Quality control markers for megakaryocytes

Abstract

The present application provides a quality control marker for megakaryocytes, which is constituted by a transcription product or a protein of a Ral (RAS-like proto-oncogene) gene. In addition, the present application also provides a quality evaluation method for megakaryocytes, which comprises a step of detecting one or more of the above-mentioned biomarkers in megakaryocytes.

Description

Technical Field

[0001] This invention relates to quality control biomarkers for megakaryocytes. More specifically, it relates to quality control biomarkers for megakaryocytes composed of transcripts or proteins of the Ral gene. Background Technology

[0002] Despite ongoing supply shortages due to factors such as viral contamination, ineffective alloimmune transfusions, and the recent COVID-19 pandemic, donor-dependent platelet transfusions remain a standard medical practice. In this context, the inventors have adopted a strategy for the ex vivo production of blood products using human induced pluripotent stem cells (iPSCs). The inventors have developed an immortalized megakaryocyte line (imMKCL) as the starting cell source for the ex vivo production of iPSC-derived platelets (iPSC-PLT) (Non-Patent Literature 1, 2). imMKCL exhibited continuous proliferation for several months in the presence of doxycycline (DOX), released iPSC-PLT upon DOX removal, and can be used to prepare 10... 11 More than one iPSC-PLT (Non-Patent Literature 3). Based on these results, the inventors initiated the first human clinical trial (iPLAT1) of iPS cell-derived platelets as the world's first clinical trial (Non-Patent Literature 4–6). iPLAT1 showed promising results with no significant side effects, but a transient increase in D-dimer levels and an increase in white blood cell count were observed after transfusion of the maximum dose (Non-Patent Literature 4). These observations suggested the involvement of recently identified immune-biased megakaryocytes (Non-Patent Literature 7, 8), raising concerns about the quality control of imMKCL as the master cell. On the other hand, the inventors found that the quality of imMKCL clones exhibited considerable deviations in proliferation and iPSC-PLT production capacity (Non-Patent Literature 9). Specifically, certain imMKCL clones exhibiting cellular senescence showed a decreased ability to produce iPSC-PLT, but this ability was restored by knocking down p53 and CDKN1A (Non-Patent Literature 9). However, the molecular factors that are the root cause of this heterogeneity remain unclear, and they have clearly hampered the efficiency and standardization of iPSC-PLT manufacturing.

[0003] Existing technical documents Non-patent literature Non-patent literature 1: Takayama, N. et al. J Exp Med 207, 2817-2830 (2010); Non-patent literature 2: Nakamura, S. et al. Cell Stem Cell 14, 535-548 (2014); Non-patent literature 3: Ito, Y. et al. Cell 174, 636-648.e618 (2018); Non-patent literature 4: Sugimoto, N. et al. Blood 140, 2398-2402 (2022); Non-patent literature 5: Sugimoto, N. et al. Blood Adv 6, 6056-6069 (2022); Non-patent literature 6: Chen, SJ, Sugimoto, N. & Eto, K. Int J Hematol 117, 349-355 (2023); Non-patent literature 7: Wang, H. et al. Cell Stem Cell 28, 535-549.e538 (2021); Non-patent literature 8: Sun, S. et al. Blood 138, 1211-1224 (2021); Non-patent literature 9: Sone, M. et al. Stem Cell Reports 16, 2861-2870 (2021). Summary of the Invention

[0004] The problem that the invention aims to solve Therefore, the objective of this invention is to provide biomarkers for controlling megakaryocyte quality by elucidating the molecular factors that are the root cause of the heterogeneity.

[0005] Methods for solving problems A member of the inventors' research team encountered a lack of reproducibility in platelet production efficiency during studies using megakaryocytes (MK). Further investigation revealed that the cause of this lack of reproducibility was long-term megakaryocyte culture, leading to megakaryocyte senescence. Analysis of RNA seq data showed that long-term megakaryocyte culture resulted in senescence and enhanced immune properties. This led to the hypothesis that elucidating the mechanism of megakaryocyte senescence might be crucial for maintaining megakaryocyte quality. To elucidate this mechanism, the inventors focused on microRNAs.

[0006] MicroRNAs (miRNAs) are small non-coding RNAs that negatively regulate the stability or translation of target mRNAs by binding to complementary mRNA sequences. It is well-established that miRNAs play a crucial role in cell fate determination or function in hematopoietic cells (Mehta, A. & Baltimore, D. Nat Rev Immunol 16, 279-294 (2016)). Building on evidence that DNA-based gene circuits regulate protein expression not by miRNA expression but by miRNA activity (Mullokandov, G. et al. Nat Methods 9, 840-846 (2012)), the inventors have developed an innovative biotechnological method, the miRNA switch, which can identify specific cell types (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015); Fujita, Y. et al. Sci Adv 8, eabj1793 (2022)). The miRNA switch can detect endogenous miRNA activity to identify heterogeneous cell populations without antibody labeling. This technology has been successfully validated in various cell types, including hepatocytes, endothelial cells, cardiomyocytes derived from iPS cells (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015)), nerve cells derived from mouse embryonic stem cells (ESC) (Sunohara, T. et al. Front Neurosci 13, 1141 (2019)), undifferentiated human ES cells and iPS cells (Parr, CJ et al. Sci Rep 6, 32532 (2016)).

[0007] Therefore, the inventors hypothesized that miRNA switches could be used to identify subsets of imMKCLs exhibiting heterogeneous miRNA activity (i.e., gradient changes in miRNA activity). First, the inventors screened a library containing 269 target miRNA switches and identified let-7a-5p and let-7g-5p miRNAs exhibiting heterogeneous activity among imMKCLs. Through transcriptional analysis of imMKCL subsets with high and low let-7 activity (hereinafter referred to as "let-7 high" and "let-7 low"), the inventors found that imMKCLs with low let-7 activity displayed immune-skewed transcriptional signatures. Further research clarified that let-7a-5p and its downstream target, RALB (RAS-like proto-oncogene B), play a crucial role in regulating the lineage determination of "immune" megakaryocytes within imMKCLs. Importantly, the inventors have demonstrated that the secretion of inflammatory cytokines and the dysregulation of immune signatures / subgroups within imMKCL together lead to a decline in quality based on proliferation arrest and defects in iPSC-PLT generation.

[0008] Furthermore, in exploring the factors contributing to immune bias in imMKCL, the inventors also focused on lysine acetyltransferase 7 (also known as KAT7, HBO1, and MYST2), an important member of the MYST family of histone acetyltransferases, which is indispensable for chromatin modification and gene regulation. KAT7 has the following functions: forming complexes with proteins such as MEAF6, ING4 / 5, JADE, and BRPF; acetylating histone H3 at lysine 14; and acetylating histone H4 at lysines 5, 8, and 12 (Yokoyama A. et al. BiochimBiophys Acta Gene Regul Mech. 2024 Sep;1867(3):195045). Analysis of the function of KAT7 in imMKCL revealed that KAT7 plays a crucial role in inhibiting the immune bias characteristics of imMKCL. Specifically, KAT7 is essential for maintaining the cell cycle of imMKCL, influencing platelet production during subsequent maturation by maintaining its proliferative capacity. In imMKCL, platelets are produced from the proliferative G1 or G2 / M phase. However, it has been established that in senescent imMKCL, KAT7 is reduced, IL-8 or TNF-α secretion is increased, the transition from G1 or G2 / M phase to G0 phase is accelerated, the cell cycle is arrested, and platelet formation from the G1 or G2 / M phase is reduced. Based on these findings, the inventors conducted further and repeated studies, resulting in this invention.

[0009] That is, the present invention is as follows.

[0010] [1] A quality control marker for megakaryocytes, consisting of the transcript or protein of the Ral (RAS-like proto-oncogene) gene.

[0011] [2] According to the marker described in [1], the Ral gene is the RalB (RAS-like proto-oncogene B) gene.

[0012] [3] A quality control marker for megakaryocytes, which consists of the transcript or protein of the Kat7 (lysine acetyltransferase 7) gene, or the target acetylated histone of the Kat7 protein.

[0013] [4] A method for quality assessment of megakaryocytes, comprising the step of detecting one or more biomarkers as described in any one of [1] to [3] in megakaryocytes.

[0014] [5] The method according to [4] includes the step of detecting the transcript or protein of the RalB gene and the transcript or protein of the Kat7 gene in megakaryocytes.

[0015] [6] The method according to [4] or [5] includes the following steps: Step (1): Determine the presence or activity of one or more biomarkers described in any one of [1] to [3] in the target megakaryocytes; and Step (2): Evaluate the quality of megakaryocytes based on the values ​​measured in step (1).

[0016] [7] The method according to [4] or [5] is characterized in that the marker is detected using a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Ral gene or an antibody that specifically recognizes the Ral protein.

[0017] [8] The method according to [4] or [5] is characterized in that: the biomarker is detected using a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes the target acetylated histone of the Kat7 protein.

[0018] [9] The method according to any one of [4] to [7], wherein the megakaryocytes are derived from pluripotent stem cells.

[0019]

[10] A kit for quality control of megakaryocytes, comprising a nucleic acid probe and / or nucleic acid primers that specifically recognize the transcript of the Ral gene or an antibody that specifically recognizes the Ral protein.

[0020]

[11] A quality control kit for megakaryocytes, comprising a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes the target acetylated histone of the Kat7 protein.

[0021]

[12] A method for preparing megakaryocytes with improved quality, comprising the step of culturing megakaryocytes in a culture medium containing a Ral inhibitor.

[0022]

[13] According to the method of

[12] , wherein at least one Ral inhibitor is an expression inhibitor of RBC8 or Ral.

[0023]

[14] A method for preparing megakaryocytes with improved quality, comprising the step of increasing the amount of Kat7 protein present in megakaryocytes.

[0024]

[15] The method according to any one of

[12] to

[14] , wherein the megakaryocytes are derived from pluripotent stem cells.

[0025]

[16] A megakaryocyte evaluated by any one of [4] to [9] or obtained by any one of

[12] to

[15] .

[0026] [17-1] A method for preparing platelets, comprising the step of maturing the megakaryocytes described in

[16] .

[0027] [17-2] The method according to [17-1] includes: an oscillating culture step.

[0028] [17-3] The method according to [17-1] or [17-2], wherein the culture medium contains a Ral inhibitor.

[0029]

[18] A platelet obtained by any one of the methods described in [17-1] to [17-3].

[0030] [19-1] A blood preparation comprising the cells described in

[16] or

[18] .

[0031] [19-2] The preparation according to [19-1] is used to treat or prevent blood disorders or bleeding.

[0032]

[20] A method of treating or preventing blood disorders or bleeding, which involves administering or transplanting an effective amount of the cells described in

[16] or

[18] to a mammal.

[0033]

[21] The cells described in

[16] or

[18] are used to treat or prevent blood disorders or bleeding.

[0034] The use of the cells described in

[22]

[16] or

[18] in the manufacture of medicines for the treatment or prevention of blood disorders or bleeding.

[0035] Invention Effects According to the present invention, the quality of megakaryocytes can be controlled or evaluated. This allows for a stable supply of high-quality platelets. Attached Figure Description

[0036] [ Figure 1 [A] Endogenous miRNA activity in imMKCL was identified through screening based on miRNA switches. (a) Schematic diagram of miRNA switch design. The mRNA consists of an antisense sequence of the target miRNA and a reporter gene. Reporter gene expression is suppressed in the presence of the activated target miRNA. (b) Design of miRNA switches for imMKCL. A pair of mRNAs encoding tagBFP, containing an antisense sequence of the miRNA target in the 5'UTR, and Azami Green protein mRNA were synthesized in vitro. These two mRNAs were co-transfected into imMKCL via lipid transfection. Cells were analyzed by flow cytometry 24 hours after transfection, and miRNA activity in imMKCL was identified through screening. (c) Representative dot plot of target miRNA activity in imMKCL. This shows that activated miRNAs reduce TagBFP expression. (d) Flow cytometry analysis of target miRNAs exhibiting endogenous activity in imMKCL. A screening based on miRNA switches was conducted from a library containing 269 miRNA switches (Table 1), and 24 miRNAs with endogenous activity in imMKCL were identified.

[0037] [ Figure 2Let-7 miRNAs can identify immune-biased imMKCLs. (a) Heterogeneous responsiveness was identified in imMKCLs via let-7a-5p or let-7g-5p miRNA switches, resulting in let-7 low-responsive and let-7 high-responsive subsets. (b) A schematic diagram of the bulk RNA-seq sampling workflow is shown. Let-7a-5p and let-7g-5p switches were transfected into imMKCLs, and let-7 low-responsive and high-responsive cells were sorted by flow cytometry. Three different imMKCL clones (clone 7, clone 7-3, and M35-1) were used in the bulk RNA-seq analysis. A bar chart showing the GSEA (Genesets enrichment analysis) results of the top-ranked enriched immune-related gene sets in let-7 low-responsive imMKCLs during the proliferation (c) and maturation (d) phases is shown. A GSEA plot showing typical enriched immune-related gene sets during the proliferation (e) and maturation (g) phases is shown. Heatmap of differentially expressed TNF targets in low-responsive and high-responsive imMKCLs during the proliferation (f) and maturation (h) phases.

[0038] [ Figure 3 (a) Expression levels of let-7a-5p and let-7g-5p in let-7 high / low imMKCL (clone 7) were determined by RT-qPCR. Expression levels were normalized relative to RNU6B (U6). Sampling was performed 48 hours after sorting. Data are presented as mean ± standard error (SEM) from three independent experiments. (b) Clone 7-3 is an aged collection with the same genetic background as clone 7. (c) iPSC-PLTs were generated from let-7 high / low imMKCL under quiescent conditions. Cells were directly subjected to a DOX-free (DOX-OFF) process after sorting. Three different imMKCL clones were used. Data are presented as mean ± SEM from three independent experiments. Studentt test was used to evaluate statistical significance. *P<0.05.

[0039] [ Figure 4 In vitro induced ESC-derived CD34 + HPCs (hematopoietic progenitor cells) exhibit an immune-biased transcriptional signature in the low-let-7 subset. (a) A schematic diagram of ESC-derived HPCs induced by the Sac method. (b) A GSEA plot of the significantly concentrated (enriched) set of immune-related genes in HPCs derived from low-let-7 ESCs. (c) A heatmap of the enriched gene set in the same cell.

[0040] [ Figure 5Single-cell RNA-seq analysis clarified the existence of transcriptionally distinct immune-biased subsets enriched within let-7a-5p low-responsive imMKCLs. (a) Visualization using uniform manifold approximation and projection (UMAP) and color differentiation of imMKCLs (clone 7) into let-7a-5p high-responsive and low-responsive imMKCLs (upper) and imMKCL subclusters (lower). (b) Distribution of let-7a-5p low-responsive and high-responsive cells within each cluster (left) and bar charts showing the distribution of let-7a-5p low-responsive and high-responsive cells in each cluster (right). (c) Relative expression levels of the top 10 differentially expressed genes (DEGs) in each cluster. (d) Representative Gene Ontology (GO): Biological Process (BP) entries enriched in each cluster. (e) Typical immune-related GO:BP entries in each cluster. (f) Violin plot showing the expression levels of typical platelet production-related and immune-related genes in each cluster.

[0041] [ Figure 6 Let-7a-5p plays a functional role in the generation of immune-biased subsets in imMKCL. (a) Schematic diagram of the experimental workflow using a specific let-7a-5p inhibitor. (b) Expression levels of let-7a-5p in negative control or imMKCL (clone 7) treated with a let-7a-5p inhibitor. Expression levels were determined by qRT-PCR and normalized relative to RNU6B (U6) as an endogenous control. (c) Activity patterns of let-7a-5p were analyzed by FACS. (d) Inhibition of let-7a-5p induced increased IL-8 secretion from imMKCL during the proliferation phase (with DOX (DOX-ON)). ImMKCL was incubated for 24 h during the proliferation phase in the absence or presence of LPS (50 ng / mL) after transfection with a let-7a-5p inhibitor or negative control. Inflammatory molecules were measured in the supernatant by flow cytometry. (e) Suppression of let-7a-5p in imMKCL (clone 7) increased the number of marker genes identified in clusters 3 and 5. Figure 5 The mRNA expression levels of [GAPDH] were measured by qRT-PCR and normalized relative to GAPDH. Data are presented as mean ± SEM from three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test.

[0042] [ Figure 7 RALB is a target of let-7a-5p in the generation of immune-biased imMKCL. (a) Flowchart of upstream regulator analysis. (b) Bar chart showing the top 10 upstream regulators of clusters 3 and 5 identified by ingenuity pathway analysis (IPA) based on scRNA-seq datasets. (c) Eight potential upstream regulators were identified by comparing the upstream regulators common to clusters 3 and 5 with the predicted has-let-7a-5p target. (d) Violin plot showing the expression levels of the upstream regulators identified in each cluster. Regulators CUX1 and RALB showed increased expression levels in let-7a-5p-low responsive cells (clusters 3 and 5), distinguished by gray color. (e) Let-7a-5p binding sites on CUX1 and RALB predicted by TargetScan. The sequences in the figure are shown in the sequence listing from top to bottom as SEQ ID NO: 41–43. (f) In imMKCL, inhibition of let-7a-5p induced the mRNA expression of CUX1 and RALB. (g) Lentiviral-mediated overexpression of RALB increased RALB mRNA expression in both the proliferation phase (with DOX) and the maturation phase (without DOX). (h) RALB overexpression induced the expression of interferon signaling genes. (i) A schematic diagram of the regulation of interferon signaling in imMKCL by the let-7 miRNA-RALB axis. Data are presented as mean ± standard deviation (SD) of three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P<0.05, **P<0.01.

[0043] [ Figure 8 (a) CUX1 mRNA expression was increased in both the proliferation (with DOX) and maturation (without DOX) phases of imMKCL (clone 7) via lentivirus-mediated overexpression (O / E). (b) CUX1 overexpression did not affect ISG15 or IFIT3 mRNA expression. Expression levels were normalized relative to GAPDH. (c) Let-7a-5p expression was not significantly altered by CUX1 overexpression. Expression levels were normalized relative to RNU6B. Proliferation rate (d) and iPSC-PLT generation (e) were not affected by CUX1 overexpression. Data are presented as mean ± SEM from three independent experiments.

[0044] [ Figure 9(a) Intracellular protein expression of RALB detected by intracellular flow cytometry in MOCK or imMKCL (O / E RALB) overexpressing RALB (mean fluorescence intensity, MFI). (b) Comparison of RALB expression using histogram overlay. (c) Equal levels of let-7a-5p expression were observed in MOCK and imMKCL overexpressing RALB. (d) RALB overexpression did not significantly affect the expression of genes associated with MK maturation. Bar charts represent FPKM values ​​of genes. Data are presented as mean ± SEM from three independent experiments.

[0045] [ Figure 10 Immune dysregulation is associated with proliferation arrest and impaired iPSC-PLT generation in imMKCL clones. (a) A schematic diagram showing the correlation between proliferation and iPSC-PLT generation, based on a previous study (Sone, M. et al. Stem Cell Reports 16, 2861-2870 (2021)). (b) GSEA plot showing enriched sets of TNF signaling and interferon-responsive genes in low- to medium-quality clones compared to high-quality clones. (c) Fold change in proliferation and cell number of clones 7 and 7-3 at day 14. (d) iPSC-PLT generation in clones 7 and 7-3 under quiescent or turbulent conditions. (e) Representative flow cytometry plots of iPSC-PLT generated by clones 7 and 7-3 under quiescent or turbulent conditions. (f) GSEA plot showing enriched sets of TNF signaling and interferon-responsive genes in clone 7-3. (g) Compared with clone 7, clone 7-3 showed increased RALB mRNA expression. (h) IL-8 was secreted by both clone 7 and clone 7-3 during the proliferation phase. Data are presented as mean ± SEM from three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P<0.05, **P<0.01.

[0046] [ Figure 11 Compared to high-quality clones, low- to medium-quality clones show enrichment of aging and age-related gene sets in GSEA plots (a) and heatmaps (b). (c) Heatmap of enrichment of immune-related gene sets in low- to medium-quality clones. (d) RALB expression levels in clones of different quality.

[0047] [ Figure 12(a) Flow cytometry analysis of let-7a-5p activity patterns in clone 7 and clone 7-3 using miRNA switching technology. (b) Heatmap of gene sets enriched in clone 7-3. Cells with low let-7 levels from each clone were compared. (c) GSEA plot showing the enrichment of senescence-related TP53 targets in clone 7-3 compared to clone 7. (d) Increased expression levels of genes encoding inflammatory cytokines in clone 7-3 compared to clone 7.

[0048] [ Figure 13 (a) Representative flow cytometry plot of clone 7-derived iPSC-PLTs prepared in the presence of recombinant human IL-8 at the concentrations shown in the figure. (b) Plunging flow cytometry analysis. (c) Generation of iPSC-PLTs under the conditions shown in the figure. (d) Molecular structure of reparixin, a specific inhibitor of CXCR1 / 2. (e) Generation of iPSC-PLTs under the conditions shown in the figure. (f) Representative flow cytometry plot of iPSC-PLTs generated from imMKCL (clone 7) overexpressing RALB in the presence of reparixin at the concentrations shown in the figure. (g) Plunging flow cytometry analysis. Data are presented as mean ± SD from three independent experiments. Statistical significance was assessed using one-way ANOVA with multiple comparisons. *P < 0.05.

[0049] [ Figure 14 [drug-dependent inhibition of imMKCL proliferation (a) and (b) iPSC-PLT generation by administration of human recombinant interferon-α2a. imMKCL (clone 7) was treated with human IFN-α2a at concentrations of 0, 1, 10, or 100 ng / mL. (c) Induction of mRNA expression of interferon-related genes and CDKN2A in imMKCL. mRNA expression levels were determined by RT-qPCR and normalized relative to GAPDH. (d) Representative flow cytometry plots of iPSC-PLTs prepared under the conditions shown in the figure. Statistical significance was evaluated using one-way ANOVA with multiple comparisons or a two-tailed Student's t test. *P<0.05, **P<0.01, ***P<0.001.]

[0050] [ Figure 15[The proliferation and iPSC-PLT generation capacity of imMKCL are decreased due to RALB overexpression, possibly due to aberrant regulation of induced immune properties. Proliferation arrest (a) and defective iPSC-PLT generation (b) occur in imMKCL (clone 7) due to lentivirus-mediated overexpression of RALB (O / E). (c) Representative flow cytometry plots of iPSC-PLT generated by MOCK and O / E RALB under quiescent and turbulent conditions. (d) Increased IL-8 secretion in O / E RALB compared to MOCK imMKCL. (e) GSEA plot showing enriched sets of TNF signaling and interferon-responsive genes in O / E RALB imMKCL. (f) Correlation analysis of RALB expression with immune-related genes. Data are presented as mean ± SEM of three independent experiments.]

[0051] [ Figure 16 (a) GSEA plot and heatmap showing the enriched set of senescent and aging-related genes in imMKCL (O / E RALBimMKCL) that overexpresses RALB, compared to MOCK. (b) Heatmap of the enriched set of genes in O / E RALB (clone 7).

[0052] [ Figure 17 (a) Molecular structure of RBC8, a specific inhibitor of RALA and RALB. (b) Inhibition of imMKCL (clone 7) proliferation by administration of 0.1 μM RBC8. (c) iPSC-PLT generation under the conditions shown in the figure. (d) Representative flow cytometry plots of iPSC-PLT generated by imMKCL (clone 7) overexpressing RALB in the presence or absence of RBC8. (e) Fibonacci retardation flow cytometry analysis. (f) Improved iPSC-PLT generation in imMKCL (clone 7) by siRNA-mediated RALB knockdown. siRNA targeting RALB (siRALB) or a non-target control (siNT) was transfected into cells. (g) Representative flow cytometry plots of iPSC-PLT generated by siNT or siRALB. (h) RALB knockdown had no significant effect on IL-8 secretion during maturation. (i) Forty-eight hours after transfection, the relative mRNA expression of the illustrated genes in imMKCL was evaluated. mRNA expression levels were determined by RT-qPCR and normalized relative to GAPDH. Data are presented as the mean ± SEM of three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P < 0.05.

[0053] [ Figure 18PAC-1 binding (a) and P-selectin expression (b) in iPSC-PLTs generated from clone 7 or clone 7-3 with or without PMA or ADP / TRAP6 stimulation. (c) Representative flow cytometry plot of activated iPSC-PLTs. (d) CD41 binding with clone 7 and clone 7-3. + Representative histograms of Annexin V binding in iPSC-PLT. PAC-1 binding (e) and P-selectin expression (f) in iPSC-PLT generated from MOCK or imMKCL (O / ERALB) overexpressing RALB, with or without PMA or ADP / TRAP6 stimulation. (g) Representative flow cytometry plots of activated iPSC-PLT. (h) CD41 from MOCK or O / E RALB. + Representative histogram of Annexin V combined with iPSC-PLT.

[0054] [ Figure 19 (a) CD34 derived from umbilical cord blood + (b) Schematic diagram of MK differentiation in vitro. (c) Inhibition of let-7a-5p had no significant effect on mRNA expression of the genes shown in the figure (b) and PLT production (cd). (e) Significantly increased expression levels of RALB, IRF7, ISG15, and IFIT3 were observed in RALB-overexpressing (O / E) cells. Total RNA was isolated from cells on day 16, and mRNA expression levels were determined by RT-qPCR and normalized relative to GAPDH. (fg) CD41a generated from umbilical cord blood-derived MK was induced on day 20 by RALB overexpression. + CD42b + Platelet-like particles were significantly reduced. Data are presented as mean ± SEM of three independent experiments. Statistical significance was assessed using a two-tailed Student's t-test. *P < 0.05.

[0055] [ Figure 20 Gating strategies for flow cytometry used to distinguish imMKCL subsets by miRNA switches (a) and to count iPSC-PLTs using absolute counting beads (b).

[0056] [ Figure 21The levels of KAT7 and H3K14ac in LT-C (long-term culture) imMKCL were decreased. (A) KAT7 protein levels, measured using the Wes Simple Western blotting system, for ST-C, LT-C, and WS clones. (B) H3K14ac protein levels, measured using the Wes Simple Western blotting system, for ST-C, LT-C, and WS clones. (C) Cell proliferation, measured by the CCK8 assay, for ST-C and WS clones during a 3-day culture period with DOX. (D) Platelet production capacity of ST-C and WS clones after maturation without DOX. Data are presented as mean ± SEM from at least three independent experiments. Statistical significance was assessed using an unpaired two-tailed Student's t-test or one-way ANOVA.

[0057] [ Figure 22 WM3835 inhibited the proliferation and maturation of imMKCL by inducing cell cycle arrest. (A) WM3835 (5 μM) effectively inhibited KAT7 signaling compared to WM1119. (B) Platelet-producing capacity of ST-C clones after WM3835 treatment at the dates shown in the figure for maturation. (C) Reduced platelet-producing capacity of ST-C clones after WM3835 treatment during the proliferation phase. (D) Cell proliferation of ST-C clones with DOX at 3, 6, and 9 days after WM3835 treatment, as determined by CCK8 assay. (E) Cell cycle analysis of ST-C clones after WM3835 treatment using the Fucci system. Data are presented as mean ± SEM from more than three independent experiments. Statistical significance was evaluated using unpaired two-tailed Student's t-test or two-way ANOVA.

[0058] [ Figure 23 KAT7 loss of function analysis. Lentiviral vectors encoding shKAT7 or control vectors (shLacZ) were introduced into imMKCL. Hygromycin was used for screening after introduction. (A) KAT7 expression as determined by real-time qPCR. (B) Platelet production capacity. (C) Cell cycle analysis during the proliferation phase. Data are presented as mean ± SEM from at least three independent experiments. Statistical significance was assessed using unpaired two-sided Student's t-test or one-way ANOVA.

[0059] [ Figure 24KAT7 gain of function analysis. Lentiviral vectors containing the KAT7 CDS sequence or control vectors (Mock) were introduced into imMKCL. After introduction, selection was performed using blastcin. (A) KAT7 expression as determined by real-time qPCR. (B) H3K14ac expression as detected by intracellular flow cytometry. (C) Cell proliferation as determined by CCK8 assay during 3 days of culture with DOX. (D) Platelet production capacity. (E) Cell cycle analysis during the proliferation phase. Data are presented as mean ± SEM from at least three independent experiments. Statistical significance was evaluated using an unpaired two-sided Student's t-test. Detailed Implementation

[0060] As used in this specification, the singular forms of "a," "an," and "the" include both the singular and plural forms, unless specifically indicated by words such as "only," "single," and / or "one." As used in this specification, the terms "comprises," "comprising," "includes," and / or "including" refer to the presence of a particular described feature, step, operation, element, concept, and / or component, but are further understood not in themselves to exclude the presence or addition of more than one other feature, step, operation, element, component, concept, and / or group thereof.

[0061] 1. Quality control biomarkers for megakaryocytes This invention provides biomarkers for the quality control of megakaryocytes (hereinafter also referred to as "biomarkers of this invention"). Since the quality of megakaryocytes can be evaluated using the biomarkers of this invention, these biomarkers are useful for the quality control of megakaryocytes (especially for ensuring that megakaryocytes have a certain quality). In this specification, the term "quality control of megakaryocytes" can also be appropriately interpreted as "quality evaluation of megakaryocytes". Specifically, examples of biomarkers of this invention include: the transcript or protein of the Ral (RAS-like proto-oncogene) gene, the transcript or protein of the Kat7 (lysine acetyltransferase 7) gene, and acetylated histone proteins that are targets of the Kat7 protein (hereinafter, "histone proteins" are simply referred to as "histones").

[0062] Ral proteins are a type of small GTPase. There are two types of Ral proteins: RalA (RAS-like proto-oncogene A) protein (also known as "GTPase RalA") and RalB (RAS-like proto-oncogene B) protein (also known as "GTPase RalB"). RalA and RalB proteins share approximately 80% homology; these proteins, except for the hypervariable region at the C-terminus, mostly have the same amino acid sequence. Both RalA and RalB can be used as biomarkers in this invention, but RalB is preferred.

[0063] Kat7 protein is a histone acetyltransferase (HAT) that primarily regulates chromatin structure, gene expression, and cell division by acetylating lysine residues in histones H3 and H4. Histones H3 and H4 are the acetylation target histones of Kat7 protein. Examples of target acetylated histones for Kat7 include: H3K14ac (histine 3 acetylated with lysine 14), H4K5ac (histine 4 acetylated with lysine 5), H4K8ac (histine 4 acetylated with lysine 8), H4K12ac (histine 4 acetylated with lysine 12), and H4K16ac (histine H4 acetylated with lysine 16), with H3K14ac being the preferred choice. Here, lysine 14 refers to the methylation of the 14th amino acid residue in the protein's amino acid sequence (excluding methionine encoded by the start codon). The same applies to lysine 8, lysine 12, and lysine 16.

[0064] In this specification, "megakaryocyte" can be, for example, a cell characterized as CD41a-positive / CD42a-positive / CD42b-positive. In addition to expressing these markers, megakaryocytes may further express one or more markers selected from CD9, CD34, CD61, CD62p, CD42c, CD42d, CD49f, CD51, CD110, CD123, CD131, and CD203c. Megakaryocytes may also express GATA1, FOG1, NF-E2, and β1-tubulin.

[0065] In one embodiment, the megakaryocytes are CD34-positive and CD41-positive cells. In another embodiment, the megakaryocytes are CD38-negative, CD90-positive, and / or CD49f-positive.

[0066] In this specification, "transcription product" refers to RNA encoding a protein; unless otherwise stated, it refers to mRNA. Complementary DNA (cDNA) synthesized from RNA using reverse transcriptase is also included in the transcription product.

[0067] The transcripts of the Ral gene (also referred to simply as "Ral transcripts") are known transcripts. For example, the transcript of human RalA is disclosed with the sequence number NCBI accession number NM_005402.4 (SEQ ID NO: 1), and the transcript of human RalB is disclosed with the sequences numbered NCBI accession number NM_001369400.1 (SEQ ID NO: 2) and NCBI accession number NM_002881.3 (SEQ ID NO: 3). The transcripts of the Kat7 gene are known transcripts. For example, the transcript of human Kat7 (isotype 1) is disclosed with the sequence number NCBI accession number NM_007067.5 (SEQ ID NO: 4). Besides isoform 1, other isoforms 2-6 of the Kat7 protein with shorter sequences are known (shown as SEQ ID NO: 5-9, respectively). Transcriptions encoding these isoforms can all be used as biomarkers of the present invention, but in this specification, the transcript of the Kat7 gene is preferably composed of the sequence shown in SEQ ID NO: 4. In the present invention, each transcript can be RNA containing the base sequence shown in any of SEQ ID NO: 1-9 (where T is read as U), or RNA containing a base sequence substantially identical to that base sequence. There is no particular limitation on the source of each transcript, but it is preferably from mammals (e.g., humans, mice, rats, monkeys, cattle, horses, pigs, dogs, etc.), with humans being the most preferred source. Each transcript can also be a homologue of the corresponding transcript from humans, a non-human mammal species.

[0068] Examples of base sequences substantially identical to those shown in any of SEQ ID NO: 1-9 include base sequences having 80% or more, preferably 90% or more, more preferably 95% or more (e.g., 96%, 97%, 98%, 99% or higher) identity with these base sequences. Such sequences are typically sequences encoding proteins having activities substantially homologous to Ral or Kat7 proteins.

[0069] Additionally, as a base sequence substantially identical to the base sequence shown in any of SEQ ID NO: 1 to 9, examples include base sequences obtained by substituting, inserting, adding, and / or deleting one or more (preferably about 1 to 300, more preferably about 1 to 150, further preferably about 1 to 30, particularly preferably one to several (2, 3, 4, 5, 6, 7, 8, 9, or 10)) nucleotides. Such sequences are typically sequences encoding proteins with activities substantially homologous to Ral or Kat7 proteins.

[0070] Each transcript can be obtained, for example, by isolating and purifying it from cells or biological samples containing the transcript using known methods. Alternatively, it can be prepared by chemical synthesis or by in vitro transcription (IVT) methods.

[0071] Ral proteins are known proteins. For example, the human RalA protein sequence is disclosed in NCBI accession number: NP_005393.2 (SEQ ID NO: 10), and the human RalB protein sequence is disclosed in NCBI accession numbers: NP_001356329.1 and NP_002872.1 (both are identical sequences (SEQ ID NO: 11)). Kat7 proteins are also known proteins. For example, the human Kat7 protein (isoform 1) sequence is disclosed in NCBI accession number: NP_NP_008998.1 (SEQ ID NO: 12). The sequences of isoforms 2 to 6 of the human Kat7 protein are shown in the sequence listing as SEQ ID NO: 13 to 17. In this invention, each protein may be a protein containing the amino acid sequence shown in any of SEQ ID NO: 10 to 17, or a protein containing an amino acid sequence substantially identical to that amino acid sequence. There are no particular limitations on the source of the proteins, but they are preferably from mammals (e.g., humans, mice, rats, monkeys, cattle, horses, pigs, dogs, etc.), with proteins from humans being the most preferred. The proteins may also be homologues of corresponding human proteins from non-human mammalian species.

[0072] An amino acid sequence that is substantially identical to the amino acid sequence shown in any of SEQ ID NO: 10-17 can be, for example, an amino acid sequence having 80% or more, preferably 90% or more, more preferably 95% or more (e.g., 96%, 97%, 98%, 99% or higher) identity with these amino acid sequences. Proteins containing such sequences typically have activities substantially homologous to Ral or Kat7 proteins.

[0073] Additionally, amino acid sequences substantially identical to those shown in any of SEQ ID NO: 10-17 can be exemplified by: amino acid sequences obtained by substitution, insertion, addition, and / or deletion of one or more (preferably about 1 to 100, more preferably about 1 to 50, further preferably about 1 to 10, particularly preferably one to several (2, 3, 4, or 5)) amino acids in these sequences. Proteins containing such sequences typically exhibit activities substantially homologous to Ral or Kat7 proteins.

[0074] Ral or Kat7 proteins can be prepared using known protein synthesis methods, such as solid-phase synthesis and liquid-phase synthesis. The resulting proteins can be purified and separated using known purification methods, such as solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, or combinations thereof. Alternatively, they can be isolated and purified from biological samples using known methods. Alternatively, Ral or Kat7 proteins can also be prepared by culturing a transformant containing a nucleic acid encoding the protein and isolating and purifying the protein from the resulting culture. This nucleic acid can be DNA, RNA, or a DNA / RNA chimera, but DNA is preferred. The nucleic acid can be double-stranded or single-stranded.

[0075] 2. Methods for evaluating the quality of megakaryocytes This invention provides a method for evaluating the quality of megakaryocytes (hereinafter, sometimes referred to as "the evaluation method of this invention"), comprising the step of detecting the biomarkers of this invention in megakaryocytes. In this specification, "evaluation" may also be appropriately read as "determination," "inspection," "verification," etc. In the evaluation method of this invention, only one biomarker of this invention may be detected, or two or more may be detected. When detecting two or more, there is no particular limitation on the combination of biomarkers to be detected; different types of transcripts or proteins may be detected (e.g., detecting the transcript of RalA and the transcript of RalB, etc.), or the same type of transcripts or proteins may be detected (e.g., detecting the transcript of RalB and the RalB protein, etc.). Furthermore, detecting the transcript or protein of the Ral gene (in one scheme, the RalB gene) and the transcript or protein of the Kat7 gene (in one scheme, the Kat7 protein) is also a preferred embodiment.

[0076] In this specification, unless otherwise specified, "cells" such as megakaryocytes include "cell populations". Furthermore, unless otherwise specified, "cell" refers to cells obtained through cell culture. A cell population may consist of one type of cell or two or more types of cells.

[0077] The megakaryocytes used in this invention can be multinucleated cells, or mononuclear or binucleated cells. Furthermore, megakaryocytes can be immortalized as megakaryocyte lines or as clonal cell populations. Non-multinucleated megakaryocytes can be proliferated through expanded culture and are sometimes referred to as immortalized megakaryocytes (imMKCL). The megakaryocytes used in this invention are typically CD34-positive and CD41-positive immortalized megakaryocytes. Immortalized megakaryocytes mature to produce functional platelets. Megakaryocyte maturation refers to the differentiation of megakaryocytes into the desired multinucleated state, enabling the production of functional platelets. Functional platelets can be, for example, CD42b-positive platelets. Megakaryocyte maturation can also be confirmed, for example, by elevated expression of megakaryocyte maturation-related gene groups such as GATA1, FOG1, FLI1, NF-E2, and β1-tubulin.

[0078] In one embodiment of the present invention, the megakaryocyte has an exogenous gene encoding a MYC protein and an exogenous gene encoding an apoptosis-inhibiting protein, and preferably also has an exogenous gene encoding a polycomb family protein. Hereinafter, the MYC protein, apoptosis-inhibiting protein, and polycomb family protein are sometimes collectively referred to as "megakaryocyte inducing factors".

[0079] In this specification, "exogenous" means not present in megakaryocytes of mammals unless introduced from an external source. Furthermore, unless otherwise specified, "expressed" or "positive" in this specification means the production of a protein encoded by the gene. Therefore, if the target protein is detected by FACS used in the examples below, the gene can be considered expressed.

[0080] Examples of genes encoding MYC proteins (hereinafter also referred to as "MYC genes") include, for example, the c-MYC gene, the N-MYC gene, and the L-MYC gene. The c-MYC gene is more preferred. Examples of c-MYC genes include genes with nucleic acid sequences as shown in NCBI accession number NM_002467.

[0081] The c-MYC gene can also be a c-MYC gene encoding a protein fused with a destabilizing domain. A "destabilizing domain" is a domain that destabilizes a operatively linked protein. The destabilizing domain can be operatively linked to the N-terminus or C-terminus of the protein. Examples of destabilizing domains include: ubiquitin, PEST sequences (sequences rich in proline, glutamate, serine, and threonine), cyclin destruction boxes, hydrophobic segments of amino acids, *E. coli* dihydrofolate reductase (ecDHFR), human estrogen receptor ligand-binding domain (ERLBD), FK506-binding protein (FKBP12), and their variants. Examples of destabilizing domains include FKBP12 and its variants. Examples of FKBP12 variants used as destabilizing domains include: F15S, V24A, H25R, E60G, L106P, M66T, R71G, D100G, D100N, E102G, and K105I variants (Banaszynski et al. Cell 126:995 (2006)). Commercially available destabilizing domains are also available, such as those from TAKARA Bio (Clontech ProteoTuner). TM Shield System C, #631072) for sale.

[0082] As an "apoptosis inhibitory gene," there are no particular limitations on any gene that inhibits apoptosis. Examples include: BCL2 gene, BCL2L1 gene (protein name: Bcl-xL), Survivin, MCL1, etc. The BCL2L1 gene is preferred. Examples of BCL2L1 genes include genes with nucleic acid sequences represented by NCBI accession numbers NM_001191 or NM_138578.

[0083] In this specification, genes encoding polycomb family proteins (hereinafter also referred to as "polycomb genes") are those known to negatively regulate CDKN2a (cyclin-dependent kinase inhibitor 2A, INK4a / ARF) and function to prevent cellular senescence. Specifically, examples of multicomb genes include: BMI1 (multicomb complex protein BMI-1, multicomb family ring finger protein 4 (PCGF4), ring finger protein 51 (RNF51)), Mel18 (multicomb family ring finger protein 2), Ring (ring finger protein) 1a / b, Phc (multi-homological homologs) 1 / 2 / 3, Cbx (pigment boxes) 2 / 4 / 6 / 7 / 8, Ezh2 (enhancer of the second subunit of the Zeste 2 multicomb repression complex), Eed (embryonic ectoderm development), Suz12 (the second subunit of the SUZ12 multicomb repression complex), HADC (histone deacetylase), Dnmt (DNA (cytosine-5)-methyltransferase) 1 / 3a / 3b), etc., but the BMI1 gene is preferred. Examples of BMI1 genes include genes consisting of the nucleic acid sequence shown in NCBI accession number NM_005180.

[0084] The source of the genes encoding megakaryocyte-inducing factors (hereinafter also referred to as "megakaryocyte-inducing factor genes") is not particularly limited, but mammals (e.g., humans, mice, rats, monkeys, cattle, horses, pigs, dogs, etc.) are preferred, with humans being the most preferred. Alternatively, human gene homologs from non-human mammalian species are also preferred as megakaryocyte-inducing factor genes. Genes with high identity to wild-type genes in their base sequence (e.g., having an identity of 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more) are also preferred.

[0085] Each megakaryocyte-inducible factor gene is preferably linked under the regulation of a drug-responsive promoter. A drug-responsive promoter is a promoter that expresses or inhibits gene expression in the presence of a corresponding drug. Examples of drug-responsive promoters include: fusion proteins of reverse tetR (rtetR) and VP16AD (rtTA) or tetR and VP16AD (rTA), and TRE promoters that can bind in the presence or absence of the corresponding drug. Examples of such drugs include: doxycycline (Dox), tetracycline, or their derivatives (hereinafter referred to as "Dox et al."). Other examples of drug-responsive promoters include: metallothionein promoters (corresponding drugs: heavy metal ions) and steroid-responsive promoters (corresponding drugs: steroid hormones or their derivatives). Vectors containing these drug-responsive promoters are also called drug-responsive vectors. In addition to drug-responsive promoters, light-responsive promoters (induced by light) and heat shock protein promoters (induced by heat shock) can also be used. These promoters induced by drugs or stimuli are also called inducible promoters.

[0086] The megakaryocytes used in this invention can be obtained by known methods. Examples include: methods for isolating megakaryocytes from biological tissues (e.g., bone marrow, umbilical cord blood, peripheral blood, etc.) using known methods; methods for inducing differentiation of pluripotent stem cells or hematopoietic progenitor cells; and methods for obtaining megakaryocytes from companies such as ATCC. Specific isolation or preparation methods are as follows.

[0087] Furthermore, in this specification, "detecting biomarkers" includes not only investigating the presence of the biomarkers of the present invention in megakaryocytes (i.e., the presence of transcripts or proteins in amounts exceeding the detection limit of the detection method), but also measuring (quantifying) their presence or activity level. Therefore, the evaluation method of the present invention can also be implemented using the presence or activity level of the biomarkers of the present invention as an indicator. Therefore, in another embodiment, the evaluation method of the present invention includes the following steps: Step (1) involves determining the presence or activity level of one or more biomarkers of the present invention in the megakaryocytes of the subject; and Step (2) evaluates the quality of megakaryocytes based on the values ​​measured in step (1).

[0088] In one embodiment, step (2) is step (2'): if the value measured in step (1) is below or less than the benchmark value, the megakaryocytes are evaluated as having high quality. In one embodiment, the benchmark value used in this step is based on the measured value of the biomarker of the present invention in low-quality megakaryocytes (e.g., megakaryocytes that have aged after multiple passages following megakaryocyte establishment or isolation from biological tissue, megakaryocytes expressing high aging markers such as IL-8, etc.). Such measured values ​​are typically measured in a population of megakaryocytes of the subject and a cell population with the same number of megakaryocytes. As the "benchmark value" used in the present invention, for example, the average, mode, median, or a value calculated from these values ​​through arithmetic operations may also be used.

[0089] The baseline values ​​used in this step can be the values ​​of the biomarkers of the present invention measured in high-quality megakaryocytes (e.g., newly established megakaryocytes or megakaryocytes recently isolated from biological tissues, megakaryocytes with low expression of aging markers such as IL-8, etc.).

[0090] The aforementioned baseline value can be a cutoff value. Methods for calculating cutoff values ​​are well-known in this field. For example, an ROC (Receiver Operating Characteristic) curve can be plotted to determine the value at which diagnostic sensitivity and specificity are as close as possible to 100%, and this value can be used as the cutoff value.

[0091] In this specification, "megakaryocyte quality" refers to the megakaryocyte's proliferative capacity and platelet-producing capacity. Therefore, "high megakaryocyte quality" means that at least one (preferably both) of the megakaryocyte's proliferative capacity and platelet-producing capacity is high or expected to be high.

[0092] The detection or quantification of the biomarkers of the present invention in megakaryocytes can be studied by modulating RNA (e.g., total RNA, mRNA) components from a megakaryocyte population and detecting the Ral or Kat7 transcripts contained in those components. Therefore, in one embodiment, the evaluation method of the present invention includes detection or quantification using nucleic acid probes or primers that can specifically recognize Ral or Kat7 transcripts, respectively.

[0093] RNA fractions can be modulated using known methods such as guanidine-CsCl ultracentrifugation and AGPC, or commercially available RNA extraction kits (e.g., RNeasy Mini Kit; manufactured by QIAGEN, etc.) to rapidly and easily modulate high-purity total RNA from trace samples. Methods for detecting Ral or Kat7 transcripts in RNA fractions include, for example, hybridization (Northern blotting, dot blotting, etc.) or quantitative PCR (e.g., real-time PCR, digital PCR, etc.).

[0094] In the case of Northern blotting or dot blot hybridization, the detection or quantification of Ral or Kat7 transcripts can be performed, for example, using nucleic acid probes that specifically recognize Ral or Kat7 transcripts. Examples of such nucleic acid probes include nucleic acids whose base sequence in the known transcript contains a sequence complementary to a region of 15 or more bases, preferably 16 to 100 bases, more preferably 17 to 80 bases, and even more preferably 18 to 50 bases. This nucleic acid can be DNA, RNA, or a DNA / RNA chimera, but DNA is preferred. Furthermore, the nucleic acid used as a probe can be double-stranded or single-stranded. In the case of double-stranded probes, it can be double-stranded DNA, double-stranded RNA, or a DNA:RNA hybrid. In the case of single-stranded probes, nucleic acids containing an antisense sequence can be used.

[0095] The aforementioned nucleic acid probes are preferably labeled with a labeling agent to enable detection of the target nucleic acid. Examples of labeling agents include radioactive isotopes, enzymes, fluorescent substances, and luminescent substances. For example, […]. 32 P]、[ 3 H]、[ 14 [C] etc. As enzymes, stable enzymes with high specific activity are preferred, such as β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase, etc. As fluorescent substances, fluorescein isothiocyanate is an example. As luminescent substances, luminol, luminol derivatives, fluorescein, lucigenin, etc. are examples. Furthermore, biotin-streptavidin can also be used for the binding of the probe to the labeling agent.

[0096] The aforementioned nucleic acid probes can be obtained in the following ways: using a primer set designed based on the transcript sequence of Ral or Kat7, and using cDNA or genomic DNA from cells as a template, amplify the nucleic acid of the desired length by PCR; or, from the cDNA or genomic DNA library, clone the aforementioned gene or cDNA through colony or plaque hybridization, and prepare fragments of appropriate length using restriction enzymes as needed. Alternatively, they can be obtained through chemical synthesis using commercially available automated DNA / RNA synthesizers.

[0097] According to a preferred embodiment, quantitative PCR is employed as a method for detecting or quantifying the transcripts of Ral or Kat7. Quantitative PCR can be performed by known methods, for example, by using total RNA as a template to synthesize cDNA using reverse transcriptase, and performing PCR in the presence of a set of target gene-specific nucleic acid primers, DNA polymerase, and a dye or probe that can act as a DNA intercalation agent for quantifying expression levels.

[0098] Examples of digital PCR include droplet digital PCR (ddPCR) and chip-based digital PCR (cdPCR). Digital PCR is performed, for example, according to the following steps: A reaction solution containing a probe set, a DNA sample, a PCR primer set, and DNA polymerase is placed in a digital PCR apparatus. Here, the mixing ratio of each reaction component can be appropriately selected and optimized within a known range, and can be appropriately changed depending on the primer set or probe set used.

[0099] The detection or quantification of Ral or Kat7 proteins can be performed by modulating protein fractions from a megakaryocyte population and detecting or quantifying the proteins contained within those fractions. These proteins can be detected or quantified using antibodies that specifically recognize each protein, via immunoassays (e.g., ELISA, FIA, RIA, Western blotting, etc.).

[0100] Antibodies that specifically recognize Ral or Kat7 proteins can be manufactured using these proteins or partial peptides with epitopes as immunogens, employing existing general preparation methods. In this specification, antibodies include, but are not limited to, natural antibodies such as polyclonal antibodies and monoclonal antibodies (mAbs), chimeric antibodies that can be manufactured using recombinant technology, humanized antibodies or single-chain antibodies, and their binding fragments. Preferably, the antibody is a polyclonal antibody, a monoclonal antibody, or their binding fragment. A binding fragment refers to a portion of the antibody that has specific binding activity; specifically, examples include, for instance, F(ab')2, Fab', Fab, Fv, sFv, dsFv, sdAb, etc. (Exp. Opin. Ther. Patents, Vol.6, No.5, p.441-456, 1996). There is no particular limitation on the antibody class; antibodies of any isotype, such as IgG, IgM, IgA, IgD, or IgE, are also included. IgG or IgM is preferred, and IgG is more preferred considering ease of purification, etc. Furthermore, in this invention, commercially available antibodies or antibody-containing kits or arrays are preferably used as antibodies that can specifically recognize Ral protein or Kat7 protein, respectively.

[0101] When applying various immunological detection or quantitative methods to the evaluation methods of this invention, no special conditions or procedures are required. Simply incorporate the technical considerations typically employed by those skilled in the art into the general conditions and procedures of each method to construct the detection or quantitative system for the biomarkers of this invention.

[0102] The activity level of the biomarker of the present invention in megakaryocytes can be determined, for example, by the following method. Ral protein exists in two states: GTP-binding (active) and GDP-binding (inactive). Therefore, the activity level can be determined by measuring the amount of GTP-binding Ral protein or calculating the ratio of active to inactive forms. Specifically, examples include the following methods: using a pull-down assay, which uses the Ral binding domain of an effector of the Ral protein (e.g., RalBP1, etc.) to pull down only the active (GTP-bound) RalB and detect or measure the amount of protein by immunological assays; detecting or measuring GTP-bound Ral protein by G-LISA (GTPase-linked Immunosorbent Assay); measuring changes in Ral protein activity by FRET (Förster Resonance Energy Transfer); and measuring the GDP / GTP exchange rate of Ral protein by GDP / GTP exchange assay, etc.

[0103] The activity level of Kat7 protein can be determined by methods such as radiolabeled acetyltransferase assay. 14 C-acetyl-CoA method for determining histone uptake 14 Methods for detecting or measuring acetylated histones include: quantitative methods; immunological assays using anti-acetylated histone antibodies; mass spectrometry (LC-MS / MS) methods for analyzing acetylated histones; and FRET (fluorescence resonance energy transfer) methods for analyzing changes in fluorescence intensity during acetylation.

[0104] In summary, in one embodiment, the evaluation method of the present invention uses nucleic acid probes and / or primers that specifically recognize one or more Ral transcripts, or antibodies that specifically recognize Ral proteins, to detect the biomarker. In another embodiment, the evaluation method of the present invention uses nucleic acid probes and / or primers that specifically recognize transcripts of the Kat7 gene, or antibodies that specifically recognize Kat7 proteins, or antibodies that specifically recognize acetylated histones targeting Kat7 proteins, to detect the biomarker. These evaluation methods can also be used in combination. In one embodiment, the evaluation method of the present invention includes: step (1), detecting the transcript or protein of Ral using nucleic acid probes and / or nucleic acid primers that specifically recognize one or more Ral transcripts, or antibodies that specifically recognize Ral proteins (in one scheme, nucleic acid probes and / or nucleic acid primers that specifically recognize the transcripts of the Ral gene (especially the RalB gene)); and step (2), detecting the transcript or protein of Kat7 using nucleic acid probes and / or nucleic acid primers that specifically recognize the transcripts of the Kat7 gene, or antibodies that specifically recognize the Kat7 protein, or antibodies that specifically recognize acetylated histones targeting the Kat7 protein (in one scheme, antibodies that specifically recognize the Kat7 protein). These steps can be performed sequentially or simultaneously. Alternatively, step (1) can be performed after step (2).

[0105] 3. Kits for quality control of megakaryocytes Furthermore, the present invention also provides a kit for quality control of megakaryocytes (hereinafter referred to as the kit of the present invention). The kit of the present invention preferably comprises a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of Ral, or an antibody that specifically recognizes the Ral protein. Alternatively, in another embodiment, a kit for quality control of megakaryocytes (also included in the "kit of the present invention") is provided, comprising a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes an acetylated histone targeting the Kat7 protein. Only one of these may be included, or multiple may be included. These kits can also be used in combination. In one embodiment, the kit of the present invention comprises: (1) a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of one or more Ral genes, or an antibody that specifically recognizes the Ral protein (in one embodiment, a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Ral gene (especially the RalB gene); and (2) a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes the acetylated histones that are the targets of the Kat7 protein (in one embodiment, an antibody that specifically recognizes the Kat7 protein).

[0106] When the kit of the present invention comprises the nucleic acid probes or nucleic acid primers (also simply referred to as "nucleic acids"), the same nucleic acids exemplified in the evaluation method of the present invention described in section 2 above can be used as these nucleic acids. These nucleic acids can be provided as solids in a dry or alcohol-precipitated state, or dissolved in water or a suitable buffer (e.g., TE buffer, etc.). When used as labeled probes, the nucleic acids can be provided pre-labeled with any of the labeled substances described above, or they can be provided separately from the labeled substances and labeled before use. Alternatively, the nucleic acids can be provided immobilized (also referred to as supported or immobilized on) a suitable substrate. Examples of substrates include, but are not limited to, glass, silicone, plastic, nitrocellulose, nylon, polyvinylidene fluoride, etc. In addition, the following methods can be listed as immobilization methods: introducing functional groups such as amino, aldehyde, SH, and biotin into the nucleic acid in advance, and on the other hand, introducing functional groups that can react with the nucleic acid (e.g., aldehyde, amino, SH, streptavidin, etc.) onto the substrate, and crosslinking the substrate and nucleic acid through covalent bonds between the two functional groups; and, for polyanionic nucleic acids, coating the substrate with polycationic coatings and immobilizing the nucleic acid by electrostatic bonding, etc., but not limited to these methods.

[0107] When the kit of the present invention contains the antibodies as a component, examples of such antibodies include antibodies identical to those exemplified in the evaluation method of the present invention described in section 2 above.

[0108] In addition to the aforementioned nucleic acids or antibodies, the kit of the present invention may also contain other substances required for the reaction used to detect or quantify the expression of the biomarkers of the present invention. These other substances may be provided in coexistence with the nucleic acids or antibodies, or may be provided with separate reagents, provided they do not adversely affect the reaction. For example, when the reaction used to detect or quantify the expression of the biomarkers of the present invention is PCR, examples of such other substances include: reaction buffer, dNTPs, thermostable DNA polymerase, etc. When quantitative PCR is used, competitive nucleic acids or fluorescent reagents (such as the aforementioned intercalating agents or fluorescent probes) may be further included. Furthermore, when the reaction used to detect or quantify the expression of the biomarkers of the present invention is an antigen-antibody reaction, examples of such other substances include: reaction buffer, competitive antibody, labeled secondary antibody (e.g., mouse anti-rabbit IgG labeled with peroxidase or alkaline phosphatase, etc., when the primary antibody is a rabbit antibody), blocking solution, ELISA plates, etc. Additionally, the kit of the present invention may also include an instruction manual describing the method of use of the kit or reagent, evaluation criteria, etc. Moreover, the aforementioned determination kit may, for example, contain one or more biomarkers of the present invention as positive controls. The types or specific examples of reagents, etc., used in the kit of the present invention, and the methods of use, refer to all the contents described in "2. Method for Quality Evaluation of Megakaryocytes".

[0109] 4. Preparation methods of megakaryocytes and platelets In another embodiment, the present invention provides a method for manufacturing megakaryocytes of improved quality. Specifically, a method for preparing megakaryocytes of improved quality (hereinafter, sometimes referred to as "the preparation method of the present invention") includes the step of culturing megakaryocytes in a culture medium containing a Ral (RAS-like proto-oncogene) inhibitor.

[0110] Furthermore, as shown in the following examples, the expression level of the Kat7 gene affects the maintenance of megakaryocyte proliferation and platelet production during the subsequent maturation stage. Therefore, a method for preparing megakaryocytes with improved quality is also provided (this method is also included in the "Preparation Method of the Invention"), which includes the step of increasing the amount of Kat7 protein present in megakaryocytes. The megakaryocytes used in this method are typically megakaryocytes with low Kat7 gene expression. Examples of megakaryocytes with low Kat7 gene expression include, for example, megakaryocytes whose Kat7 gene expression has decreased through multiple passages compared to megakaryocytes after establishment or isolation from biological tissues; and megakaryocytes with low Kat7 gene expression due to a mutation in the Kat7 gene compared to megakaryocytes with the wild-type Kat7 gene.

[0111] These preparation methods can be used in combination. In one embodiment, the preparation method of the present invention includes: step (1), culturing megakaryocytes in a culture medium containing a Ral inhibitor; and step (2), increasing the amount of Kat7 protein present in the megakaryocytes. These steps can be performed sequentially or simultaneously. Alternatively, step (1) can be performed after step (2). In addition, megakaryocytes obtained by the preparation method of the present invention are also provided (sometimes referred to as "megakaryocytes of the present invention"). "Method for preparing megakaryocytes with improved quality" can also be appropriately interpreted as "method for improving the quality of megakaryocytes".

[0112] In this specification, "increasing the amount of Kat7 protein" means that the amount of Kat7 protein present in megakaryocytes is greater than the amount present in megakaryocytes before the step of increasing Kat7 protein presence. This high protein level can be maintained consistently in megakaryocytes or it can be a temporary state. There are no particular limitations on the methods for increasing the amount of Kat7 protein in megakaryocytes. Examples include: introducing the nucleic acid (DNA or RNA) encoding Kat7 protein (hereinafter also referred to as "exogenous nucleic acid") from outside into megakaryocytes or cells capable of differentiating into megakaryocytes (e.g., hematopoietic progenitor cells, pluripotent stem cells, etc.) to force the expression of the protein; modifying promoters through methods such as genome editing to activate the expression of endogenous genes encoding Kat7 protein; adding Kat7 protein to the culture medium and delivering the protein into the cells. Kat7 protein or the nucleic acid encoding it can be introduced into the cells only once or multiple times.

[0113] Exogenous nucleic acids are typically introduced into cells (e.g., megakaryocytes, hematopoietic progenitor cells, pluripotent stem cells, etc.) in the form of expression vectors containing those nucleic acids. Vectors for expressing exogenous nucleic acids can include viral vectors such as retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpesviruses, and Sendai viruses, as well as animal cell expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo). For applications requiring only a single introduction, retroviral or lentiviral vectors are preferred.

[0114] Examples of promoters used in expression vectors include the EF-α promoter, CAG promoter, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rouse sarcoma virus) promoter, MoMuLV (Molony murine leukemia virus) LTR, and HSV-TK (herpes simplex virus thymidine kinase) promoter. In addition to promoters, expression vectors may also contain enhancers, PolyA addition signals, selection marker genes, and SV40 origin of replication, as needed. Useful selection marker genes include, for example, dihydrofolate reductase genes, neomycin resistance genes, and puromycin resistance genes.

[0115] Exogenous nucleic acids can be introduced into cells using various methods, including lipid transfection, liposome transfection, electroporation, nuclear transfection, calcium phosphate coprecipitation, DEAE dextran transfection, microinjection, and gene gun transfection. When the viral vector contains exogenous nucleic acid, a plasmid containing this nucleic acid is introduced into appropriate packaging cells (e.g., Plat-E cells) or a supplementary cell line (e.g., 293 cells). The virus generated in the culture supernatant is then recovered and brought into contact with the cells for infection, thus introducing the virus into the cells.

[0116] In this specification, "improved quality" means that the megakaryocytes prepared after implementing the preparation method of this invention have higher proliferation capacity and / or platelet-producing capacity compared to megakaryocytes prepared before implementing the preparation method of this invention. Furthermore, in this specification, "platelet-producing capacity" refers to the ability of megakaryocytes to produce platelets by forming cell body processes after being brought into the mature phase. The megakaryocytes are brought into the mature phase via the "step of maturing megakaryocytes" described below. In the following examples, the number of megakaryocytes on day 14 after the start of proliferation is divided by the number of megakaryocytes at the time when megakaryocyte proliferation begins. If the proliferation rate calculated thereby is higher than the proliferation rate of megakaryocytes before implementing the preparation method of this invention, the megakaryocytes are considered to have high proliferation capacity. Additionally, as in the following examples, if the proportion of platelets (platelet count / megakaryocyte count) recovered after megakaryocytes have entered the mature phase and have been cultured for 6 days is higher than the proportion in megakaryocytes before implementing the preparation method of this invention, the megakaryocytes are considered to have high platelet-producing capacity.

[0117] The preparation method of the present invention typically includes the step of inducing megakaryocyte proliferation in the presence of a Ral inhibitor. In one formulation, megakaryocytes can begin to proliferate by increasing the levels of MYC protein (especially c-MYC) and apoptosis-inhibiting proteins (especially Bcl-xL) (preferably further increasing the levels of polycomb family proteins (especially BMI1)). There are no particular limitations on the methods for increasing the levels of these proteins in megakaryocytes; examples include methods for increasing the expression level of nucleic acids encoding the proteins, or methods for adding proteins to the culture medium for intracellular delivery. Specifically, methods for increasing the gene expression level of the encoded proteins include, for example, introducing exogenous nucleic acids (DNA or RNA) encoding the proteins into megakaryocytes, or culturing megakaryocytes in the presence of a corresponding agent or stimulus using the aforementioned inducible promoter. From the viewpoint of effective maturation, the period during which the elevated levels of megakaryocyte-inducing factors (especially MYC protein) are maintained in megakaryocytes is preferably limited to the period of megakaryocyte proliferation.

[0118] The Ral inhibitors used in this invention are not limited to specific inhibitors against RalA or RalB, but can also be inhibitors that inhibit both RalA and RalB, or inhibitors that also have inhibitory activity against other molecules (typically other GTPases). Examples of such Ral inhibitors include: RBC6 (Cas No: 381186-64-7), RBC8 (Cas No: 361185-42-4; 6-amino-4-(2,5-dimethoxyphenyl)-1,4-dihydro-3-(2-naphthyl)-pyrano[2,3-c]pyrazole-5-carboxynitrile), RBC10 (CAS No: 362503-73-9), BAY 293 negative control, BQU57, CE3F4, CID-1067700, etc., with RBC8 being preferred. Furthermore, antibodies, peptides, or aptamers against the Ral protein are also preferred. Alternatively, Ral inhibitors can be antisense nucleic acids, siRNAs, shRNAs, hybrid double-stranded nucleic acids, or other Ral expression inhibitors that suppress Ral expression. Only one Ral inhibitor may be used, or multiple inhibitors may be used.

[0119] The concentration of the Ral inhibitor can be appropriately selected by those skilled in the art based on the Ral inhibitor used. When the Ral inhibitor is RBC8, its concentration in the culture medium is typically 1 nM to 100 μM, preferably 10 nM to 10 μM, and more preferably 20 nM to 1 μM (100 nM in one scheme).

[0120] The culture method of this invention can be either suspension culture or adhesion culture, typically suspension culture. Alternatively, megakaryocytes isolated from organisms can be cultured via adhesion culture. There are no particular limitations on the culture time (the time required for megakaryocyte proliferation) in the presence of Ral inhibitors; typically, it is 3 days or more, 5 days or more, 7 days or more, or 10 days or more, and typically, it is 20 days or less, 17 days or less, 15 days or less, or 14 days or less. During the above culture period, it is preferable to change the culture medium every 3 to 4 days.

[0121] Furthermore, there are no particular limitations on the time for culturing megakaryocytes in a medium containing Ral inhibitors (in other words, the time for Ral inhibitors to contact megakaryocytes) and the time for maintaining an elevated level of Kat7 protein in megakaryocytes; it can be limited to the time for megakaryocyte proliferation or can continue for the time for megakaryocyte maturation. Typically, the stated time is 6 days or more, but it can also be 12 days or more, 18 days or more, 24 days or more, 30 days or more, 36 days or more, 42 days or more, 48 days or more, 54 days or more, or 60 days or more.

[0122] In this specification, "suspension culture" refers to culture conducted under conditions in which cells or cell aggregates are kept in suspension in the culture medium; that is, culture under conditions in which a strong cell-matrix bond (cell-matrix junction) is not formed between the cells or cell aggregates and the culture vessel. Suspension culture can be static culture or shaking culture. In the case of shaking culture, as long as the cells are not fixed in one place, it can be called suspension culture.

[0123] There are no particular limitations on the culture containers used for suspension culture. Examples include: flasks, tissue culture flasks, dishes, Petri dishes, tissue culture dishes, multipurpose culture dishes, microplates, microwell plates, microwells, multi-slice plates, multi-well plates, chambered slides, culture dishes, tubes, trays, culture bags, roller flasks, etc. For the shaking culture (also known as "stirred culture") described below, a sealed culture container is preferred. Examples of such culture containers include: tissue culture flasks, culture bags, roller flasks, etc. In addition, in order to enable culture under non-adhesive conditions, the culture container is preferably cell-non-adhesive. As a cell-non-adhesive culture container, containers whose surface has not been artificially treated to improve cell adhesion (e.g., coating treatment with extracellular matrix, etc.) or containers that have undergone artificial adhesion inhibition treatment (e.g., coating treatment with poly-HEMA, etc.) can be used.

[0124] The megakaryocytes used in this invention can be obtained by known methods. Examples include: methods for isolating megakaryocytes from biological tissues (e.g., bone marrow, umbilical cord blood, peripheral blood, etc.) using known methods; methods for inducing differentiation of pluripotent stem cells or hematopoietic progenitor cells; and methods obtained from companies such as ATCC. For example, megakaryocytes can be isolated from biological tissues using methods employing flow cytometry or mass spectrometry flow cytometry, magnetic cell separation, or affinity columns immobilized with the desired antigen, using surface antigens as indicators. The megakaryocytes used in this invention are preferably obtained by inducing differentiation of hematopoietic progenitor cells. Therefore, the preparation method of this invention may include a step of preparing (or “inducing differentiation”) megakaryocytes from pluripotent stem cells or hematopoietic progenitor cells (hereinafter also referred to as the “megakaryocyte preparation step”) before preparing megakaryocytes of improved quality. Hematopoietic progenitor cells can be obtained, for example, by methods for isolating megakaryocytes from biological tissues (e.g., bone marrow, umbilical cord blood, peripheral blood, etc.) or by methods for inducing differentiation from pluripotent stem cells.

[0125] There are no particular limitations on the preparation steps of megakaryocytes, and they can be carried out by known induction methods. As specific examples, megakaryocytes can be prepared using methods described in International Publication No. 2011 / 034073, International Publication No. 2012 / 157586, etc. In one embodiment, the megakaryocyte preparation steps include: step (A) culturing pluripotent stem cells to prepare (or "differentiation-inducing") hematopoietic progenitor cells and / or step (B) culturing hematopoietic progenitor cells to prepare megakaryocytes.

[0126] The method for differentiating pluripotent stem cells into hematopoietic progenitor cells in step (A) is not particularly limited as long as they can differentiate into hematopoietic progenitor cells. For example, the following method can be used: Pluripotent stem cells are cultured on C3H10T1 / 2 in the presence of VEGF according to the method described in Takayama N., et al., J Exp Med.2817-2830 (2010), and modulated by the resulting reticular structure (also called ES-sac or iPS-sac). Here, "reticular structure" refers to a three-dimensional sac-like (with internal cavity) structure derived from pluripotent stem cells, formed by endothelial cell populations, etc., containing hematopoietic progenitor cells. Furthermore, examples include methods based on embryoid formation and the addition of cytokines (Chadwick et al., Cell Stem Cell 2009, 4: 248-62, Saeki et al., Stem Cells 2009, 27: 59-67) or methods co-culturing with xenogeneic stromal cells (NiwaA et al., J Cell Physiol. 2009 Nov;221(2):367-77). Further examples include methods described in International Publication No. 2013 / 075222, International Publication No. 2016 / 076415, International Publication No. 2017 / 221975, Liu S. et al., Cytotherapy, 17 (2015); 344-358, etc.

[0127] "Pluripotent stem cell" refers to a stem cell capable of differentiating into various tissues or cells with different morphologies or functions in an organism, and also capable of differentiating into any system of cells from the three germ layers (endoderm, mesoderm, and ectoderm). Examples of pluripotent stem cells used in this invention include: induced pluripotent stem cells (iPS cells), embryonic stem cells (ES cells), nuclear transfer embryonic stem cells (ntES cells) obtained through nuclear transfer, multipotent germline stem cells (mGS cells), embryonic germline stem cells (EG cells), etc., preferably iPS cells (more preferably human iPS cells). When the aforementioned pluripotent stem cells are ES cells or any cells derived from human embryos, the cells can be prepared by destroying the embryo or by preparing cells without destroying the embryo; from an ethical perspective, cells prepared without destroying the embryo are preferred.

[0128] ES cells are stem cells that are formed from the internal cell blocks of early embryos (e.g., blastocysts) of mammals such as humans or mice. They are pluripotent and have the ability to proliferate based on self-replication. ES cells were first discovered in mice in 1981 (MJ Evans and MH Kaufman (1981), Nature 292:154-156). Subsequently, ES cell lines were also established in primates such as humans and monkeys (JA Thomson et al. (1998), Science 282:1145-1147; JA Thomson et al. (1995), Proc. Natl. Acad. Sci. USA, 92:7844-7848; JA Thomson et al. (1996), Biol. Reprod., 55:254-259; JA Thomson and V.S. Marshall (1998), Curr. Top.Dev.Biol., 38:133-165). ES cells can be established by extracting an internal cell block from the blastocyst of a fertilized egg of the target animal and culturing the internal cell block on a feeder layer of fibroblasts. Alternatively, ES cells can be established using only a single blastomer from a pre-blastocyst cleavage embryo (Chung Y. et al., (2008), Cell Stem Cell 2:113-117) or using an arrested embryo (Zhang X. et al. (2006), StemCells 24:2669-2676).

[0129] As for the ES cell lines used in this invention, if they are mouse ES cells, various mouse ES cell lines established by companies such as inGenious Targeting Laboratory and RIKEN can be used; if they are human ES cell lines, various human ES cell lines established by companies such as the University of Wisconsin, NIH, RIKEN, Kyoto University, National Center for Child Health and Medical Research, and Cellartis can be used. Specifically, examples of human ES cell lines include: CHB-1 to CHB-12, RUES1, RUES2, and HUES1 to HUES28 sold by ESIBio; H1 and H9 sold by WiCellResearch; and KhES-1, KhES-2, KhES-3, KhES-4, KhES-5, SSES1, SSES2, and SSES3 sold by RIKEN.

[0130] iPS cells are cells obtained by reprogramming mammalian somatic cells or undifferentiated stem cells by introducing specific factors (nuclear reprogramming factors (nuclear initialization factors)). Currently, there are many types of iPS cells. Besides the iPSCs established by Yamanaka et al. by introducing four factors—Oct3 / 4, Sox2, Klf4, and c-Myc—into mouse fibroblasts (Takahashi K, Yamanaka S., Cell, (2006) 126: 663-676), other types include: human cell-derived iPSCs established by introducing the same four factors into human fibroblasts (Takahashi K, Yamanaka S., et al., Cell, (2007) 131: 861-872.); Nanog-iPSCs established by sorting and establishing Nanog expression after introducing the above four factors (Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Nature 448, 313-317.); and iPSCs prepared using a method that does not contain c-Myc (Nakagawa M, Yamanaka S., et al., Nature Biotechnology, (2008) 26, 101-106); and iPSC established by introducing 6 factors through a virus-free method (Okita K et al., Nat. Methods 2011 May; 8(5):409-12, Okita K et al., StemCells. 31(3):458-66.). In addition, induced pluripotent stem cells (iPSCs) prepared by Thomson et al. by introducing four factors, OCT3 / 4, SOX2, NANOG and LIN28 (Yu J., Thomson JA., et al., Science (2007) 318: 1917-1920.), induced pluripotent stem cells prepared by Daley et al. (Park IH, Daley GQ. et al., Nature (2007) 451: 141-146), and induced pluripotent stem cells prepared by Sakurada et al. (Japanese Patent Application Publication No. 2008-307007) can also be used.

[0131] In addition, all publicly published papers (e.g., Shi Y., Ding S., et al., Cell Stem Cell, (2008) Vol3, Issue 5, 568-574; Kim JB., Scholer HR., et al., Nature, (2008)454, 646-650; Huangfu D., Melton, DA., et al., Nature Biotechnology, (2008) 26, No 7) Any induced pluripotent stem cell known in the art as described in patent publications (e.g., Japanese Patent Application Publication No. 2008-307007, Japanese Patent Application Publication No. 2008-283972, US2008-2336610, US2009-047263, WO2007-069666, WO2008-118220, WO2008-124133, WO2008-151058, WO2009-006930, WO2009-006997, WO2009-007852) may be used.

[0132] As induced pluripotent stem cell lines, various iPSC lines established by institutions such as the NIH, RIKEN, and Kyoto University can be used. For example, if it is a human iPSC line, the following can be listed: RIKEN's HiPS-RIKEN-1A, HiPS-RIKEN-2A, HiPS-RIKEN-12A, Nips-B2, etc.; Kyoto University's 253G1, 253G4, 1201C1, 1205D1, 1210B2, 1383D2, 1383D6, 201B7, 409B2, 454E2, 606A1, 610B1, 648A1, 1231A3, FfI-01s04, Ff-MH23s01, 15M41, TkDN-sev2, etc.

[0133] The induced pluripotent stem cells used in this invention can be cells derived from patients with hereditary diseases (such as hereditary blood disorders). Cells induced from pluripotent stem cells derived from patients with hereditary blood disorders can serve as disease models reflecting the pathological state of the disease, and are therefore suitable for screening therapeutic or preventative drugs for the disease. Alternatively, pluripotent stem cells derived from patients with hereditary blood disorders can be genetically repaired using genome editing methods such as CRISPR-Cas systems, causing them to differentiate into target cells, thereby enabling these cells to be used as therapeutic agents for the disease.

[0134] There are no specific restrictions on the species from which pluripotent stem cells are derived. For example, cells can come from the following species: rodents such as rats, mice, hamsters, and guinea pigs; lagomorphs such as rabbits; ungulates such as pigs, cattle, goats, and sheep; carnivores such as dogs and cats; and primates such as humans, monkeys, rhesus monkeys, marmosets, orangutans, and chimpanzees. Humans are the preferred source species.

[0135] In this specification, "hematopoietic progenitor cell" refers to a cell capable of differentiating into hematopoietic cell lines such as lymphocytes, eosinophils, neutrophils, basophils, erythrocytes, and megakaryocytes. In this specification, hematopoietic progenitor cells and hematopoietic stem cells are not distinguished and are considered the same cell unless otherwise stated. Hematopoietic progenitor cells are typically cells that express the CD34 and / or CD43 genes.

[0136] Regarding the culture time in step (A), those skilled in the art can determine it appropriately while monitoring the number of hematopoietic progenitor cells. As long as hematopoietic progenitor cells can be obtained, there is no particular limitation on the number of days; typically, it is 6 days or more, preferably 7 days or more, 8 days or more, 9 days or more, 10 days or more, 11 days or more, 12 days or more, 13 days or more, or 14 days or more (especially 14 days). A longer culture time does not pose a problem for the preparation of hematopoietic progenitor cells; typically, it is less than 30 days, but it can also be less than 20 days.

[0137] Step (B) can also be performed by known methods (e.g., those described in WO 2011 / 034073, WO 2012 / 157586, WO 2014 / 123242, and WO 2021 / 075568). Specifically, examples include methods that simultaneously force the expression of an apoptosis-inhibiting gene (e.g., the BCL2L1 gene) and a MYC gene (e.g., the c-MYC gene) in hematopoietic progenitor cells before culturing those cells.

[0138] Regarding the culture time in step (B), those skilled in the art can determine it appropriately while monitoring the number of megakaryocytes. As long as megakaryocytes can be obtained, there is no particular limitation on the number of days; typically 5 days or more, preferably 6 days or more, and more preferably 7 days or more. There is also no particular limitation on the upper limit of the culture period; typically 20 days, preferably 17 days or less, and more preferably 14 days or less.

[0139] Furthermore, in hematopoietic progenitor cells, the expression of the TP53 gene (protein name: p53) and / or the CDKN1A gene (protein name: p21), or the function of their expression products, can also be suppressed. Examples of TP53 genes include those with the nucleic acid sequence shown in NCBI accession number NM_000546.6. Examples of CDKN1A genes include those with the nucleic acid sequence shown in NCBI accession number NM_001291549.3. The source of these genes is not particularly limited, but mammals (e.g., humans, mice, rats, monkeys, cattle, horses, pigs, dogs, etc.) are preferred, with genes from humans being particularly preferred. Alternatively, in one embodiment, these genes are human genes or homologous genes of human genes from other mammalian species. Genes with high base sequence identity to wild-type genes are also preferred (e.g., having more than 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity).

[0140] The megakaryocytes of the present invention are suitable as starting cells for platelet preparation. Therefore, in another embodiment, a method for preparing platelets is provided (hereinafter, sometimes referred to as "the method for preparing platelets of the present invention"). Additionally, platelets obtained by the method of the present invention are sometimes also referred to as "platelets of the present invention"), which includes the step of maturing the megakaryocytes of the present invention.

[0141] The platelet preparation method of the present invention can be carried out by known methods. For example, in the case of forcibly expressing megakaryocyte-inducing factors in megakaryocytes, megakaryocyte maturation can be achieved by reducing or stopping the forced expression of one or more (preferably at least the MYC gene) or all of the megakaryocyte-inducing factors. For example, in the case of forcibly expressing megakaryocyte-inducing factors using a drug, the forced expression can be reduced or stopped by culturing megakaryocytes in the absence of the drug. Furthermore, in the case of introducing the megakaryocyte-inducing factor gene into cells using a vector containing LoxP, this can also be achieved by introducing Cre recombinase into the cells. Moreover, in the case of using a transient expression vector and introducing RNA or protein, this can also be achieved by stopping contact with the vector, etc.

[0142] The platelet preparation method of the present invention uses a culture medium containing any one (preferably all) of ADAM17 inhibitors, AhR (aromatic hydrocarbon receptor) inhibitors, and ROCK inhibitors. Examples of ADAM17 inhibitors include KP-457, DPC333, GW280264X, Aderbasib, TMI-1, and JG26, with KP-457 being preferred. Examples of AhR inhibitors include StemRegenin 1 (SR-1), SR-1 analogs (e.g., compounds described in US2014 / 0369973), stilbene derivatives (e.g., (E)-1-(4'-trifluoromethylphenyl)-2-(3,5-bistrifluoromethylphenyl)-ethylene, (E)-1-(4'-methoxyphenyl)-2-(3,5-dichlorophenyl)-ethylene, (E)-1-(4'-chlorophenyl)-2-(3,5-dichlorophenyl)-ethylene, 3,5,4'-trihydroxystilbene, etc.), CH-223191, etc., with SR-1 being preferred. Examples of ROCK inhibitors include: Y-27632 (e.g., see Ishizaki et al., Mol. Pharmacol. 57, 976-983 (2000); Narumiya et al., Methods Enzymol. 325, 273-284 (2000)), fasudil / HA1077 (e.g., see Uenata et al., Nature 389: 990-994 (1997)), SR3677 (e.g., see Feng Y et al., J Med Chem. 51: 6642-6645 (2008)), GSK269962 (e.g., see Stavenger RA et al., J Med Chem. 50:2-5 (2007) or WO2005 / 037197), GSK429286A, H1152 (e.g., see Sasaki et al., Pharmacol.Ther. 93: 225-232 (2002)), Wf-536 (e.g., see Nakajima et al., Cancer Chemother Pharmacol. 52(4): 319-324 (2003)), Thiazovivin and their derivatives, etc., preferably Y-27632.

[0143] The culture medium used in the platelet preparation method of the present invention may contain the above-mentioned Ral inhibitor. In one embodiment, the culture medium used in the platelet preparation method of the present invention contains a Ral inhibitor. Specific compound types, concentrations in the culture medium, etc., are all described in the preparation method of the present invention. As a Ral inhibitor, RBC8 is preferred, and the concentration of RBC8 in the culture medium is preferably 20 nM to 1 μM (100 nM in one embodiment).

[0144] Mature megakaryocytes induced by the platelet preparation method of the present invention can be CD34-positive and CD41-positive cells. Mature megakaryocytes induced by this method can also be CD38-negative, CD90-positive, and / or CD49f-positive.

[0145] Regarding the culture time in the platelet preparation method of the present invention, there is no particular limitation as long as the platelet function is maintained; for example, it is 2 to 9 days (6 days in one embodiment). When using a Ral inhibitor, the platelet can be cultured in the presence of the Ral inhibitor for the entire culture period (6 days in one embodiment), or for a portion of the culture period. During the above culture period, the culture medium may be changed as appropriate, or it may not be changed; in one embodiment, the culture medium is not changed.

[0146] The platelet preparation method of the present invention typically employs suspension culture. Furthermore, it is preferable to perform the culture while agitating. Therefore, in one embodiment, the platelet preparation method of the present invention includes a oscillation culture step. Oscillating culture can be performed, for example, using a commercially available rotary oscillation culture device (e.g., a VerMES reactor (manufactured by Satake Multimix Co., Ltd.)), by stirring the culture medium through the rotational motion of a stirring paddle. The stirring speed can be 50–200 rpm, for example, approximately 100 rpm.

[0147] The oscillation culture in the platelet preparation method of the present invention can also be implemented using the apparatus and method described in WO 2019 / 009364. Specifically, for example, the following method can be listed, which includes the step of stirring the culture medium in the culture vessel using a stirring paddle, the stirring step including: reciprocating the stirring paddle to sufficiently satisfy one or more of the following indicators (a) to (c).

[0148] (a) Turbulent energy of approximately 0.0005 m² / s² to approximately 0.02 m² / s²; (b) Shear stress of approximately 0.2 Pa to approximately 6.0 Pa; and (c) Kolmogorov scale, approximately 100 μm to approximately 600 μm.

[0149] Furthermore, as a culture device, specifically, a platelet-producing apparatus can be cited as an example, which includes: a container holding a culture medium containing megakaryocytes and a stirring paddle that reciprocates within the container, wherein by causing the stirring paddle to reciprocate within the culture medium, one or more indicators selected from (a) to (c) are sufficiently satisfied, thereby producing platelets from megakaryocytes while the culture medium is being stirred: (a) Turbulent energy of 0.0005 m² / s² to approximately 0.02 m² / s²; (b) Shear stress of approximately 0.2 Pa to approximately 6.0 Pa; and (c) Kolmogorov scale, approximately 100 μm to approximately 600 μm.

[0150] The turbulent energy, shear stress, and Kolmogorov scale in the culture medium within the container being stirred can be obtained through simulation based on the fundamental equations of turbulence. For example, calculations can be performed using the thermal fluid analysis software FLUENT (manufactured by ANSYS), but it is not limited to any particular software. More specifically, in the case of a configuration where the impeller moves in a reciprocating motion, the turbulent energy varies depending on the stroke, speed, and frequency of the impeller's reciprocating motion. When multiple impellers are used, the number of impellers also becomes a variable factor. Shear stress and the Kolmogorov scale also change due to variations in these factors.

[0151] The culture medium used in this invention is not particularly limited, and can be prepared using a culture medium for animal cell culture as the basal medium. Examples of basal media include: IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Dulbecco's Modified Eagle's Medium (DMEM) medium, Ham's F12 medium, RPMI 1640 medium, Fischer's medium, Neurobasal Medium (Life Technologies), and mixtures of these media. The culture medium may contain serum or may be serum-free. Depending on the requirements, the culture medium may also contain one or more substances such as albumin, insulin, transferrin, selenium, fatty acids, trace elements, 2-mercaptoethanol, thioglycerol, lipids, amino acids, L-glutamine, non-essential amino acids, vitamins, growth factors, small molecule compounds, antibiotics, antioxidants, pyruvate, buffers, inorganic salts, and cytokines. Cytokines are proteins that promote the differentiation of the hematopoietic system; examples include VEGF, TPO, and SCF. It is also preferable to use TA-316 ((2E)-2-[1-[5-(4-bromophenyl)-4-hydroxy-3-thienyl]ethylene]hydrazide-5-[[[[4-[[(2-hydroxyethyl)amino]carbonyl]phenyl]methyl]amino]carbonyl]-2-thiencarboxylic acid) instead of TPO. In one embodiment, the culture medium used in the preparation method of the present invention contains SCF and TA-316. In another embodiment, the culture medium used in the platelet preparation method of the present invention contains SCF, TA-316, SR-1, KP-457 and Y27632. In addition, when megakaryocytes have drug-responsive promoters, it is preferable to contain the corresponding drug, such as tetracycline or doxycycline, in the culture medium when expressing the gene under that promoter.

[0152] In this invention, there are no particular limitations on the cell culture conditions, and conventional culture conditions can be used. As specific examples, the culture temperature is, for example, about 35–42°C, about 36–40°C, or about 37–39°C. The CO2 concentration is, for example, about 5–15%. The O2 concentration is, for example, about 15–25%.

[0153] In each step of the preparation method and platelet preparation method of the present invention, cells can be cultured under feeder-free and / or xeno-free conditions. In the preparation method and platelet preparation method of the present invention, the entire process can also be carried out under feeder-free and xeno-free conditions. In this specification, "feeder-free" refers to a culture medium or culture condition that does not contain other cell types (i.e., feeder cells) that play an auxiliary role in optimizing the culture conditions of the target cells. Furthermore, "xeno-free" refers to a culture medium or culture condition that does not contain components of a biological origin different from the biological species of the target cells.

[0154] In each step of the preparation method and platelet preparation method of the present invention, the cell seeding density is not particularly limited, as long as the cells can proliferate. A typical density is 1.0 × 10⁻⁶. 2 ~1.0×10 7 cells / cm 2 Preferably 1.0×10 3 ~1.0×10 6 cells / cm 2 More preferably 1.0×10 4 ~1.0×10 5 cells / cm 2 .

[0155] In the case of small molecule compounds used in this invention, the compounds include not only the free form but also their pharmacologically acceptable salts and hydrates. Pharmacologically acceptable salts vary depending on the type of compound, and examples include: inorganic base salts such as alkali metal salts (sodium salts, potassium salts, etc.), alkaline earth metal salts (calcium salts, magnesium salts, etc.), aluminum salts, and ammonium salts; and organic base salts such as trimethylamine, triethylamine, pyridine, methylpyridine, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, and N,N'-dibenzylethylenediamine, as well as inorganic acid salts such as hydrochloride, hydrobromide, sulfate, hydroiodide, nitrate, and phosphate, and organic acid salts such as citrate, oxalate, acetate, formate, propionate, benzoate, trifluoroacetate, maleate, tartrate, methanesulfonate, benzenesulfonate, and p-toluenesulfonate.

[0156] The various substances used in this invention can be synthesized by known methods or commercially available products can be used. Furthermore, when using proteins or peptides, these proteins or peptides can be obtained from cells that express them. Cells expressing the target protein or peptide can be prepared by inserting DNA encoding the target protein or peptide into a known expression vector and then introducing the resulting expression vector into a suitable host cell.

[0157] The preparation methods of the present invention and the platelet preparation methods of the present invention may include a step of recovering the target cells or tissues obtained in each step. The recovered cells can be cryopreserved using cell cryopreservation solution. In addition, the obtained cells can be counted using a cell counter, labeled with antibodies against cell surface markers, and sorted or purified by flow cytometry, mass spectrometry, or magnetic cell separation methods.

[0158] 5. Uses of megakaryocytes and platelets In another aspect of the invention, megakaryocytes (i.e., megakaryocytes of the invention) and platelets (i.e., platelets of the invention) that are evaluated by the evaluation method of the invention (typically, evaluated as high quality) or obtained by the preparation method and platelet preparation method of the invention (“obtained” may be properly understood as “available”) are provided. Hereinafter, the term “cells of the invention” will sometimes be used to collectively refer to the megakaryocytes and platelets of the invention.

[0159] The cells of the present invention can be used in medical applications such as blood transfusions. Therefore, in another embodiment, a blood preparation (hereinafter, sometimes referred to as "the blood preparation of the present invention") is provided, which comprises the cells of the present invention. In this specification, a blood preparation refers to a composition comprising blood cells such as megakaryocytes and platelets. The megakaryocytes of the present invention, for example, can be used to produce functional platelets in an organism by administration or transplantation. Additionally, the platelets of the present invention can be used, for example, to prevent bleeding caused by thrombocytopenia or platelet dysfunction, to treat bleeding, or to treat blood diseases. Furthermore, the present invention also includes a method for treating or preventing blood diseases or bleeding by administering or transplanting an effective amount of the cells of the present invention to a mammal (e.g., human, mouse, rat, monkey, cattle, horse, pig, dog, etc.) as the object of treatment or prevention. In this specification, unless otherwise stated, the treatment or prevention of a disease (or treatment or prevention method) also includes a drug (or method) that can treat and prevent the disease.

[0160] Blood disorders that are the object of treatment or prevention include, for example, thrombocytopenia and platelet dysfunction. Causes of thrombocytopenia include, for example, pancytopenia due to bone marrow insufficiency; thrombocytopenia caused by platelet destruction leading to shortened platelet lifespan; thrombocytopenia caused by excessive platelet consumption; drug-induced thrombocytopenia; and thrombocytopenia caused by abnormal platelet distribution in organs. Causes of platelet dysfunction include, for example, drug-induced platelet dysfunction and hereditary platelet dysfunction (e.g., thrombocytopenia, Bernard-Soulier syndrome, MYH9 abnormality, Wiskott-Aldrich syndrome, etc.).

[0161] When using the cells of the present invention as a blood preparation, from the viewpoint of avoiding rejection, it is preferable to use iPS cell-derived cells established from somatic cells that are identical or substantially identical to the HLA genotype of the individual to whom the drug is administered or transplanted. Here, "substantially identical" means that the degree of HLA genotype consistency is such that the immune response can be suppressed by immunosuppressants, for example, somatic cells with an HLA type consistent at three loci (HLA-A, HLA-B, and HLA-DR) or four loci (including HLA-C). If sufficient cells cannot be obtained due to age or physical condition, the cells can be encapsulated in capsules, porous containers, or the like, such as polyethylene glycol or silicone, and administered or transplanted while avoiding rejection.

[0162] Furthermore, HLA-A, HLA-B, and HLA-C proteins are closely related to rejection reactions following cell transplantation. Therefore, the cells of this invention preferably have only the HLA-A and HLA-B genes disrupted, or all three loci (HLA-A, HLA-B, and HLA-C) disrupted, and more preferably, the HLA-E gene disrupted further. For example, genetically modified cells with disrupted HLA-A and HLA-B genes, or disrupted HLA-A, HLA-B, and HLA-C genes (optionally further disrupted) in pluripotent stem cells or cells at any stage of differentiation from pluripotent stem cells to platelets (e.g., hematopoietic progenitor cells, megakaryocytes, especially megakaryocytes), can be prepared. These cells can then undergo differentiation induction and / or maturation steps to produce platelets, thereby eliminating HLA protein expression on the platelet surface. This is expected to reduce antigenicity during platelet transplantation. In addition, for patients carrying anti-HLA class I antibodies, transplantable platelet preparations and other blood products can also be provided.

[0163] The cells of the present invention can be mixed with pharmaceutically acceptable carriers using conventional methods to prepare parenteral preparations such as injections, suspensions, and infusions. Therefore, in one embodiment, a method for preparing a blood preparation is also provided, which includes the step of preparing the cells of the present invention into a formulation. The preparation method may include the step of preparing the cells of the present invention. Furthermore, it may also include the step of preserving the cells of the present invention.

[0164] Pharmaceutically acceptable carriers that can be included in this parenteral preparation include, for example, physiological saline, isotonic solutions containing glucose or other excipients (e.g., D-sorbitol, D-mannitol, sodium chloride, etc.), and other aqueous solutions for injection. The cells of the present invention can also be blended with, for example, human plasma, infusion solutions, buffers (e.g., phosphate-buffered saline, sodium acetate buffer), analgesics (e.g., benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (e.g., human serum albumin, polyethylene glycol, etc.), preservatives, antioxidants, etc.

[0165] The blood preparations of the present invention can also be provided frozen under conditions typically used for cell cryopreservation, and used after thawing. In this case, it may further comprise serum or a substitute thereof, an organic solvent (e.g., DMSO), etc. In this case, the concentration of serum or a substitute thereof is not particularly limited, and may be from about 1 to about 30% (v / v), preferably from about 5 to about 20% (v / v). The concentration of the organic solvent is not particularly limited, and may be from 0 to about 50% (v / v), preferably from about 5 to about 20% (v / v).

[0166] Furthermore, the cells of the present invention can also be used in methods for screening agents, i.e., candidate agents, for the treatment or prevention of blood diseases. Therefore, in yet another aspect of the present invention, a method for screening agents for the treatment or prevention of blood diseases is provided, comprising the step of culturing the cells of the present invention in the presence or absence of a test substance. For example, using a disease model reflecting the condition of a blood disease as cells, if the pathological condition improves in the presence of the test substance, the test substance can be sorted as a candidate substance for the treatment or prevention of the blood disease. Examples of such blood diseases include those identical to those described above as targets for treatment or prevention by the blood preparations of the present invention.

[0167] The step of contacting the test substance with the cells of the present invention is typically performed by adding the test substance to the culture medium in which the cells of the present invention are cultured, or by transferring the cells of the present invention to a culture medium pre-added with the test substance. The time for contacting the test substance with the cells of the present invention is not particularly limited, but is typically from 1 minute to 5 days, preferably from 1 hour to 1 day.

[0168] Examples of test substances used in this invention include: cell extracts, cell culture supernatants, microbial fermentation products, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic small molecule compounds, and natural compounds. Test substances can be existing or candidate ingredients of pharmaceuticals or nutritional foods.

[0169] The present invention will be more fully understood by referring to the following embodiments, which provide exemplary and non-limiting implementations of the invention. Example

[0170] <Results> Identification of endogenously active miRNAs in imMKCL miRNA switch technology refers to gene circuits that regulate transgene expression via miRNA activity, controlling the expression of synthetic mRNAs (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015); Fujita, Y. et al. SciAdv 8, eabj1793 (2022)). The inventors hypothesize that miRNA switches can be used to identify imMKCL subsets with different miRNA activities, potentially providing a useful tool for exploring heterogeneity within imMKCL. Figure 1 a schematic diagram of the miRNA switching technology is shown. The inventors designed a synthetic mRNA containing a complementary sequence to the target miRNA in its 5' untranslated region (UTR) and encoding a reporter fluorescent protein for monitoring endogenous miRNA activity. As a transfection control, a pair of mRNAs, namely an mRNA encoding Azami-Green 1 (AG1) and an mRNA encoding TagBFP containing the target miRNA sequence, were synthesized and co-transfected into imMKCL. Figure 1 b). In cells exhibiting endogenous activity against specific miRNAs, the expression level of TagBFP was determined by flow cytometry. Figure 1 c). A screening based on miRNA switches was performed using a library containing 269 miRNA switches (Table 1). The results identified 24 miRNAs with endogenous activity in imMKCL. Figure 1 d).

[0171] [Table 1-1] The target miRNAs included in the screening library for miRNA switches. miR-1234-5p miR-185-3p miR-301a-5p miR-425-3p miR-497-5p miR-10b-3p miR-329 miR-144-3p miR-211-3p miR-485-5p miR-450-5p miR-379-5p miR-629-5p miR-362-3p miR-589-5p miR-671-5p miR-506-3p miR-125b-1-3p miR-30b-3p miR-296-3p miR-506-5p miR-361-3p miR-582-3p miR-422a miR-98-3p miR-499a-5p miR-24-2-5p miR-105-5p miR-381-3p miR-181b-3p miR-122-5p miR-27a-5p miR-505-5p miR-454-3p miR-301a-3p miR-510 miR-411-5p miR-29c-5p miR-148b-5p miR-204-3p miR-486-3p miR-125b-2-3p miR-212-5p miR-582-5p miR-197-5p miR-222-5p miR-93-3p miR-483-5p miR-576-5p miR-146a-3p miR-548-3p miR-34a-3p miR-190a miR-383 miR-140-5p miR-326 miR-576-3p miR-219-5p miR-342-5p miR-590-3p miR-133a miR-17-3p miR-17-5p miR-1 miR-206 miR-21-5p miR-367-3p miR-373-5p miR-92a-3p miR-16-5p miR-197-3p miR-24-3p miR-339-5p miR-224-5p miR-127-3p miR-365a-3p miR-183-5p miR-331-3p miR-203a miR-214-3p miR-137 miR-298 miR-325 miR-449a miR-498 miR-661 miR-429 miR-1182 miR-208a-3p miR-320b miR-423-5p miR-140-3p miR-378c miR-185-5p miR-101-3p miR-378b miR-128 miR-509-5p miR-340-5p miR-25-5p miR-92b-3p miR-320c miR-508-3p miR-744-5p miR-3180-3p miR-30d-3p miR-215 miR-4510 miR-1260a miR-151a-5p miR-584-5p miR-503-5p miR-34c-5p miR-3180 miR-514a-3p miR-374b-5p miR-28-3p miR-1307-5p miR-21-3p miR-193a-5p miR-1269a miR-365b-3p miR-4286 miR-4454 miR-138-5p miR-1307-3p miR-652-3p miR-502-3p miR-92b-5p miR-501-3p miR-1285-3p miR-126-3p [Table 1-2] miR-4531 miR-193b-5p miR-181a-2-3p miR-1301 miR-877-5p miR-4443 miR-425-5p miR-320d let-7a-3p miR-92a-1-5p miR-365b-5p miR-142-3p miR-320e miR-106b-3p miR-548 miR-1261 miR-9-3p miR-129-1-3p miR-424-3p miR-760 miR-365a-5p miR-374a-5p miR-873-5p miR-30c-2-3p miR-99b-3p miR-4532 20b-3p miR-4448 miR-363-5p miR-145-3p miR-574-5p miR-223-3p miR-4521 miR-22-5p miR-339-3p miR-16-2-3p miR-374a-3p miR-542-3p miR-452-5p miR-513a-3p miR-532-39 miR-548a-3p miR-27b-5p miR-3180-5p miR-4324 let-7d-3p miR-184 miR-95 miR-664a-5p let-7a-5p let-7g-5p let-7i-5p miR-191-5p miR-125b-5p miR-100-5p miR-342-3p miR-210 miR-193b-3p miR-99b-5p miR-106b-5p miR-27a-3p miR-30a-3p miR-423-3p miR-409-3p miR-186-5p miR-324-3p miR-22-3p miR-378a-3p miR-196b-5p miR-296-5p miR-99a-5p miR-34a-5p miR-501-5p miR-500a-3p miR-155-5p miR-182-5p miR-10a-5p miR-345-5p miR-335-5p miR-362-5p miR-193a-5p miR-134 miR-195-5p miR-26a-5p miR-151a-3p miR-200c-3p miR-212-3p miR-143-3p miR-149-5p miR-28-5p miR-505-3p miR-192-5p miR-187-3p miR-129-5p miR-106a-5p miR-299-3p miR-483-3p miR-18a-3p miR-330-3p miR-200b-3p miR-154-5p miR-150-5p miR-145-5p miR-199a-5p miR-135a-5p miR-200a-3p miR-133b miR-141-3p miR-148a-3p miR-9-5p miR-520c-3p miR-328 miR-361-5p miR-375 miR-378a-5p miR-382-5p miR-484 miR-486-5p miR-7-5p miR-124-3p miR-302a-5p miR-370 miR-373-3p miR-492 miR-509-3p miR-512-5p miR-516b-5p miR-518b miR-518c-3p miR-518c-5p miR-519d miR-520f miR-520g miR-523-3p miR-525-5p miR-526a miR-98-5p Concentration of immune-biased imMKCL using Let-7 miRNA switch Among activated miRNAs, the inventors focused on let-7a-5p and let-7g-5p, which exhibit heterogeneous activity between imMKCLs. Figure 2 a). The inventors divided the samples into subgroups with high and low let-7 activity, with the low-let-7 activity subgroup comprising less than 5% of the total. The inventors confirmed that the let-7 activity levels in these subgroups correlated with their expression levels within the imMKCL subgroup. Figure 3a) To characterize the molecular differences between the high and low let-7 subsets, the inventors performed bulk RNA-seq analysis using three different imMKCL clones (M35-1, clone 7, and clone 7-3) during their proliferation and maturation phases. The characteristics of the imMKCL from clone 7 and the function of its derived iPSC-PLT have been reported (Non-Patent Literature 2, 3). Furthermore, clone 7 has been used by several research groups in studies of megakaryopoiesis and thrombopoiesis (Lo, RW et al. Blood 136, 715-725 (2020); VerDonck, F. et al. Blood (2023); Seo, H. et al. Blood Adv 2, 2262-2272 (2018)), highlighting its importance as a research tool. Also selected was clone 7-3, which, through repeated subculture, exhibited a senescence phenotype characterized by decreased proliferative capacity or reduced iPSC-PLT production. Figure 3 b). Because M35-1 exhibited superior proliferative capacity and iPSC-PLT generation capacity compared to imMKCL clones from other suitable patients, M35-1 was established from patient iPSCs for iPLAT1 clinical trials (Non-Patent Literature 5). Equal iPSC-PLT generation was observed in both low-let-7 and high-let-7 subpopulations across the three clones. Figure 3 c).

[0172] For the sampling steps of batch RNA-seq, see [link to sample collection procedure]. Figure 2 b. Differential gene expression analysis identified several genes whose expression profiles changed between let-7 high imMKCL and let-7 low imMKCL. To identify enriched transcriptional pathways in each subpopulation, the inventors performed gene set enrichment analysis (GSEA). In particular, the inventors observed that in let-7 low imMKCL, immune-related gene sets were significantly enriched in both the proliferation and maturation phases. Figure 2c, d). Particularly during the proliferative phase, gene sets involved in responses to tumor necrosis factor (TNF), lipopolysaccharide (LPS), and enterotoxin were enriched in let-7 sluggish cells, a finding consistent with reports of nascent mouse and human megakaryocytes possessing pathogen-sensing capabilities (Pariser, DN et al. J Clin Invest 131 (2021); Campbell, RA et al. Blood 133, 2013-2026 (2019)). This also suggests that TNF-driven inflammation induces age-related platelet hyperreactivity (Davizon-Castillo, P. et al. Blood 134, 727-740 (2019)). During maturation, gene sets related to interferon signaling were significantly enriched in let-7 sluggish cells. Among these, immune-related characteristics remained consistent from the proliferative phase to maturity (…). Figure 2 (eh, Table 2). These findings suggest that imMKCLs with low let-7 activity selectively enrich the expression patterns of immune-biased MKs. Batch RNA-seq analysis by the inventors further clarified that in the subset of immune-biased imMKCLs with low let-7 activity, multiple genes encoding chemokines or cytokines, including CXC motif chemokine ligand 10 (CXCL10), CC motif chemokine ligand 2 (CCL2), and CCL3, were upregulated. Figure 2 f, h), suggesting the consistency of multiple immune responses mediated by the secretion of these molecules (Cunin, P. & Nigrovic, PA J Leukoc Biol 105, 1111-1121 (2019)). Interestingly, elevated mRNA levels of these molecules have been reported in patients with severe acute respiratory syndrome (SARS) or Middle East respiratory syndrome (MERS) (Channappanavar, R. & Perlman, S. Semin Immunopathol 39, 529-539 (2017)). Moreover, in COVID-19 patients, elevated mRNA expression levels of CXCL10, CCL2, and TNF were associated with increased MK (Ren, X. et al. Cell 184, 5838 (2021); Bernardes, JP et al. Immunity 53, 1296-1314.e1299 (2020)).

[0173] [Table 2] low imMKCL of let-7 and CD34 from low ESC of let-7 during the proliferation or differentiation phases + A set of immune-related genes that are significantly enriched in cells Identification of Immunotyped MK using let-7 miRNA switch The inventors further verified whether immunogenic MKs directly differentiated from human embryonic stem cells (ESCs) can be identified via a let-7 miRNA switch. The inventors used CD34 prepared by the Sac. method (Takayama, N. et al. Blood 111, 5298-5306 (2008); Yuzuriha, A. et al. Stem Cell Res 53, 102287 (2021)). + Batch RNA-seq analysis was performed on two independent cell populations (HPCs) with different activities of let-7a-5p and let-7g-5p. Figure 4 a). GSEA confirmed that immune-related gene sets are also enriched in HPC derived from let-7 low ESC. Figure 4 (b, c, Table 2) This result suggests that the fate determination of immune-biased MKs during MK production can occur as early as the hematopoietic progenitor cell stage.

[0174] The heterogeneity and functional diversity of imMKCL were clarified using scRNA-seq. To further characterize the cellular heterogeneity of imMKCLs and explore the mechanism by which "immune" imMKCLs are enriched through let-7 miRNA switching, the inventors performed single-cell (sc) RNA-seq analysis on let-7 low and let-7 high imMKCLs in the proliferative phase. Since the similar behavior of let-7a-5p and let-7g-5p miRNA switches has been confirmed in batch RNA-seq analysis (…),… Figure 2 Therefore, the investigation focused on let-7a-5p. Five transcriptionally distinct imMKCL subsets were identified. Figure 5 a) where let-7 low imMKCL is relatively concentrated in clusters 3 and 5 ( Figure 5 b). The inventors further identified the expression of the genes with the greatest differential expression (DEG) and characterized the gene ontology (GO) entries enriched in each cluster. Figure 5 c, d).

[0175] In cluster 1, GO:BP (biological process) entries associated with oxidative phosphorylation were enriched, suggesting their role in energy supply. Conversely, in clusters 2 and 4, GO:BP entries associated with cell cycle and nuclear division in mitosis were enriched, indicating a MK precursor cell subset involved in cell division. Two marker genes for MK in cell division, PCNA (proliferating cell nuclear antigen) and TPM4 (tropomyosin 4), were identified, consistent with recent studies on MK in human bone marrow (BM) cell division (Liu, C. et al. Adv Sci (Weinh) 8, e2100921 (2021)). In cluster 3, genes associated with platelet activation and blood coagulation were highly expressed, suggesting a MK precursor cell subset specifically engaged in platelet production. In particular, genes related to platelet regeneration, such as thromboretin 1 (THBS1) (non-patent literature 7), von Willebrand factor (VWF) (Ruggeri, ZM Von Willebrand factor, platelets and endothelial cell interactions. J ThrombHaemost 1, 1335-1342 (2003)), and platelet membrane glycoprotein IX (GP9) (Romo, GM et al. J Exp Med 190, 803-814 (1999)), were expressed at higher levels in cluster 3 compared to other clusters. Figure 5 f). Furthermore, genes related to immune system processes are enriched in cluster 3, suggesting that it may exhibit a functionally dualistic subset of MK precursor cells. For example, one of the most abundant DEGs in cluster 3, platelet factor 4 (PF4), promotes blood clotting (f). Figure 5 c)(Kowalska, MA, Rauova, L. & Poncz, M. Thromb Res 125, 292-296 (2010)), through its influence on the activity of macrophages (Scheuerer, B. et al. Blood 95, 1158-1166 (2000)) and neutrophils (Xiao, Z., Visentin, GP, Dayananda, KM & Neelamegham, S. Blood 112, 1091-1100 (2008)), has become an important regulator of innate immunity. Moreover, proplatelet basic protein (PPBP), a neutrophil activator against bacteria (Laarman, AJ et al. EMBO J 31, 3607-3619 (2012)), was also significantly upregulated in cluster 3.

[0176] Clusters 3 and 5 both represent subsets of MK progenitor cells with potentially elevated expression of immune-related genes. According to GO analysis, the immune genes annotated in clusters 3 and 5 are involved in immune system processes and immune responses. Figure 5 e). In cluster 5, gene clusters involved in type I interferon, cytokines, and viral responses are highly expressed, in contrast to cluster 3, which appears to respond to myeloid leukocyte-mediated immunity. CCL5, an important inflammatory chemokine (Marques, RE, Guabiraba, R., Russo, RC & Teixeira, MM Expert Opin Ther Targets 17, 1439-1460 (2013)), is one of the most abundant DEGs in cluster 5. In particular, CCL5 has been reported to promote the formation of platelet precursor cells in platelet regeneration (Machlus, KR et al. Blood 127, 921-926 (2016)), and its expression is upregulated in cluster 3 compared to clusters 1, 2, or 4. Figure 5 c, f). The interferon-stimulated gene associated with interferon-like protein 15 (ISG15) (Perng, YC & Lenschow, DJ Nat Rev Microbiol 16, 423-439 (2018)), which is covalently bound to both host and viral proteins, was identified as a front-end DEG of cluster 5. Considering that the secretion of type I interferon by virus-infected cells is a characteristic of antiviral immunity (Grandvaux, N., tenOever, BR, Servant, MJ & Hiscott, J. Curr Opin Infect Dis 15, 259-267 (2002)), these results suggest that cluster 5 represents a representative “immunotype” MK associated with antiviral function. In recent in vivo models of initial MK, the existence of "immune-type" MK, MK supporting hematopoietic stem cell (HSC) niches, and MK biased towards platelet regeneration has been confirmed (Non-Patent Literature 7, 8; Liu, C. et al. Adv Sci (Weinh) 8, e2100921 (2021)). In particular, these results suggest that imMKCL contains a platelet-biased subset (cluster 3) and a representative immune-type subset (cluster 5). Although the niche-supporting subset was not observed, it is believed that imMKCL contains the same immune-biased cell population as the cell population found in endogenous MK.

[0177] Inhibition of let-7a-5p activity drives the production of "immunotype" imMKCL. Next, in order to investigate whether let-7 functionally drives the generation of the "immune" subset in imMKCL, the inventors conducted a loss-of-function experiment. Figure 6 a). When the expression / activity of let-7a-5p is inhibited using a let-7a-5p inhibitor ( Figure 6 b, c) revealed increased expression of various immune-related molecules, including PF4, PPBP, ISG15, and interferon-induced protein with tetratricopeptide repeats 3 (IFIT3), identified in clusters 3 and 5. Figure 6 e). The inventors also investigated whether inhibiting let-7a-5p activity in imMKCL altered the response to immune stimulation. Cells were stimulated with LPS, a pathogen receptor agonist, or control buffer, and the supernatant was analyzed using a flow cytometry-based flow cytometry microsphere array kit. The inventors found that inhibiting let-7a-5p in imMKCL promoted the secretion of interleukin-8 (IL-8), an important inflammatory chemokine (David, JM, Dominguez, C., Hamilton, DH & Palena, C. Vaccines (Basel) 4 (2016)). Figure 6 d). It is known that IL-8 and its receptor regulate the proliferation and maturation of MK (Emadi, S. et al. Blood 105, 464-473 (2005)). These results are consistent with previous reports that human cord blood-derived MK produce IL-8 even without stimulation (Higuchi, T. et al. Br J Haematol 99, 509-516 (1997)). In conclusion, the inventors conclude that let-7a-5p is a functional factor regulating the production of "immunotyped MK" between imMKCLs.

[0178] RALB is a functional target of let-7a-5p in the production of immune-biased imMKCL. Previous experiments have established the important role of let-7a-5p in immune-biased imMKCL. To further identify the underlying factors contributing to immune-related outcomes, an ingenuity pathway analysis (IPA) was performed to investigate upstream regulators of clusters 3 and 5 (let-7 low imMKCL). Figure 7'a' represents a flowchart illustrating the overall analysis design. The results of the IPA analysis, in cluster 3, identified the transcription factor GATA1 (Orkin, SH, Shivdasani, RA, Fujiwara, Y. & McDevitt, MA Stem Cells 16 Suppl 2, 79-83 (1998)) and the myelogenetic regulator KLF2 as potential transcriptional activators. Figure 7 b). In particular, it was shown that KLF2 regulates the host's innate immune response to multi-species infection (Mahabeleshwar, GH et al. Immunity 34, 715-728 (2011)). On the other hand, in cluster 5, known activators of virus-induced intracellular genes, such as IRF7 (Ning, S., Pagano, JS & Barber, GN Genes Immun 12, 399-414 (2011)) and IRF3 (Kubota, T. et al. J Biol Chem 283, 25660-25670 (2008)), were identified as potential upstream regulators. Figure 7 b). The inventors also compared the common upstream regulatory factors of clusters 3 and 5 with the predicted targets of let-7a-5p ( Figure 7 c). This analysis identified 20 candidate upstream regulators, of which 8 showed detectable expression levels in imMKCL. Figure 7 d). Furthermore, based on the elevated expression levels in the enriched low-let-7 clusters (clusters 3 and 5), it is suggested that cut-like homeobox 1 (CUX1) and RAS-like proto-oncogene B (RALB) are targets of let-7a-5p. Figure 7 e) can contribute to the observed immune-related outcomes. Subsequently, by inhibiting let-7a-5p, the mRNA expression levels of CUX1 and RALB were upregulated in both the proliferative and maturation phases. Figure 7 f). Although CUX1 overexpression did not have a significant effect ( Figure 8 However, due to the overexpression of RALB, the mRNA expression of IRF7, ISG15, and IFIT3 was upregulated. Figure 7 g, h, Figure 9 a, b), but it does not affect the expression level of let-7a-5p ( Figure 9 c). On the other hand, although predicted to be an upstream regulator of both clusters 3 and 5, RALB overexpression does not affect the expression of platelet-related genes identified in cluster 3. Figure 9d). This demonstrates that different let-7 targets may be involved in the regulation of immune and platelet-forming pathways in imMKCL. Combined with insights from IPA analysis ( Figure 7 b) The inventors propose that let-7a-5p modulates the immune properties of imMKCL by targeting RALB. Figure 7 i).

[0179] Dysregulation of immune characteristics / subgroups is associated with the quality of imMKCL The inventors previously reported that certain imMKCL clones with slow proliferation rates during the proliferation phase have a low ability to generate iPSC-PLTs. Figure 10 a)(Non-Patent Literature 9). However, the transcriptional characteristics of cellular senescence / aging ( Figure 11 a), b), and the factors causing the decline in the quality of imMKCL remain unclear. Therefore, the inventors reanalyzed the GSEA of MKCLs of various qualities used in previous studies (non-patent document 9). Similar to the GSEA of let-7 low group and let-7 high group ( Figure 2 ), and found that the gene sets of TNF signaling and interferon response were significantly enriched in medium to low quality MKCLs (). Figure 10 b、 Figure 11 c). The inventors also discovered that although clone 7 and clone 7-3 originated from the same iPSC clone with the same genetic background (non-patent literature 2, 3), they exhibited different characteristics regarding proliferation and iPSC-PLT generation under static and turbulent conditions. Figure 10 The activity modes of let-7a-5p are also different (ce), Figure 12 a). Compared to clone 7, clone 7-3 showed enrichment in TNF signaling and interferon response signals ( Figure 10 f、 Figure 12 b). These results suggest that the induced immune-related pathway is associated with low-quality imMKCL. Further confirmation via GSEA indicated that the target of the downregulated tumor protein 53 (TP53) was abundant in clone 7. Figure 12 c), this indicates cellular senescence in clone 7-3. The mRNA expression and IL-8 secretion of RALB in clone 7-3 were both higher than in clone 7 (c). Figure 10 g, h). Inflammatory cytokines are known to be secreted by senescent cells with persistent DNA damage (Rodier, F. et al. Nat Cell Biol 11, 973-979 (2009)). Except for IL-8 secretion ( Figure 10In addition to h), genes encoding inflammatory cytokines (IFNB1, CXCL8, CXCL10, CXCL11) also showed higher expression levels in clone 7-3 (senescent clone) than in clone 7 (younger clone). Figure 12 d). In particular, inducing recombinant IL-8 in imMKCL leads to a reduction in iPSC-PLT generation ( Figure 13 On the other hand, blocking IL-8 signaling with the specific CXCR1 / 2 inhibitor reparibine (Gorio, A. et al. J Pharmacol Exp Ther 322, 973-981 (2007)) did not affect proliferation (data not shown), but improved iPSC-PLT production (ac). Figure 13 dg). Moreover, by administering recombinant interferon-α2a, not only was the proliferation rate reduced ( Figure 14 a) The formation of iPSC-PLT also decreased in a concentration-dependent manner. Figure 14 b, d). Interferon treatment increased the mRNA expression of CDKN2A, a marker of aging, and ISG15 and IFIT3, interferon response genes, in imMKCL. Figure 14 c). In summary, these insights suggest that the dysregulation of immune characteristics / subpopulations and the secretion of inflammatory cytokines within imMKCLs can be attributed to the upregulation of RALB levels, leading to the cessation of proliferation and decreased platelet production across the entire imMKCL population. Furthermore, these results highlight the influence of immune cytokines on the in vitro preparation of iPSC-PLTs, which has significant implications for clinical applications.

[0180] Interestingly, studies on RALB revealed that upregulation of RALB levels induced proliferation arrest, decreased iPSC-PLT production, and increased IL-8 secretion. Figure 15 (ad), and also accompanied by transcriptional features of cellular senescence / aging (ad). Figure 16 a). The inventors believe that this mechanism has the potential to reproduce the characteristics of low-quality imMKCLs. Furthermore, through batch RNA-seq analysis, it was clarified that TNF signaling and interferon responses are enriched in imMKCLs that overexpress RALB. Figure 15 e Figure 16 b) This further supports the inventors' hypothesis. Furthermore, the expression level of RALB is correlated with the expression levels of interferon response genes in multiple imMKCL clones ( Figure 15 f).

[0181] To verify the effectiveness of RALB, the inventors employed two other methods. One method involved adding 0.1 μM of RBC8, a small molecule compound reported as a selective inhibitor of GTPase Ral. Figure 17 a)(Yan, C. et al. Nature 515, 443-447 (2014)), the results promoted proliferation ( Figure 17 b) and improved the generation of iPSC-PLT ( Figure 17 ce). siRNA-mediated RALB knockdown also promotes iPSC-PLT generation ( Figure 17 f, g). Although no significant changes were observed in IL-8 secretion ( Figure 17 h), but due to RALB knockdown, the mRNA expression levels of IRF7, ISG15, and IFIT3 decreased ( Figure 17 i). Finally, iPSC-PLT generated from low-quality clones showed reduced PAC-1 binding and P-selectin expression (i). Figure 18 These results suggest that dysregulation of immune properties / subgroups within imMKCL is associated with decreased imMKCL proliferation and reduced iPSC-PLT production, and this phenotype may be caused by upregulation of RALB expression.

[0182] Finally, the inventors used umbilical cord blood CD34 + The insights of this study were validated in a cell-derived in vitro differentiated MK model. Figure 19 a). Inhibition of let-7 has no significant effect on interferon signaling or platelet production. Figure 19 However, due to the overexpression of RALB, interferon response genes are upregulated and platelet production is reduced. Figure 19 These results suggest that imMKCL and primary MK show different responses to let-7 inhibition, but the effects of RALB are common, highlighting the extremely important role of RALB in determining the immune characteristics / subgroups in MK production.

[0183] LT-C imMKCL's KAT7 and H3K14ac levels decreased Cell cycle arrest is also an indicator of cellular senescence (Kumari, R., Jat, P., 2021. Front. CellDev. Biol. 9, 645593; MohamadKamal, NS et al. 2020. Eur. J. Cell Biol. 99,151108). The inventors previously reported that clones with low or moderate PLT production capacity exhibited senescence characteristics (Sone, M. et al. Stem Cell Reports 16, 2861-2870 (2021)). In particular, KAT7 was suggested to be a novel regulator of cellular senescence (Wang, W. et al., 2021. Sci. Transl. Med. 13,eabd2655). Therefore, KAT7 levels, potentially related to proliferation rate and subsequent PLT production capacity, were detected in ST-C (short-term culture, less than 1 month) and LT-C imMKCL (long-term culture, more than 4 months). Western blot analysis revealed that, compared to ST-C imMKCL, the levels of KAT7 and its downstream H3K14ac proteins were decreased in both LT-C imMKCL and iPSC-derived imMKCL (WS imMKCL) from Werner syndrome, a known progeria disorder (Paul, SK, et al. 2024. Nat. Commun. 15, 4772). Figure 21 A, B). Furthermore, compared to ST-C imMKCL, WSimMKCL showed decreased proliferative capacity and platelet production capacity (A, B). Figure 21 (C, D). These results suggest that KAT7 is an important regulator of imMKCL proliferation, and that age-dependent KAT7 levels can affect cell cycle progression.

[0184] Pharmacological inhibition of KAT7 induces cell cycle arrest and inhibits the proliferation and maturation of imMKCL. To investigate the role of KAT7 in imMKCL, the KAT6 / KAT7 inhibitors WM3835 and WM1119 were first used to inhibit H3K9 acetylation activity. Preliminary experimental results confirmed that, compared with WM1119, 5 μM of WM3835 significantly reduced H3K14ac levels, thus suggesting that it is suitable as a selective KAT7 inhibitor in this study (MacPherson, L., et al. 2020. 266-270). Figure 22 A). During days 1 to 5 of the Dox-free phase, the PLT generation capacity was not affected even with the administration of WM3835, suggesting that KAT7 is ineffective during the maturity phase. Figure 22B). Conversely, pretreatment of WM3835 for 3 or 6 days with Dox had no effect, but pretreatment for 9 days followed by Dox removal and a further 6 days of platelet maturation significantly reduced platelet production. Figure 22 C, D). Analysis using the Fucci sensor confirmed that inhibiting KAT7 increased cells in G0 phase and decreased cells in G1 and G2 / M phases. Figure 22 E).

[0185] To avoid off-target effects caused by WM3835, shRNA-mediated KAT7 knockdown (shKAT7) was also performed, and RT-qPCR confirmed a significant reduction in KAT7 mRNA expression. Figure 23 A). In shKAT7 imMKCL, both cell proliferation and platelet production were significantly reduced ( Figure 23 B). Additionally, in shKAT7 imMKCL, the proportion of cells in G0 phase increased twofold, suggesting that knockdown of KAT7 leads to cell cycle arrest in G0 phase. Figure 23 C). These results confirm a phenotype similar to that observed with WM3835 treatment. On the other hand, even with overexpression of KAT7, there were no changes in proliferation rate, PLT production, or cell cycle status. Figure 23 Based on these results, KAT7 is important for maintaining the cell cycle of imMKCLs in the Dox phase, highlighting its role in maintaining imMKCL proliferative capacity and influencing platelet production in subsequent maturation phases.

[0186] <Materials and Methods> cell Human iPSC lines TkDN-Sev2 and T-1 were established in the inventors' laboratory. imMKCL (clone 7, clone 7-3, M35-1) were induced from human iPSCs using DOX-induced type limiting factor and used in previous studies (Non-Patent Literature 2, 3). Human ESC line KhES-3 was obtained from the Institute for Regenerative Medicine, Kyoto University (Kyoto, Japan). WS imMKCL was provided by the Chiba University Graduate School of Medicine (Innovative Regenerative Medicine, where Hiroyuki Eto, one of the inventors, also holds a position at Kyoto University). The use of all cells was approved by the ethics committees of Kyoto University and Chiba University.

[0187] Cell culture imMKCL (clone 7, clone 7-3, M35-1) were cultured in the same manner as previously reported (non-patent literature 3). Doxycycline was used to regulate the proliferation and differentiation phases.

[0188] Cell proliferation assay Cell proliferation was evaluated using the CCK-8 assay kit according to the manufacturer's instructions. ImMKCL cells cultured for 3 days with the Dox phase were cultured at 5 × 10⁶ cells / day. 3 Cells were seeded at a density of 100 cells / well in 96-well plates. The absorbance at 450 nm was measured using a microplate reader (Envision 2104, PerkinElmer).

[0189] microRNA switch miRNA-responsive mRNAs (miRNA switches) were fabricated using the MegaScript T7 kit (Ambion) according to previously reported methods (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015)). The miRNA switches were encoded on modified mRNAs that responded to the activity of any miRNA (miR-X) expressed within imMKCL to posttranscriptionally regulate TagBFP, a blue fluorescent protein. The mRNA encoding TagBFP contained the target miR-X sequence within its 5' UTR; TagBFP expression was suppressed with increasing miR-X activity. The mRNA encoding Azami Green1 (hmAG1) was used as a transfection control. Figure 1 B).

[0190] Screening based on miRNA switches Screening based on miRNA switches was performed using a self-constructed library (containing a total of 269 miRNA switches). Two different mRNAs encoding TagBFP and AG1 were co-transfected into cells. Transfection of the miRNA switches was performed according to previous reports (Miki, K. et al. Cell Stem Cell 16, 699-711 (2015)). Briefly, during the proliferation phase of imMKCL, 150 ng of mRNA (75 ng each) and StemFect mRNA (Stemgent) were co-transfected into 50 μL of cell suspension (1 × 10⁻⁶ cells / mL). 6 Reverse transfection was performed for 30 minutes at 1 cell / mL, followed by dilution with culture medium to 200 μL in 96-well plates. Flow cytometry was performed 24 hours later using an LSR Tortessa (BD Biosciences, San Jose, CA, USA). Candidate miRNA switches were selected based on the activity response pattern of imMKCL to the target miR-X. Figure 1 The term "activity" in c) defines miRNAs that do not exhibit strong responsive activity within imMKCL as "inactive". Figure 1c). For let-7a-5p and let-7g-5p, the inventors transfected the candidate switches along with the mRNA encoding hmAG1 (as a control) into imMKCL cells. After 24 hours of incubation, cells were sorted using BDFACSAria II for further analysis.

[0191] Cell sorting and flow cytometry Cells were suspended in staining medium and incubated on ice in the dark for 30 minutes with appropriate antibodies before sorting or analysis using BD FACSAria II. Platelet counts were determined according to previously reported methods (Non-Patent Literature 2, 3). The following antibodies were used in flow cytometry: allophycocyanin (APC) conjugated with anti-CD41a (integrin αIIbβ3 complex: HIP8 clone) (Biolegend, San Diego, CA), phycoerythrin (PE) conjugated with anti-CD42b (GPIbα) (eBioscience, San Diego, CA), and PE conjugated with anti-CD41a (HIP8 clone) (Biolegend). Alternatively, imMKCLs were sorted using a FACS S6 device with a 100 μm nozzle, operated using the DIVA software package (version 8.0.2).

[0192] Antibody-based quantitative protein analysis (simplified WES) Cell lysis buffer was prepared using the EpiQuik Total Histone Extraction Kit (Epigentek). Protein concentrations were determined using Pierce assays. TM The BCA protein assay kit (Thermo Fisher Scientific) was used for the assay. The lysis buffer was adjusted to a final concentration of 0.5 or 1 μg / μL, and analysis was performed using the Western blot system (ProteinSimple). The antibodies used were mouse anti-β-actin (1:500, Sigma), rabbit anti-histone H3 (1:50, Cell Signaling Technology), rabbit anti-acetylated histone H3 (Lys14) (D4B9) (1:25, Cell Signaling Technology), and rabbit anti-MYST2 (D4N3F) (1:50, Cell Signaling Technology).

[0193] Reverse transcription and real-time PCR Total RNA was extracted using the microRNeasy Micro Kit or microRNeasy Mini Kit (Qiagen, Hilden, Germany) and SuperScript VILO was used.TM Reverse transcription was performed using Master Mix (Thermo Fisher Scientific) or ReverTraAce (registered trademark) qPCR RT Master Mix with gDNA Remover (Toyobo). qPCR was performed using the StepOnePlus system (Thermo Fisher Scientific) via SYBR™ Green PCR MasterMix (Applied Biosystems, Foster City, CA, USA). Alternatively, qPCR was performed using the QuantStudio3 system (Applied Biosystems) via THUNDERBIRD (registered trademark) Next SYBR™. TM Real-time PCR was performed using qPCR Mix (Toyobo). GAPDH was used as an internal control. The primer sets used are shown in Table 3. The sequences in Table 3 are listed in the sequence listing as SEQ ID NO: 18–39 from top to bottom. Reverse transcription of let-7a-5p and let-7g-5p miRNAs was performed using the TaqMan MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific) and miRNA-specific stem-loop RT primers, according to the manufacturer's instructions. qPCR was performed using the StepOnePlus system via TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). The expression level of let-7 was calculated as a relative value to RNU6B using specific TaqMan probes.

[0194] [Table 3] Analysis of cytokine secretion in imMKCL Following the manufacturer's instructions, cytokine secretion in culture supernatants was measured using the Human Inflammatory Cytokine Flow Cytometry Microsphere Array Kit (BD Biosciences). In short, beads with different fluorescence intensities and coated with capture antibody proteins were mixed with PE-conjugated detection antibodies and recombinant standards or samples, and then incubated to form a sandwich complex. After acquiring sample data by flow cytometry, the FCAP Array was used. TM The software (BD Biosciences) calculates cytokine concentrations.

[0195] Transfection with let-7a-5p inhibitor A specific inhibitor for mirVana let-7a-5p and a negative control were purchased from Thermo Fisher Scientific and used according to the manufacturer's instructions. Transfection was performed using the Stemfect RNA transfection kit (ReproCell, Yokohama, Japan).

[0196] The emergence of lentiviruses The use of viral vectors was approved by the committees of Kyoto University and Chiba University. Full-length sequences encoding human CUX1 and RALB were cloned into lentiviral vectors CS2-Ubic-IG-GFP or CS2-Ubic-IB. The full-length sequence encoding human KAT7 was cloned into the CS2-Ubic-IB lentiviral vector for overexpression experiments. ShRNA oligonucleotides targeting KAT7 or LacZ (control) were inserted into the FG12-HYG lentiviral vector plasmid for knockdown experiments. The Fucci vector was obtained from TAKARA Bio. Lentiviral production using 293T cells was performed as previously reported (Non-Patent Literature 1). The oligonucleotide sequence of shKAT7 is as follows: GCCCTTCCTGTTCTATGTTAT (Sequence No. 40).

[0197] Immunofluorescence confocal microscopy Cells were fixed with 4% paraformaldehyde (Wako) for 10 minutes, followed by permeabilization with 0.1% Triton X-100 (Sigma) for 5 minutes. Samples were blocked with 10% goat serum (Sigma) and incubated with mouse anti-CD41a antibody (eBioscience) for 1 hour. Cells were then treated with Alexa Fluor 647 conjugated with a secondary antibody (ThermoFisher Scientific) for 30 minutes. Nuclear staining was performed using DAPI (Vector). Images were acquired using a Zeiss LSM900 confocal microscope with an oil immersion objective lens of 63× / 1.40.

[0198] Batch RNA sequencing analysis Total RNA was extracted using the microRNeasy Micro Kit. RNA-seq libraries were prepared according to the manufacturer's protocol. In short, approximately 10 ng of total RNA was used in cDNA synthesis using the SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (TakaraBio). The cDNA was fragmented using an S220 focused ultrasound generator (Covaris, Woburn, MA, USA). Then, NEBNext (registered trademark) Ultra...TM cDNA libraries were prepared using the DNA Library Prep Kit for Illumina (New England BioLabs, Beverly, MA, USA). The size of the NEBnext library was evaluated using a bioanalyzer equipped with an Agilent high-sensitivity DNA kit. Sequencing was performed using either the HiSeq 2500 (Illumina) or NextSeq 500 (Illumina) platform with a single-read sequencing length of 60 bp. TopHat (version 2.1.1) was used to align the annotated data from iGenomes (Illumina) to a reference genome (UCSC / hg19). Gene expression levels were quantified using Cuffdiff (Cufflinks version 2.2.1) as FPKM (number of exons per million aligned reads).

[0199] Gene set enrichment analysis (GSEA) GSEA was applied to screen for pathways enriched in (1) low or high let-7 (let-7a-5p and let-7g-5p) imMKCLs (M35-1, clone 7, clone 7-3), (2) let-7 low imMKCLs of clone 7-3 or clone 7, and (3) MOCK or RALB-overexpressing imMKCLs (clone 7) based on bulk RNA-seq datasets. Graphing was performed using the Broad Institute's GSEA software (version 4.2.3). The inventors also reanalyzed bulk RNA-seq datasets from high-quality, medium-quality, and low-quality MKCL clones (Non-Patent Reference 9). Alternatively, the Python GSEApy package with the MsigDB Hallmarks library was used to identify pathways enriched in bulk RNA-seq data from WM3835-treated and DMSO-treated imMKCLs. Normalized gene expression matrices were input into GSEA, and statistical significance was defined as an FDR and a p-value less than 0.05.

[0200] Construction of Chromium 10x single-cell RNA-seq library imMKCL (clone 7) cells with different let-7a-5p activities were sorted and resuspended in PBS containing 0.4% BSA at a concentration of 1000 cells / μL. Figure 5Cells were loaded into the Chromium Next Gel Beads-in-Emulsion (GEMs) Chip G Single Cell Kit (10x Genomics, USA). GEM generation and barcoding, reverse transcription, cDNA generation, and library construction were performed according to the manufacturer's protocol (Chromium NextGEM Single Cell 3' Reagent Kits v3.1 Dual Index, 10x Genomics). The dual-indexed single-cell libraries were merged and sequenced using a NovaSeq6000 (Illumina) via paired-end reads.

[0201] Bioinformatics Analysis Datasets from 10x Genomics were collected, and quality control was implemented to remove low-quality and contaminated cells. Reads were typically preprocessed using Cell Ranger pipeline v.3.0.2 (10x Genomics). Downstream analysis and visualization were performed using Seurat (version 4.0.5) installed on R (version 4.1.1). After studying quality control metrics, cells with mitochondrial content exceeding 15% and cells with fewer than 2500 detected genes were excluded from downstream analysis. Normalized negative binomial regression was used to normalize and scale the unique molecular identifier (UMI) counts. Subsequently, linear dimensionality reduction (principal component analysis) was performed, and unsupervised uniform manifold approximation (UMAP) and clustering were performed using the first 20 principal components, computed at resolutions ranging from 1.2 to 0.05. High and low imMKCL clusters of let-7a-5p were integrated through all subsequent analyses. Cell clusters were identified using Seurat's FindClusters feature. Five clusters were identified in the DOX-containing samples (resolution 0.2). The DEGs between different clusters were identified using Seurat's FindAllMarkers function. Wilcoxon tests were performed on each gene, and p-values ​​and adjusted p-values ​​were calculated. A p-value less than 0.01 was considered statistically significant. g:Profiler was used to identify enriched functional entries from the GOs.

[0202] Statistical analysis Statistical analysis was performed using GraphPad Prism software (GraphPad Software, La Jolla, CA). Data are presented as mean ± standard error (SEM). A p-value less than 0.05 was considered statistically significant. Details of the sample size, statistical methods, and statistical significance are provided in the brief descriptions of each figure. The thresholds for statistical significance were set as follows: *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001.

[0203] CD34 from human ESC source + Cell differentiation Human embryonic stem cell (ESC) line KhES-3 was obtained from the Institute for Regenerative Medicine, Kyoto University (Kyoto, Japan) and maintained in 6-well plates pre-coated with iMatrix-511 silk (Takara Bio, Shiga, Japan) using AK02N medium (Ajinomoto, Tokyo, Japan). CD34 + HPC differentiation was performed using the Sac method previously established by the inventors (Takayama, N. et al. Blood 111, 5298-5306 (2008); Yuzuriha, A. et al. Stem Cell Res 53, 102287 (2021)). In short, equal amounts of cells (1.5–1.6 × 10⁻⁶) were used. 5 Small clusters of cells were transferred to 10 cm culture dishes coated with mitomycin C-treated C3H10T1 / 2 mouse feeder cells (RIKEN Bioresource Center, Ibaraki, Japan). The cells were cultured in IMDM medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with L-glutamine (Thermo Fisher Scientific, Waltham, MA, USA), insulin-transferrin-selenium (Thermo Fisher Scientific), 50 μg / mL ascorbic acid (Sigma-Aldrich), 450 μM α-monothioglycerol (Sigma-Aldrich), and 20 ng / mL recombinant human VEGF (Wako Pure Chemicals, Osaka, Japan). Then, 50 ng / mL basic FGF (Wako) and 10 μM SB431542 (Wako) were added on days 4–7, and 10 U / mL heparin (AY Pharmaceuticals, Tokyo, Japan) was added on days 4–10. The medium was changed on days 4, 7, and 11. Figure 4 a) Cells were recovered using a cell scraper on day 14, filtered through a cell strainer, and then used for further study.

[0204] CD34 derived from human umbilical cord blood + Cell purification Fresh umbilical cord blood (UCB) samples were obtained from healthy donors from the Kanto-Koshinetsu Region Blood Center of the Japanese Red Cross. Monocytes (MNCs) were isolated using density centrifugation on lymphocyte separation medium (Ficoll). The cells were then incubated with immunomagnetic beads (CD34) (Miltenyi Biotech) and selected using a QuadroMACS (registered trademark) separation device according to the manufacturer's instructions. Purification efficiency was confirmed by flow cytometry. The obtained CD34... + The components are divided into small portions and stored in liquid nitrogen before use.

[0205] CD34 derived from umbilical cord blood + Cell differentiation into megakaryocytes CD34 derived from umbilical cord blood + In vitro cell differentiation was performed with slight modifications to previously reported protocols (Kaushansky, K. et al. Proc Natl Acad Sci USA 92, 3234-3238 (1995); Bruno, S. et al. Haematologica 88, 379-387 (2003)). In short, CD34... + Cells were expanded in X-VIVO 10 medium (Lonza) supplemented with 1% bovine serum albumin (BSA, StemCell Technologies), 100 ng / mL human SCF (R&D Systems), 100 ng / mL human Flt-3 ligand (PeproTech EC Ltd.), 50 ng / mL human thrombopoietin (TPO) (R&D Systems), 10 ng / mL human IL-6 (PeproTech EC Ltd.), and 10 ng / mL human IL-3 (PeproTech EC Ltd.). After 9 days of culture, cells were recovered and counted. 4 × 10⁶ cells were then cultured. 5 Cells were seeded in 1 mL of X-VIVO10 medium supplemented with 1% BSA, SCF, TPO, and IL-6, and cultured for 11 days. RNA was isolated on day 16, and flow cytometry analysis was performed on day 20 to evaluate CD41a. + CD42b + Platelet-like granules. The culture medium was changed every 2 days during differentiation. Figure 18 a).

[0206] siRNA-mediated gene knockdown Purchased Dharmacon, a gene engineered for human RALB, from Horizon Discovery Ltd. TM siGENOMEsiRNA SMARTpool (siRALB) contains four siRNAs targeting different sites and a non-target control siRNA (siNT). The gene silencing procedure was performed based on a slightly modified Dharmacon reverse transcription transfection protocol. In short, siRNA was diluted to a final concentration of 10 nM with transfection buffer from the Stemfect RNA Transfection Kit (ReproCELL), and the transfection reagent was diluted with an equal volume of buffer. The diluted siRNA and transfection reagent were mixed and incubated at room temperature for 15 minutes. Then, 12.5 μL / well of the transfection mixture was added to a 96-well plate, followed by 100 μL of 2 × 10⁻⁶ mcg medium in each well. 5 Cells were incubated for 4 hours, washed with PBS, and then placed in proliferation or differentiation culture conditions. To confirm the knockdown efficiency, total RNA was isolated and analyzed 48 hours after transfection.

[0207] Add recombinant human interferon-α2a or IL-8 to imMKCL culture To investigate the potential involvement of interferon or IL-8 in imMKCL proliferation and iPSC-PLT generation, recombinant human interferon-α2a (Miltenyi Biotec) or IL-8 (R&D Systems) was added to cells during proliferation or differentiation culture conditions. Working concentrations were used in the range of 0–100 ng / mL. Proliferation and iPSC-PLT generation capabilities were evaluated accordingly.

[0208] Adding small molecule compounds to imMKCL culture The effects of two small molecule compounds on imMKCL proliferation and iPSC-PLT formation were investigated. (1) Reparibine (Selleckchem): a specific inhibitor commonly used to inhibit the CXCL8 receptor CXCR1 / 2 in the IL-8 signaling pathway; and (2) RBC8 (Selleckchem): a selective inhibitor of GTPases RALA and RALB. ImMKCLs were cultured in the presence or absence of reparibine or RBC8 at working concentrations of 0–10 μM under either proliferation or differentiation culture conditions. Under proliferation culture conditions, imMKCLs were treated with reparibine or RBC8 for 14 days. The culture medium was changed every 3–4 days, and the number of imMKCLs was counted and their growth curves were plotted during the medium change. Under differentiation culture conditions, imMKCLs were treated with reparibine or RBC8 for 6 days, and their iPSC-PLT formation was evaluated. In these studies, dimethyl sulfoxide (DMSO) was added to the control wells. It is worth noting that if a high concentration (10 μM) of any molecule is applied, proliferation stops.

[0209] Intracellular flow cytometry Cells were fixed with 4% PFA for 15 minutes and permeabilized with methanol (on ice for 15 minutes). After washing with PBS, cells were stained with anti-RalB antibody (Merck Millipore, 1:3000) on ice for 1 hour. Next, cells were stained with a secondary antibody, Alexa Fluor. TM Cells were stained with 647 (Invitrogen, 1:1000) and analyzed by flow cytometry. Intracellular flow cytometry assays were optimized for imMKCL as follows: Cells were fixed with 4% paraformaldehyde (PFA) for 15 min at room temperature, followed by methanol permeabilization (on ice for 15 min). After washing twice with PBS, cells were incubated on ice for 1 h with anti-RalB antibody (Merck Millipore, 1:3000). Cells were then washed and incubated with goat anti-mouse secondary antibody Alexa Fluor. TM 647 (Invitrogen, 1:1000) were incubated together on ice. The stained cells and the unstained control were then analyzed by flow cytometry.

[0210] Following the manufacturer's instructions, imMKCL cells were fixed and stained using the PerFix-nc kit (Beckman Coulter). A rabbit antibody against acetylated histone H3 (Lys14) (D4B9) (Cell Signaling Technology) was used as the primary antibody, followed by a secondary antibody conjugated with Alexa Fluor 647 (Thermo Fisher Scientific). Samples were analyzed using a FACSLyric device (BD Biosciences).

[0211] PAC-1 binding and P-selectin expression of iPSC-PLT The determination of PAC-1 binding and P-selectin expression levels was based on the protocol outlined in the inventors' previous research (Sugimoto, N. et al. Blood Adv 6, 6056-6069 (2022)). Briefly, the culture suspension (iPSC-PLT) was stimulated with or without phorbol-12-myristate-13-acetate (PMA, 0.2 μM) or adenosine triphosphate plus thrombin receptor activator peptide 6 (ADP / TRAP6, 100 μM and 40 μM, respectively). The mixture was then incubated with BV421 mouse anti-human CD62P (BD Biosciences), APC-anti-human CD41a (Bio Legend), and FITC-PAC-1 (BD Biosciences) antibodies. After incubation at room temperature for 30 minutes, the samples were diluted with Hepes-Tyrode buffer and analyzed by flow cytometry.

[0212] This application is based on U.S. Provisional Patent Application No. 63 / 558,394 (filed on February 27, 2024), the entire contents of which are contained in this specification.

Claims

1. A quality control marker for megakaryocytes, consisting of the transcript or protein of the Ral (RAS-like proto-oncogene) gene.

2. The marker according to claim 1, wherein, The Ral gene is the RalB (RAS-like proto-oncogene B) gene.

3. A quality control marker for megakaryocytes, comprising the transcript or protein of the Kat7 (lysine acetyltransferase 7) gene, or a target acetylated histone of the Kat7 protein.

4. A method for quality assessment of megakaryocytes, comprising: The step of detecting one or more biomarkers according to any one of claims 1 to 3 in megakaryocytes.

5. The method according to claim 4, comprising: The procedure for detecting the transcripts or proteins of the RalB gene and the Kat7 gene in megakaryocytes.

6. The method according to claim 4 or 5, comprising the following steps: Step (1): Determine the presence or activity level of one or more biomarkers according to any one of claims 1 to 3 in the target megakaryocytes; as well as Step (2): Evaluate the quality of megakaryocytes based on the values ​​measured in step (1).

7. The method according to claim 4 or 5, characterized in that: The biomarker is detected using nucleic acid probes and / or nucleic acid primers that specifically recognize the transcript of the Ral gene or antibodies that specifically recognize the Ral protein.

8. The method according to claim 4 or 5, characterized in that: The biomarker was detected using a nucleic acid probe and / or primer that specifically recognizes the transcript of the Kat7 gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes the target acetylated histone of the Kat7 protein.

9. The method according to any one of claims 4 to 7, wherein, Megakaryocytes are a source of pluripotent stem cells.

10. A quality control kit for megakaryocytes, comprising: nucleic acid probes and / or nucleic acid primers that specifically recognize the transcript of the Ral (RAS-like proto-oncogene) gene, or antibodies that specifically recognize the Ral protein.

11. A quality control kit for megakaryocytes, comprising: a nucleic acid probe and / or nucleic acid primer that specifically recognizes the transcript of the Kat7 (lysine acetyltransferase 7) gene, or an antibody that specifically recognizes the Kat7 protein, or an antibody that specifically recognizes the target acetylated histone of the Kat7 protein.

12. A method for preparing megakaryocytes with improved quality, comprising: The steps for culturing megakaryocytes in a medium containing an inhibitor of Ral (RAS-like proto-oncogene).

13. The method according to claim 12, wherein, At least one Ral inhibitor is an inhibitor of RBC8 or Ral expression.

14. A method for preparing megakaryocytes with improved quality, comprising: Steps to increase the presence of Kat7 protein in megakaryocytes.

15. The method according to any one of claims 12 to 14, wherein, Megakaryocytes are a source of pluripotent stem cells.

16. A megakaryocyte, evaluated by any one of claims 4 to 9, or obtained by any one of claims 12 to 15.

17. A method for preparing platelets, comprising: The steps for maturing the megakaryocytes as described in claim 16.

18. A platelet obtained by the method of claim 17.

19. A blood preparation comprising the cells of claim 16 or 18.

Images