') is added to either the front or back primer. The RPA reaction system is prepared according to Table 2, with the reaction program being: constant temperature 37℃, reaction time 30 min. The amplification effect of different primer combinations is detected by agarose gel electrophoresis. 2% agarose gel electrophoresis, 150V, 30 min. Template concentration is 1000 cp / μl.

[0037] Table 1 List of RPA primers

[0038] Primer name Sequence (5'-3') HSV-1_gG-RPA-F1 CTCAACATACCCCGCTGTTCTCGTTCCTCACT HSV-1_gG-RPA-F2 TCAACATACCCCGCTGTTCTCGTTCCTCAC HSV-1_gG-RPA-R1 TCGCACCAATACACAAAAACGATAAGGTGTGG HSV-1_gG-RPA-R2 CCATCGCACCAATACACAAAAACGATAAGGTG HSV-2_UL55-RPA-F1 GATAAACGGTATCGTGTACCACTGTCACTGTC HSV-2_UL55-RPA-F2 ATAAACGGTATCGTGTACCACTGTCACTGTC HSV-2_UL55-RPA-F3 TAAACGGTATCGTGTACCACTGTCACTGTC HSV-2_UL55-RPA-R1 ATACCTTGATTTTGATTTTGATTTTGTGGCGT HSV-2_UL55-RPA-R2 TACCTTGATTTTGATTTTGATTTTGTGGCGTC

[0039] Table 2 RPA Reaction System

[0040] Reagent Name Volume (μL) A Buffer 5 Forward Primer 0.5 Reverse Primer 0.5 template 2 B Buffer 0.5 <![CDATA[H2O]]> 1.5 Total 10ul

[0041] Four and six primer combinations were designed and screened for HSV-1 and HSV-2, respectively. T7 sequences were added to primer combinations with clear bands, high amplification efficiency, and high specificity to further test the amplification effect. Figure 1 As shown in Figure A, the amplification products of primers HSV-1-gG-RPA-F1 / R2 and HSV-2-UL55-RPA-F3 / R2 exhibited the most prominent target bands in electrophoresis gel electrophoresis. After adding the T7 promoter sequence to these two pairs of RPA primers with better amplification efficiency, further screening was performed, and the results are as follows: Figure 1 As can be seen from B, the optimal amplification primers are HSV-1-gG-T7-F1 / HSV-1-gG-RPA-R2 and HSV-2-UL55-RPA-F3 / R2.

[0042] Example 2:

[0043] sgRNA design and screening

[0044] Three suitable LwaCas13a crRNAs were designed for the HSV-1 gG gene amplification region, and seven crRNAs targeting LbCas12a were designed for HSV-2 UL55. The specific sequences are shown in Table 3. The synthesized crRNAs are ready for use.

[0045] Table 3 sgRNA sequence listing

[0046] crRNA name Sequence (5'-3') HSV-1-gG-crRNA1 <![CDATA[GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC AUGACGGUGCUGACGACGAAGAGGGUGU ]]> HSV-1-gG-crRNA2 <![CDATA[GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC ACGGUGCUGACGACGAAGAGGGUGUCCA ]]> HSV-1-gG-crRNA3 <![CDATA[GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC GUGCUGACGACGAAGAGGGUGUCCAGGG ]]> HSV-2-UL55-crRNA1 <![CDATA[UAAUUUCUACUAAGUGUAGAU UCCAAAACCUGCUGGCUCGG ]]> HSV-2-UL55-crRNA2 <![CDATA[UAAUUUCUACUAAGUGUAGAU GCUCUAUAAGCUCAAGCGGC ]]> HSV-2-UL55-crRNA3 <![CDATA[UAAUUUCUACUAAGUGUAGAU UGCCGCGCGAGCGGCCGUGC ]]> HSV-2-UL55-crRNA4 <![CDATA[UAAUUUCUACUAAGUGUAGAU AGCUUAUAGAGCGAAGGUGU ]]> HSV-2-UL55-crRNA5 <![CDATA[UAAUUUCUACUAAGUGUAGAU UAGAGCGAAGGUGUUGUAGG ]]> HSV-2-UL55-crRNA6 <![CDATA[UAAUUUCUACUAAGUGUAGAU UAGGGCCGCGGAUGCCCCGA ]]> HSV-2-UL55-crRNA7 <![CDATA[UAAUUUCUACUAAGUGUAGAU GAGAACGGAUACCGACAGUG ]]>

[0047] 1. Establish a one-step dual typing detection system for HSV1 and HSV2.

[0048] A one-step dual typing assay system was prepared according to the reaction group allocation. During RPA amplification, different CRISPR / Cas systems within the system were used for target detection, and the presence or absence of the target was determined by different fluorescence signals. The reaction system is shown in Table 4. The reaction conditions were 37℃, 45 min, with FAM and ROX fluorescence signals collected every 30 s.

[0049] Table 4. RPA-Cas12 / Cas13 One-Step Dual Genotyping Detection Reagent System

[0050] A Buffer 5 HSV1-gG-T7-F1 (10μM) 0.1 HSV1-gG-R2 (10μM) 0.1 HSV2-UL55-F3 (10μM) 0.4 HSV2-UL55-R2 (10μM) 0.4 B Buffer 0.5 Template (1000 cp / μL) 1 LbCas12a (10μM) 0.2 UL55-crRNA5 (10μM) 0.4 ssDNA-Reporter (10μM) 0.5 LwaCas13a (10μM) 0.2 gG-crRNA3 (10μM) 0.4 ssRNA-Reporter (10μM) 0.5 NTPs (25mM) 0.2 T7 RNA polymerase (50U / μL) 0.1 <![CDATA[H2O]]> / total 10

[0051] 2. Screening of crRNA

[0052] The crRNA screening results of the HSV1 detection system are as follows: Figure 2 As shown in Figure A, all three crRNAs could detect the amplified and transcribed target RNA sequence. Among them, HSV1-gG-crRNA3 produced the strongest trans-cleavage fluorescence signal within the same time frame. Therefore, crRNA3 was ultimately selected as the crRNA for LwaCas13a, the target of HSV1-gG. The crRNA screening results for the HSV2 detection system are shown below. Figure 2 As shown in B, five RNAs, crRNA1, crRNA2, crRNA4, crRNA5, and crRNA6, can produce positive detection signals. Among them, crRNA6 has a strong fluorescence signal value, so crRNA6 was selected as the crRNA of LbCas12a, which is the target of HSV2 UL55.

[0053] Example 3 Detection Kit

[0054] Prepare a kit for HSV genotyping detection according to the following composition:

[0055] A Buffer, 10 μM forward and reverse primers; B Buffer, 10 μM LbCas12a, 10 μM M waCas13a, 50 U / μL T7 RNA polymerase, 10 μM crRNA, 10 μM ssDNA Reporter, 10 μM ssRNA-Reporter, 25 mM NTPs, and ddH2O.

[0056] The primers were the combination HSV-1-gG-T7-F1 / HSV-1-gG-RPA-R2 and HSV-2-UL55-RPA-F3 / R2 described in Example 1; the crRNAs were HSV1-gG-crRNA3 and HSV2-UL55-crRNA6 described in Example 2.

[0057] The reaction system for this kit can be as follows: Buffer A 5 μL, 10 μM HSV-1-gG-T7-F1 / HSV-1-gG-RPA-R2 0.1 μL each, HSV-2-UL55-RPA-F3 / R2 0.4 μL each, Buffer B 0.5 μL, 10 μM LbCas12a 0.2 μL, 10 μM LwaCas13a 0.2 μL, 50 U / μL T7 RNA polymerase 0.1 μL, 10 μM crRNA3 and crRNA6 0.4 μL each, 10 μM ssDNA Reporter 0.5 μL, 10 μM ssRNA-Reporter 0.5 μL, 25 mM NTPs 0.2 μL, template 1 μL, and add enzyme-free sterile water to a total reaction volume of 10 μL.

[0058] The reaction procedure for this kit is: 37°C for 30 seconds (collecting FAM and ROX fluorescence signals), for a total of 90 cycles.

[0059] When this kit is used to detect samples, a detection curve is obtained from the fluorescence signal detected by the instrument.

[0060] Example 4: Specificity and Sensitivity Detection

[0061] 1. Specific detection

[0062] Plasmids containing the HSV-1-gG and HSV-2-UL55 genes, respectively, were used as positive controls. Specificity was validated using three clinically relevant pathogens that are prone to cross-reactivity (including varicella-zoster virus (VZV), Epstein-Barr virus (EBV), and Neisseria gonorrhoeae NG) and five oral swab samples (numbered H1-H5) that were not infected with herpes simplex virus.

[0063] Test results as follows Figure 3As shown, compared to the template-free control, only HSV1 showed a significant detection signal in the FAM fluorescence channel, and only HSV-2 showed a significant detection signal in the ROX fluorescence channel. The background signals for other viral or pathogenic nucleic acids showed no significant difference compared to the template-free control.

[0064] Test results show that the RPA-Cas12 & Cas13 one-step dual HSV typing detection system established in Example 2 has good specificity.

[0065] 2. Sensitivity Analysis

[0066] Sensitivity refers to the lowest concentration of a sample that a detection system can detect, also known as the limit of detection (LOD).

[0067] The plasmid containing the target gene was serially diluted, and 1 μL of DNA from each concentration was used as a template. The detection was performed according to the one-step dual typing system in Example 2. The experiment was repeated 8 times. The template concentration corresponding to the detection rate of 95% was calculated using the Sigmoid function as the LOD of the system.

[0068] The results are shown in Tables 5 and 6. The LOD of this system is 28 copies / test for HSV1 and 38 copies / test for HSV2.

[0069] Table 5 Sensitivity test results of the HSV-1 one-step dual detection system

[0070] 20 100% (8 / 8) 100% (8 / 8) 75% (6 / 8) 37.5% （3 / 8） 37.5% （3 / 8） 50 30 100% (8 / 8) 100% (8 / 8) 87.5% (7 / 8) 37.5% （3 / 8） 37.5% （3 / 8） 40 40 100% (8 / 8) 100% (8 / 8) 87.5% (7 / 8) 37.5% （3 / 8） 37.5% （3 / 8） 40 45 100% (8 / 8) 100% (8 / 8) 100% (8 / 8) 37.5% （3 / 8） 50% （4 / 8） 28

[0071] Table 6 Sensitivity test results of the HSV-2 one-step dual detection system

[0072] 20 100% (8 / 8) 37.5% (3 / 8) 0%(0 / 8) 0% ( / 8) 0% (0 / 8) 124 30 100% (8 / 8) 100% (7 / 8) 37.5% (3 / 8) 25% (2 / 8) 0% (0 / 8) 115 40 100% (8 / 8) 100% (8 / 8) 62.5% (5 / 8) 50% (4 / 8) 25%(2 / 8) 65 45 100% (8 / 8) 100% (8 / 8) 87.5% (7 / 8) 62.5% (5 / 8) 37.5% (3 / 8) 38

[0073] In this invention, the terms "guide RNA," "gRNA," or "crRNA" refer to RNA that guides Cas proteins (such as LbCas12a, LwaCas13a, and LbuCas13a proteins) to specifically bind to target nucleic acid (DNA or RNA) sequences.

[0074] The term "CRISPR" refers to clustered regularly interspaced short palindromic repeats, which are the immune system of many prokaryotes.

[0075] The term "Cas protein" refers to CRISPR-associated proteins, which are related proteins in the CRISPR system.

[0076] The term "LbCas12a" refers to a type II VA CRISPR-Cas system derived from the bacterium Lachnospiraceae bacterium, which is a crRNA-guided, DNA-targeting endonuclease.

[0077] The term "LbuCas13a" refers to a type II VI CRISPR-Cas system derived from the bacterium *Leptotrichia buccalis*, which is a crRNA-guided, RNA-targeting endonuclease.

[0078] The term "LwaCas13a" refers to a type II type VI CRISPR-Cas system derived from the bacterium Leptotrichia wadei, which is a crRNA-guided, RNA-targeting endonuclease.

[0079] The term "RPA" stands for recombinase polymerase amplification, a temperature-controlled nucleic acid amplification technique suitable for gene diagnosis.

[0080] CRISPR diagnostics is a rapid molecular detection technology based on the targeted recognition of pathogen nucleic acids by proteins associated with clustered regularly spaced short palindromic repeat sequences under RNA guidance. Compared with existing molecular diagnostic technologies such as quantitative PCR and next-generation sequencing, CRISPR diagnostics has advantages such as sensitivity, specificity, speed, convenience and low cost, and can be widely used in many fields such as point-of-care testing (POCT), clinical infection detection, tumor screening, companion diagnostics, and food safety.

[0081] For pathogens targeting DNA, CRISPR diagnostics primarily utilizes the Cas12 protein to specifically bind to single-stranded or double-stranded DNA and induce cleavage, thereby activating non-specific trans cleavage of single-stranded DNA. For pathogens targeting RNA, the Cas13 protein is used to specifically bind to single-stranded RNA and induce cleavage, thereby activating non-specific trans cleavage of single-stranded RNA. The substrates for trans cleavage are often molecular probes with fluorescent groups or biotin-labeled probes used for colloidal gold detection. In this application, the molecular probes used for fluorescence detection have a fluorescent group ROX or FAM and a quencher group BHQ1 or BHQ2 attached to their 5' and 3' ends, respectively. The DNA probe sequence is ROX-CCCCCCCC-BHQ2, and the RNA probe sequence is FAM-UUUUUUUU-BHQ1. When the pathogen's genome is present in the detection system, the CRISPR / Cas protein, guided by crRNA, cleaves the viral nucleic acid, activating its trans activity. The corresponding detection probe is cleaved and generates corresponding fluorescence, thus achieving target detection.

[0082] It should be understood that numerous specific implementation decisions can be made during the development of any practical implementation, such as in any engineering or design project. Such development efforts may be complex and time-consuming, but for those skilled in the art who benefit from this disclosure, the development effort will be a routine work of design, manufacturing, and production without requiring much experimentation.

[0083] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

[0084] Sequence List:

[0085] SEQ ID NO. 1

[0086] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAUGACGGUGCUGACGACGAAGAGGGUGU

[0087] SEQ ID NO. 2

[0088] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACACGGUGCUGACGACGAAGAGGGUGUCCA

[0089] SEQ ID NO. 3

[0090] GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUGCUGACGACGAAGAGGGUGUCCAGGG

[0091] SEQ ID NO. 4

[0092] UAAUUUCUACUAAGUGUAGAUUCCAAAACCUGCUGGCUCGG

[0093] SEQ ID NO. 5

[0094] UAAUUUCUACUAAGUGUAGAUGCUCUAUAAGCUCAAGCGGC

[0095] SEQ ID NO. 6

[0096] UAAUUUCUACUAAGUGUAGAUUGCCGCGCGAGCGGCCGUGC

[0097] SEQ ID NO. 7

[0098] UAAUUUCUACUAAGUGUAGAUAGCUUAUAGAGCGAAGGUGU

[0099] SEQ ID NO. 8

[0100] UAAUUUCUACUAAGUGUAGAUUAGAGCGAAGGUGUUGUAGG

[0101] SEQ ID NO. 9

[0102] UAAUUUCUACUAAGUGUAGAUUAGGGCCGCGGAUGCCCCGA

[0103] SEQ ID NO. 10

[0104] UAAUUUCUACUAAGUGUAGAUGAGAACGGAUACCGACAGUGSEQ ID NO. 2

[0105] SEQ ID NO.11

[0106] HSV-1-gG>

[0107] CCTTGGTTCCGACGCCTCAACATACCCCGCTGTTCTCGTTCCTCACTGCCTCCCCCGCCCTGGACACCCTCTTCGTCGTCAGCACCGTCATCCACACCTTATCGTTTTTGTGTATTGGTGCGATGGCGACACACCTGTGTGGCGGTTGGTCCAGACGCGGGCGACGCACACACCCTAGCGTGCGTTACGTGTGCCTGCCG

[0108] SEQ ID NO.12

[0109] HSV-2-UL55>

[0110] GAATACACGATAAACGGTATCGTGTACCACTGTCACTGTCGGTATCCGTTCTCCAAAACCTGCTGGCTCGGGGCATCCGCGGCCCTACAACACCTTCGCTCTATAAGCTCAAGCGGCACGGCCGCTCGCGCGGCAGAACAGCGACGCCACAAAATCAAAATCAAAATCAAGGTATAACCCACCCCCTTCCCTCCGAGTCC。

Claims

1. A combination of RPA primers and crRNA, characterized in that, The combination includes: The nucleotide sequences of the forward and reverse primers for the HSV1 characteristic gene RPA are as follows: 5'TAATACGACTCACTATAG CTCAACATACCCCGCTGTTCTCGTTCCTCACT-3'; and 5'- CCATCGCACCAATACACAAAAACGATAAGGTG -3'; The nucleotide sequences of the forward and reverse primers for the HSV2 characteristic gene RPA are respectively 5'-TAAACGGTATCGTGTACCACTGTCACTGTC-3'; and 5'-TACCTTGATTTTGATTTTGATTTTGTGGCGTC-3'; And crRNA, whose nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:

9.

2. A kit for detecting herpes simplex virus typing, characterized in that: The invention comprises the RPA primer and crRNA combination as described in claim 1, wherein the crRNA shown in SEQ ID NO:3 is used to guide the LbuCas13a protein or LwaCas13a protein to specifically bind to the HSV1 nucleic acid molecule; and the crRNA shown in SEQ ID NO:9 is used to guide the LbCas12a protein to specifically bind to the HSV2 nucleic acid molecule. It also contains LbCas12a and LbuCas13a or LwaCas13a proteins; Nucleic acid probes include single-stranded DNA probes and single-stranded RNA probes; the nucleotide sequence of the single-stranded DNA probe is CCCCCCCC, with a fluorescent group ROX labeled at its 5' end and a quencher group BHQ2 labeled at its 3' end; the nucleotide sequence of the single-stranded RNA probe is UUUUUUUU, with a fluorescent group FAM labeled at its 5' end and a quencher group BHQ1 labeled at its 3' end.

3. A method for detecting the presence of HSV1 and HSV2 in a sample, for non-disease diagnostic purposes, characterized in that, Includes the following steps: (i) Detecting the sample to be tested using the kit described in claim 2; (ii) Detect the cutting status of the nucleic acid probes in the kit; (iii) Based on the detection results of step (ii), the following determination is made: when the single-stranded RNA nucleic acid probe is cleaved, it indicates that HSV1 is present in the sample; when the single-stranded RNA nucleic acid probe is not cleaved, it indicates that HSV1 is not present in the sample; when the single-stranded DNA nucleic acid probe is cleaved, it indicates that HSV2 is present in the sample; when the single-stranded DNA nucleic acid probe is not cleaved, it indicates that HSV2 is not present in the sample.

4. The method according to claim 3, characterized in that: The cleavage status of the nucleic acid probe described in step (ii) is detected by real-time monitoring of changes in fluorescence signals; when FAM fluorescence signal is detected, it indicates that the single-stranded RNA probe has been cleaved, and the sample is determined to contain HSV1 with a nucleic acid concentration of not less than 50 copies / test; when ROX fluorescence signal is detected, it indicates that the single-stranded DNA probe has been cleaved, and the sample is determined to contain HSV2 with a nucleic acid concentration of not less than 50 copies / test.

5. The application of the RPA primer and crRNA combination as described in claim 1 in the preparation of a herpes simplex virus typing detection kit.

6. The application of the kit according to claim 2 in the preparation of herpes simplex virus typing detection.

Images