Process for producing deoxyribonucleotide triphosphates or ribonucleotide triphosphates

CN122826331APending Publication Date: 2026-09-25YAMAGUCHI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202580017485.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-02-29
Filing Date
2025-02-28
Publication Date
2026-09-25

AI Technical Summary

Technical Problem

然而,由于向dATP或ATP的合成因平衡的影响而不充分,需要长时间无氧条件下的反应,在从反应开始起120小时后需要加入已固定于聚丙烯酰胺凝胶的乙酸激酶等,在实用化中存在改善的余地

Benefits of technology

通过本发明的从脱氧核糖核苷合成脱氧核糖核苷三磷酸(dNTP)或从核糖核苷合成核糖核苷三磷酸(NTP)的方法,能够廉价且在短时间内制造脱氧核糖核苷三磷酸或核糖核苷三磷酸。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application provides a novel method for synthesizing deoxyribonucleotide triphosphates or ribonucleotide triphosphates. The method is characterized by adding (i) to (iii) below to a reaction vessel to prepare a reaction solution, and performing a one-pot reaction: (i) deoxyribonucleoside or ribonucleoside as a starting material; (ii) a kinase capable of generating deoxyribonucleoside monophosphate from the aforementioned deoxyribonucleoside or ribonucleoside monophosphate from the aforementioned ribonucleoside, a kinase capable of generating deoxyribonucleoside diphosphate from the aforementioned deoxyribonucleoside monophosphate or ribonucleoside diphosphate from the aforementioned ribonucleoside monophosphate, and pyruvate kinase as an enzyme; and (iii) phosphoenolpyruvate (PEP) and nucleotide triphosphates or deoxyribonucleotide triphosphates as a phosphate donor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for manufacturing deoxyribonucleoside triphosphate or ribonucleoside triphosphate. Background Technology

[0002] In recent years, the development of nucleic acid drugs and vaccines has been ongoing. The manufacture of DNA and RNA used in these nucleic acid drugs requires deoxyribonucleoside triphosphates (dNTPs), represented by deoxyadenosine triphosphate (dATP), and ribonucleoside triphosphates (NTPs). For example, for dATP, methods for chemical synthesis and methods for synthesis from deoxyadenosine monophosphate (dAMP) using microorganisms or yeast are known (see Patent Document 1). However, in all these methods, the current situation is that commercially available nucleotides are expensive due to the high cost of the substrates and enzymes used in the reactions and the complexity of the reactions. Especially when synthesizing DNA and RNA in large quantities via PCR, a large amount of dATP is required; therefore, there is a need for a method to synthesize dATP at the lowest possible cost.

[0003] Methods for synthesizing dATP or adenosine triphosphate (hereinafter referred to as "ATP") from relatively inexpensive deoxyadenosine (hereinafter also referred to as "dAd") or adenosine (hereinafter also referred to as "Ad") have also been studied (see Non-Patent Literature 1, 2). However, since the synthesis of dATP or ATP is insufficient due to the influence of equilibrium, the reaction requires a long period of anaerobic conditions, and the addition of acetate kinase, which has been immobilized in a polyacrylamide gel, is required 120 hours after the start of the reaction. There is room for improvement in practical application.

[0004] Furthermore, the enzymes used to synthesize dATP or ATP are expensive due to the previous processes of producing each enzyme using bacteria or yeast and then purifying them. These factors are also a major reason for the high production cost of dATP or ATP.

[0005] In addition, when DNA is synthesized in large quantities through PCR, dATP, dGTP, dTTP, and dCTP are required. When RNA is synthesized in large quantities through PCR, ATP, GTP, UTP, and CTP are required. They are also expensive for the same reasons as dATP.

[0006] Existing technical documents Patent documents Patent Document 1: International Publication No. 1998 / 048031 Non-patent literature Non-patent literature 1: Maryke Fehlau et al., Frontiers in Bioengineering and Biotechnology, August 2020, Volume 8, Article 854 Non-patent literature 2: Richard L. Baughn, et al., J. Am. Chem. Soc. 1978, 100, 1, 304-306 Summary of the Invention

[0007] The problem that the invention aims to solve The subject of this invention is to provide a novel method for synthesizing deoxyribonucleoside triphosphate or ribonucleoside triphosphate.

[0008] Methods for solving problems In order to solve the above-mentioned problems, the inventors of this application conducted in-depth research and first explored the reaction from Ad to adenosine monophosphate (hereinafter also referred to as "AMP"), and confirmed that ScADO1, an adenosine kinase derived from yeast, could be used. Furthermore, the reaction from AMP to adenosine diphosphate (hereinafter also referred to as "ADP") used ECadk enzyme, a phosphorylase (adenosine monophosphate kinase / adenosine kinase) derived from Escherichia coli. For the reaction from ADP to ATP, phosphoenolpyruvate (hereinafter also referred to as "PEP") was used as a substrate, and ECpykF enzyme, a phosphorylase (pyruvate kinase) derived from Escherichia coli, was used for preparation. Moreover, a method was discovered in which a reaction solution consisting of three enzymes, ScADO1, ECadk, and ECpykF, was mixed and reacted in the same reaction vessel, thereby enzymatically synthesizing dATP or ATP from inexpensive deoxyadenosine or adenosine. Furthermore, it was discovered that enzymes derived from Escherichia coli or yeast can be extracted from Escherichia coli or yeast using a prescribed method, and the extract can be used directly as an enzyme solution, thus completing this invention. Furthermore, the following method was discovered: using deoxyguanosine, deoxycytidine, and deoxythymidine instead of deoxyadenosine, using nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase as enzymes, and using phosphoenolpyruvate as the substrate for the reaction from dNDP to dNTP, and carrying out the reaction in the same reaction vessel, thereby enzymatically synthesizing dATP or ATP from inexpensive deoxyadenosine or adenosine.

[0009] That is, the present invention is as follows.

[0010] [1] A method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleosides or ribonucleosides from ribonucleosides, characterized in that a reaction solution is prepared by adding the following (i) to (iii) into a reaction vessel, and the reaction is carried out in a one-pot manner: (i) Deoxyribonucleoside or ribonucleoside as starting material; (ii) as an enzyme Nucleoside kinases capable of generating deoxyribonucleoside monophosphate from the aforementioned deoxyribonucleosides or ribonucleoside monophosphate from the aforementioned ribonucleosides. Nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate from the aforementioned deoxyribonucleoside monophosphate or ribonucleoside diphosphate, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

[0011] [2] The method described in [1] above is characterized in that, in the reaction solution at the beginning of the reaction, the concentration ratio of the aforementioned phosphoenolpyruvate (PEP) to the aforementioned deoxyribonucleoside or the aforementioned ribonucleoside (PEP / deoxyribonucleoside or ribonucleoside) is 3.0 or more.

[0012] [3] The method as described in [1] or [2] above is characterized in that, in the reaction solution at the beginning of the reaction, the concentration ratio (dNTP or NTP / deoxyribonucleoside or ribonucleoside) of the aforementioned deoxyribonucleoside or ribonucleoside is 0.5 or less.

[0013] [4] The method as described in any one of [1] to [3] above, characterized in that the aforementioned nucleoside kinase, the aforementioned nucleoside monophosphate kinase and the aforementioned pyruvate kinase are derived from yeast or bacteria.

[0014] [5] The method as described in any one of [1] to [4] above is characterized in that the reaction time is 0.1 to 24 hours.

[0015] [6] The method as described in any one of [1] to [5] above, characterized in that the enzyme reaction solution obtained by the following method is used directly as the enzyme, wherein the enzyme reaction solution is prepared by extracting the aforementioned enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase and pyruvate kinase while maintaining enzyme activity. The method includes a step of treating the aforementioned bacteria or yeast at 4-95°C with the following enzyme extract solution for 0.1 hours to 4 days, wherein the enzyme extract solution is a 0.01-1.0M buffer solution containing 0-3% nonionic surfactant or amphoteric surfactant, and the pH is adjusted to 6-11. The method does not include a step of lysing or breaking down the bacteria or yeast.

[0016] [7] The method as described in any one of [1] to [6] above, characterized in that deoxyadenosine or adenosine is used as the starting material. Adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase were used as enzymes. The aforementioned adenosine kinase is a yeast-derived adenosine kinase, while the aforementioned adenosine monophosphate kinase is a yeast- or bacterial-derived adenosine kinase.

[0017] [8] A method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleoside monophosphate or ribonucleoside triphosphate (NTP), characterized in that a reaction solution is prepared by adding the following (i) to (iii) into a reaction vessel, and the reaction is carried out in a one-pot manner: (i) Deoxyribonucleoside monophosphate or ribonucleoside monophosphate as starting material; (ii) as an enzyme Nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate from the aforementioned deoxyribonucleoside monophosphate or ribonucleoside diphosphate, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

[0018] [9] The method as described in [8] above, characterized in that the enzyme reaction solution obtained by the following method is used directly as the enzyme, said method being a method of preparing the enzyme reaction solution by extracting the aforementioned enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside monophosphate kinase and pyruvate kinase while maintaining enzyme activity. The method includes a step of treating the aforementioned bacteria or yeast at 4-95°C with the following enzyme extract solution for 0.1 hours to 4 days, wherein the enzyme extract solution is a 0.01-1.0M buffer solution containing 0-3% nonionic surfactant or amphoteric surfactant, and the pH is adjusted to 6-11. The method does not include a step of lysing or breaking down the bacteria or yeast.

[0019] In addition, other methods of this disclosure are described below.

[0020] [1] A method for synthesizing deoxyadenosine triphosphate (dATP) from deoxyadenosine (dAd) or adenosine triphosphate (ATP) from adenosine (Ad), the method being characterized in that, A reaction solution is prepared by adding deoxyadenosine (dAd) or adenosine (Ad) as the starting material, adenosine kinase, adenosine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as the phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to the reaction vessel, and the reaction is carried out in a one-pot process.

[0021] [2] The method described in [1] above is characterized in that, at the beginning of the reaction, the concentration ratio (PEP / dAd or Ad) of phosphoenolpyruvate (PEP) relative to deoxyadenosine (dAd) or adenosine (Ad) in the reaction solution is 3.0 or more.

[0022] [3] The method as described in [1] or [2] above is characterized in that, at the start of the reaction, the concentration ratio (dNTP or NTP / dAd or Ad) of nucleoside triphosphate (NTP) or deoxynucleoside triphosphate (dNTP) relative to deoxyadenosine (dAd) or adenosine (Ad) in the reaction solution is 0.5 or less.

[0023] [4] The method as described in [1] or [2] above, characterized in that the adenosine kinase, adenosine monophosphate kinase and pyruvate kinase are derived from yeast or bacteria.

[0024] [5] The method as described in [1] or [2] above, wherein the adenosine kinase is an adenosine kinase derived from yeast.

[0025] [6] The method described in [1] or [2] above is characterized in that the reaction time is 0.1 to 24 hours.

[0026] [7] The method as described in [1] or [2] above, characterized in that the enzyme reaction solution obtained by the following method is used directly as the enzyme, said method being a method of preparing the enzyme reaction solution by extracting the aforementioned enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase and pyruvate kinase while maintaining enzyme activity. The method includes a step of treating the aforementioned bacteria or yeast at 4-95°C with the following enzyme extract solution for 0.1 hours to 4 days, wherein the enzyme extract solution is a 0.01-1.0M buffer solution containing 0-3% nonionic surfactant or amphoteric surfactant, and the pH is adjusted to 6-11. The method does not include a step of lysing or breaking down the bacteria or yeast.

[0027] Invention Effects The method of synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleoside or ribonucleoside triphosphate (NTP) from ribonucleoside according to the present invention enables the production of deoxyribonucleoside triphosphate or ribonucleoside triphosphate inexpensively and in a short time. Attached Figure Description

[0028] [ Figure 1 ] Figure 1 The results of enzyme extraction confirmed by SDS-PAGE in Example 1 are shown.

[0029] [ Figure 2 ] Figure 2 This is the result of confirming the PCR amplification product by agarose gel electrophoresis in Example 1.

[0030] [ Figure 3 ] Figure 3 The results of SDS-PAGE of the enzyme reaction solution obtained in Example 2 are shown.

[0031] [ Figure 4 ] Figure 4 The results of SDS-PAGE of the enzyme reaction solution obtained in Example 3 are shown.

[0032] [ Figure 5 ] Figure 5 This illustrates a schematic of the reaction from deoxyadenosine (dAd) to deoxyadenosine triphosphate (dATP) in Example 4.

[0033] [ Figure 6 ] Figure 6 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 4 are shown.

[0034] [ Figure 7 ] Figure 7 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 5 are shown.

[0035] [ Figure 8 ] Figure 8 The results of the investigation of the concentration of dATP in the dATP solution obtained by setting PEP to 60 mM and reacting for 1 hour or 24 hours are shown in Example 5.

[0036] [ Figure 9 ] Figure 9 The results of the investigation of the concentration of dATP in the dATP solution obtained by setting PEP to 90 mM and reacting for 1 hour or 24 hours are shown in Example 5.

[0037] [ Figure 10 ] Figure 10 The results of enzyme extraction confirmed by SDS-PAGE in Example 6 are shown.

[0038] [ Figure 11 ] Figure 11 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 7 are shown.

[0039] [ Figure 12 ] Figure 12 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 7 are shown.

[0040] [ Figure 13 ] Figure 13 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 7 are shown.

[0041] [ Figure 14 ] Figure 14 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 7 are shown.

[0042] [ Figure 15 ] Figure 15 The results of enzyme extraction confirmed by SDS-PAGE in Example 8 are shown.

[0043] [ Figure 16 ] Figure 16 The results of confirming the PCR amplification products by agarose electrophoresis in Example 8 are shown.

[0044] [ Figure 17 ] Figure 17 The results of enzyme extraction confirmed by SDS-PAGE in Example 9 are shown.

[0045] [ Figure 18 ] Figure 18 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 10 are shown.

[0046] [ Figure 19 ] Figure 19 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 10 are shown.

[0047] [ Figure 20 ] Figure 20 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 10 are shown.

[0048] [ Figure 21 ] Figure 21 The results of confirming the PCR amplification products by agarose gel electrophoresis in Example 10 are shown. Detailed Implementation

[0049] The methods for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleosides or ribonucleosides from ribonucleosides in this specification are not particularly limited as long as they are the methods described below, and are hereinafter also referred to as "Method 1 for Synthesizing dNTP or NTP of this Application". The method is characterized in that... The following (i) to (iii) are added to the reaction vessel to prepare a reaction solution, and the reaction is carried out using a one-pot method: (i) Deoxyribonucleoside or ribonucleoside as starting material; (ii) as an enzyme Nucleoside kinases capable of generating deoxyribonucleoside monophosphate from the aforementioned deoxyribonucleosides or ribonucleoside monophosphate from the aforementioned ribonucleosides. Nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate from the aforementioned deoxyribonucleoside monophosphate or ribonucleoside diphosphate, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

[0050] Furthermore, the methods for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleoside monophosphate or ribonucleoside triphosphate (NTP) in this specification are not particularly limited as long as they are the methods described below, hereinafter also referred to as "Method 2 for Synthesizing dNTP or NTP of this Application," characterized in that... The following (i) to (iii) are added to the reaction vessel to prepare a reaction solution, and the reaction is carried out using a one-pot method: (i) Deoxyribonucleoside monophosphate or ribonucleoside monophosphate as starting material; (ii) as an enzyme Nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate from the aforementioned deoxyribonucleoside monophosphate or ribonucleoside diphosphate, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

[0051] It should be noted that, in the following, "the method for synthesizing dNTP or NTP in this application 1" and "the method for synthesizing dNTP or NTP in this application 2" will be referred to together as "the method for synthesizing dNTP or NTP in this application".

[0052] Examples of deoxyribonucleosides used in this specification include deoxyadenosine (dAd), deoxyguanosine (dGua), deoxythymidine (dThy), or deoxycytidine (dCyt). Examples of deoxyribonucleoside monophosphates used in this specification include deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dGMP), deoxythymidine monophosphate (dTMP), or deoxycytidine monophosphate (dCMP). Examples of deoxyribonucleoside diphosphates used in this specification include deoxyadenosine diphosphate (dADP), deoxyguanosine diphosphate (dGDP), deoxythymidine diphosphate (dTDP), or deoxycytidine diphosphate (dCDP). Examples of deoxyribonucleoside triphosphates (dNTPs) used in this specification include deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), or deoxycytidine triphosphate (dCTP).

[0053] Examples of ribonucleosides used in this specification include adenosine (Ad), guanosine (Gua), 5'-methyluridine (m5Uri), uridine (Uri), or cytine (Cyt). Examples of ribonucleosides monophosphates used in this specification include adenosine monophosphate (AMP), guanosine monophosphate (GMP), 5'-methyluridine monophosphate (m5UMP), uridine monophosphate (UMP), or cytine monophosphate (CMP). Examples of ribonucleosides diphosphates used in this specification include adenosine diphosphate (ADP), guanosine diphosphate (GDP), 5'-methyluridine diphosphate (m5UDP), uridine diphosphate (UDP), or cytine diphosphate (CDP). Examples of ribonucleosides triphosphates (NTPs) used in this specification include adenosine triphosphate (ATP), guanosine triphosphate (GTP), 5'-methyluridine triphosphate (m5UTP), uridine triphosphate (UTP), or cytine monophosphate (CTP).

[0054] The method for synthesizing deoxyadenosine triphosphate (dATP) from deoxyadenosine (dAd) or adenosine triphosphate (ATP) from adenosine (Ad) in this specification involves adding deoxyadenosine (dAd) or adenosine (Ad) as starting materials, adenosine kinase, adenosine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dATP or ATP, hereinafter also referred to as "Method 1 for Synthesizing dATP or ATP of this Application".

[0055] The method for synthesizing deoxyadenosine triphosphate (dATP) from deoxyadenosine monophosphate (dAMP) or adenosine triphosphate (ATP) from adenosine (AMP) in this specification involves adding deoxyadenosine monophosphate (dAMP) or adenosine monophosphate (AMP) as starting materials, adenosine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dATP or ATP. This method is hereinafter also referred to as "Method 2 for Synthesizing dATP or ATP of this application". It should be noted that, hereinafter, "Method 1 for Synthesizing dATP or ATP of this application" and "Method 2 for Synthesizing dATP or ATP of this application" will also be collectively referred to as "Method 1 for Synthesizing dATP or ATP of this application".

[0056] The method for synthesizing deoxyguanosine triphosphate (dGTP) from deoxyguanosine (dGua) or guanosine triphosphate (GTP) from guanosine (Gua) in this specification involves adding deoxyguanosine (dGua) or guanosine (Gua) as starting materials, guanosine kinase, guanosine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dGTP or GTP, hereinafter also referred to as "Method 1 for Synthesizing dGTP or GTP of this Application".

[0057] The method for synthesizing deoxyguanosine triphosphate (dGTP) from deoxyguanosine monophosphate (dGMP) or guanosine triphosphate (GTP) from guanosine monophosphate (GMP) in this specification involves adding deoxyguanosine monophosphate (dGMP) or guanosine monophosphate (GMP) as starting materials, guanosine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dGTP or GTP, hereinafter also referred to as "Method 2 for Synthesizing dGTP or GTP of this Application". It should be noted that, hereinafter, "Method 1 for Synthesizing dGTP or GTP of this Application" and "Method 2 for Synthesizing dGTP or GTP of this Application" will also be collectively referred to as "Method 1 for Synthesizing dGTP or GTP of this Application".

[0058] The method for synthesizing deoxythymidine triphosphate (dTTP) from deoxythymidine (dThy) in this specification involves adding deoxythymidine (dThy) as a starting material, deoxythymidine kinase, deoxythymidine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dTTP. This method is also referred to below as "Method 1 for Synthesizing dTTP of this Application".

[0059] The method for synthesizing deoxythymidine triphosphate (dTTP) from deoxythymidine monophosphate (dTMP) in this specification involves adding deoxythymidine monophosphate (dTMP) as a starting material, deoxythymidine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dTTP. This method is hereinafter also referred to as "Method 2 for Synthesizing dTTP of this Application". It should be noted that, hereinafter, "Method 1 for Synthesizing dTTP of this Application" and "Method 2 for Synthesizing dTTP of this Application" will also be collectively referred to as "Method for Synthesizing dTTP of this Application".

[0060] The method for synthesizing 5-methyluridine triphosphate (m5UTP) from 5-methyluridine (m5Uri) or uridine triphosphate (UTP) from uridine (Uri) in this specification involves adding 5-methyluridine (m5Uri) or uridine (Uri) as starting materials, uridine kinase, uridine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing m5UTP or UTP, hereinafter also referred to as "Method 1 for Synthesizing m5UTP or UTP of this Application".

[0061] The method for synthesizing 5-methyluridine monophosphate (m5UTP) or uridine triphosphate (UTP) from 5-methyluridine monophosphate (m5UMP) described in this specification involves adding 5-methyluridine monophosphate (m5UMP) or uridine monophosphate (UMP) as starting materials, uridine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing m5UTP or UTP, hereinafter also referred to as "Method 2 for Synthesizing m5UTP or UTP of this Application". It should be noted that, hereinafter, "Method 1 for Synthesizing m5UTP or UTP of this Application" and "Method 2 for Synthesizing m5UTP or UTP of this Application" will also be collectively referred to as "Method 1 for Synthesizing m5UTP or UTP of this Application".

[0062] The method for synthesizing deoxycytidine triphosphate (dCTP) from deoxycytidine (dCyt) or cytidine triphosphate (CTP) from cytidine (Cyt) in this specification involves adding deoxycytidine (dCyt) or cytidine (Cyt) as a starting material, cytidine kinase, cytidine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dCTP or CTP, hereinafter also referred to as "Method 1 for Synthesizing dCTP or CTP of this Application".

[0063] The method for synthesizing deoxycytidine triphosphate (dCTP) from deoxycytidine monophosphate (dCMP) or cytidine triphosphate (CTP) from cytidine monophosphate (CMP) in this specification involves adding deoxycytidine monophosphate (dCMP) or cytidine monophosphate (CMP) as starting materials, cytidine monophosphate kinase and pyruvate kinase as enzymes, phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate to a reaction vessel to prepare a reaction solution. The reaction is then carried out using a one-pot method, thereby synthesizing dCTP or CTP. This method is hereinafter also referred to as "Method 2 for Synthesizing dCTP or CTP of this Application". It should be noted that, hereinafter, "Method 1 for Synthesizing dCTP or CTP of this Application" and "Method 2 for Synthesizing dCTP or CTP of this Application" will also be collectively referred to as "Method 1 for Synthesizing dCTP or CTP of this Application".

[0064] The term "method of synthesizing dNTP or NTP" in this application is a term used to describe the method of synthesizing dATP or ATP, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP in this application.

[0065] (enzyme) In this specification, examples of nucleoside kinases capable of generating deoxyribonucleoside monophosphate or ribonucleoside monophosphate from deoxyribonucleosides include deoxyadenosine kinase, deoxyguanosine kinase, deoxythymidine kinase, deoxycytidine kinase, and other deoxynucleoside kinases, as well as nucleoside kinases such as adenosine kinase, guanosine kinase, uridine kinase, and cytidine kinase. Additionally, examples of nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate or ribonucleoside monophosphate from deoxyribonucleoside monophosphate include deoxyadenosine monophosphate kinase, deoxyguanosine monophosphate kinase, deoxythymidine monophosphate kinase, deoxycytidine monophosphate kinase, and other deoxynucleoside monophosphate kinases, as well as nucleoside monophosphate kinases such as adenosine monophosphate kinase, guanosine monophosphate kinase, uridine monophosphate kinase, and cytidine monophosphate kinase.

[0066] In method 1 for the synthesis of dATP or ATP in this application, deoxyadenosine kinase or adenosine kinase is used as an enzyme in the reaction from dAd to dAMP or from Ad to AMP. In this specification, deoxyadenosine kinase or adenosine kinase refers to an enzyme (e.g., EC 2.7.1.20, EC 2.7.1.76, EC 2.7.1.145) that uses dATP or ATP as a phosphate source to catalyze the phosphorylation of deoxyadenosine to dAMP or adenosine to AMP. There are no particular limitations on the type of deoxyadenosine kinase or adenosine kinase used; commercially available enzymes may be used in addition to known enzymes derived from yeast, bacteria, or mammals. However, deoxyadenosine kinase or adenosine kinase derived from yeast or bacteria is preferred, and more preferably, it is derived from yeast. Examples of yeast-derived deoxyadenosine kinases or adenosine kinases include: polypeptides consisting of the amino acid sequence shown in Serial No. 1; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 1, and possessing the aforementioned deoxyadenosine kinase or adenosine kinase activities; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 1, and possessing deoxyadenosine kinase or adenosine kinase activities. It should be noted that yeast-derived deoxyadenosine kinases or adenosine kinases consisting of the amino acid sequence shown in Serial No. 1 are known as ADO1 (Patricia Barrado et al., Yeast 2003; 20: 1145-1150). Furthermore, any reaction from dAd to dAMP that can proceed can be performed, and either deoxyadenosine kinase or adenosine kinase can be used in this reaction. Similarly, as long as the reaction from Ad to AMP can proceed, either deoxyadenosine kinase or adenosine kinase can be used in this reaction.

[0067] In method 1 for synthesizing dGTP or GTP of this application, deoxyguanosine kinase or guanosine kinase is used as an enzyme in the reaction from dGua to dGMP or from Gua to GMP. In this specification, deoxyguanosine kinase or guanosine kinase refers to an enzyme (e.g., EC 2.7.1.73, EC 2.7.1.113) that uses dGTP or GTP, ATP, etc., as a phosphate source to catalyze the phosphorylation of deoxyguanosine to dGMP or guanosine to GMP. There are no particular limitations on the type of deoxyguanosine kinase or guanosine kinase used; commercially available enzymes may be used in addition to known enzymes derived from yeast, bacteria, or mammals. However, deoxyguanosine kinase or guanosine kinase derived from yeast or bacteria is preferred, and deoxyguanosine kinase or guanosine kinase derived from bacteria is more preferred. Examples of bacterial deoxyguanosine kinases or guanosine kinases include: polypeptides consisting of the amino acid sequence shown in Serial No. 17; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 17, and possessing the aforementioned deoxyguanosine kinase or guanosine kinase activity; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 17, and possessing deoxyguanosine kinase or guanosine kinase activity. It should be noted that bacterial deoxyguanosine kinases or guanosine kinases consisting of the amino acid sequence shown in Serial No. 17 are known as GSK. Furthermore, any reaction from dGua to dGMP can proceed, in which either deoxyguanosine kinase or guanosine kinase can be used. Similarly, any reaction from Gua to GMP can proceed, in which either deoxyguanosine kinase or guanosine kinase can be used.

[0068] In method 1 for the synthesis of dTTP in this application, deoxythymidine kinase is used as the enzyme in the reaction from dThy to dTMP. In this specification, deoxythymidine kinase is defined as an enzyme (e.g., EC 2.7.1.21) that uses dTTP, ATP, or the like as a phosphate source to catalyze the phosphorylation of deoxythymidine to dTMP. There are no particular limitations on the type of deoxythymidine kinase used; commercially available enzymes may be used in addition to known enzymes derived from yeast, bacteria, or mammals. However, deoxythymidine kinases derived from yeast or bacteria are preferred, and deoxythymidine kinases derived from bacteria are more preferred. Examples of bacterial deoxythymidine kinases include: polypeptides consisting of the amino acid sequence shown in Serial No. 18; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 18, and possessing the aforementioned deoxythymidine kinase activity; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 18, and possessing deoxythymidine kinase activity. It should be noted that, as bacterial deoxythymidine kinases, polypeptides consisting of the amino acid sequence shown in Serial No. 18 are known as tdk.

[0069] In method 1 for synthesizing m5UTP or UTP of this application, uridine kinase or cytidine kinase is used as an enzyme in the reaction from 5'-methyluridine (m5Uri) to m5UMP or from uridine (Uri) to UMP. In this specification, uridine kinase is an enzyme (e.g., EC 2.7.1.48) that catalyzes the phosphorylation of 5'-methyluridine (m5Uri) or uridine (Uri) to m5UMP or UMP using UTP, ATP, or the like as a phosphate source. There are no particular limitations on the uridine kinase or cytidine kinase used; commercially available enzymes may be used in addition to known enzymes derived from yeast, bacteria, or mammals. However, uridine kinase or cytidine kinase derived from yeast or bacteria is preferred, and uridine kinase or cytidine kinase derived from bacteria is more preferred. Examples of bacterial uridine kinases or cytidine kinases include: polypeptides consisting of the amino acid sequence shown in Serial No. 19; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 19, and possessing the aforementioned uridine kinase or cytidine kinase activity; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 19, and possessing uridine kinase or cytidine kinase activity. It should be noted that, as bacterial uridine kinases or cytidine kinases, polypeptides consisting of the amino acid sequence shown in Serial No. 19 are known as udk.

[0070] In method 1 for synthesizing dCTP or CTP of this application, deoxycytidine kinase or cytidine kinase is used as an enzyme in the reaction from dCyt to dCMP or from Cyt to CMP. In this specification, deoxycytidine kinase or cytidine kinase refers to an enzyme (e.g., EC 2.7.1.48, EC 2.7.1.74, or EC 2.7.1.213) that uses dCTP or CTP, ATP, etc., as a phosphate source to catalyze the phosphorylation of deoxycytidine to dCMP or cytidine to CMP. There are no particular limitations on the type of deoxycytidine kinase or cytidine kinase used; commercially available enzymes may be used in addition to known enzymes derived from yeast, bacteria, or mammals. However, deoxycytidine kinase or cytidine kinase derived from yeast or bacteria is preferred, and more preferably deoxycytidine kinase or cytidine kinase derived from bacteria. Examples of bacterial deoxycytidine kinases or cytidine kinases include: polypeptides consisting of the amino acid sequence shown in Serial No. 19; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 19, and possessing the aforementioned deoxycytidine kinase or cytidine kinase activity; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 19, and possessing deoxycytidine kinase or cytidine kinase activity. It should be noted that bacterial deoxycytidine kinases or cytidine kinases consisting of the amino acid sequence shown in Serial No. 19 are known as udk. Furthermore, any reaction from dCyt to dCMP can proceed, in which either deoxycytidine kinase or cytidine kinase can be used. Similarly, any reaction from Cyt to CMP can proceed, in which either deoxycytidine kinase or cytidine kinase can be used.

[0071] The aforementioned "amino acid sequence obtained by deleting, substituting or adding one or more amino acids" refers to an amino acid sequence obtained by deleting, substituting or adding any number of amino acids, such as 1 to 20, preferably 1 to 10, more preferably 1 to 3, further preferably 1 to 2, and most preferably 1.

[0072] In the method for synthesizing dATP or ATP in this application, deoxyadenosine monophosphate kinase (DEAP) or adenosine monophosphate kinase (ADK) is used as an enzyme in the reaction from dAMP to dADP or from AMP to ADP. DEAP is an enzyme that catalyzes the phosphorylation of dAMP to dADP or AMP to ADP using dATP or ATP as a phosphate source (e.g., EC 2.7.4.3, EC 2.7.4.11), also known as adenylate kinase (ADK). There are no particular limitations on the source of this DEAP, and commercially available enzymes can be used in addition to known enzymes derived from yeast, bacteria, or mammals. However, DEAP from yeast or bacteria is preferred, specifically those derived from bacteria, preferably from Gram-negative bacteria, and more preferably from *Escherichia coli*. Examples of deoxyadenosine monophosphate kinases (dAPKs) or adenosine monophosphate kinases derived from *Escherichia coli* include: polypeptides (adk) consisting of the amino acid sequence shown in Serial No. 2; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 2, and possessing the aforementioned deoxyadenosine monophosphate kinase or adenosine monophosphate kinase activities; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 2, and possessing deoxyadenosine monophosphate kinase or adenosine monophosphate kinase activities. Furthermore, any reaction from dAMP to dADP that can proceed can be performed, and either deoxyadenosine monophosphate kinase or adenosine monophosphate kinase can be used in this reaction. Similarly, any reaction from AMP to ADP that can proceed can be performed, and either deoxyadenosine monophosphate kinase or adenosine monophosphate kinase can be used in this reaction.

[0073] In the method for synthesizing dGTP or GTP in this application, deoxyguanosine monophosphate kinase (DMP) or guanosine monophosphate kinase (GMP) is used as an enzyme in the reaction from dGMP to dGDP or from GMP to GDP. DMP or GMP is an enzyme (e.g., EC 2.7.4.8) that catalyzes the phosphorylation of dGMP to dGDP or GMP to GDP using dGTP or GTP, ATP, etc., as a phosphate source; it is also called guanylate kinase (gmk). There are no particular limitations on the source of this DMP or GMP; in addition to known enzymes derived from yeast, bacteria, or mammals, commercially available enzymes can be used. However, DMP or GMP derived from yeast or bacteria is preferred. Examples of DMP or GMP derived from bacteria, preferably from Gram-negative bacteria, and even more preferably from *Escherichia coli*, are also preferred. Examples of deoxyguanosine monophosphate (DMP) or guanosine monophosphate (GMP) kinases derived from *Escherichia coli* include: polypeptides (GMKs) consisting of the amino acid sequence shown in Serial No. 13; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 13, and possessing the aforementioned DMP or GMP activities; and polypeptides consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence shown in Serial No. 13, and possessing DMP or GMP activities. Furthermore, any reaction from dGMP to dGDP that can proceed can be performed, and either DMP or GMP can be used in this reaction. Similarly, any reaction from GMP to GDP that can proceed can be performed, and either DMP or GMP can be used in this reaction.

[0074] In the method for synthesizing dTTP in this application, deoxythymidine monophosphate kinase is used as the enzyme in the reaction from dTMP to dTDP. Deoxythymidine monophosphate kinase is an enzyme that catalyzes the phosphorylation of dTMP to dTDP using dTTP, ATP, etc., as a phosphate source (EC 2.7.4.9), also known as thymidylate kinase (TMK). There are no particular limitations on the source of this deoxythymidine monophosphate kinase; in addition to known enzymes derived from yeast, bacteria, or mammals, commercially available enzymes can be used. However, deoxythymidine monophosphate kinases derived from yeast or bacteria are preferred, including those derived from bacteria, preferably from Gram-negative bacteria, and even more preferably from *Escherichia coli*. Examples of deoxythymidine monophosphate kinases derived from *Escherichia coli* include: polypeptides (TMKs) consisting of the amino acid sequence shown in Serial No. 14; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 14, and having the aforementioned deoxythymidine monophosphate kinase activity; and polypeptides consisting of an amino acid sequence having more than 90%, 93%, 95%, or 98% sequence identity with the amino acid sequence shown in Serial No. 14, and having deoxythymidine monophosphate kinase activity.

[0075] In the method for synthesizing m5UTP or UTP in this application, uridine monophosphate kinase is used as an enzyme in the reaction from m5UMP to m5UDP or from UMP to UDP. Urinidine monophosphate kinase is an enzyme that catalyzes the phosphorylation of m5UMP to m5UDP or UMP to UDP using UTP, ATP, or the like as a phosphate source (EC 2.7.4.22), also known as uridylate kinase (UMK). There are no particular limitations on the source of this uridine monophosphate kinase; in addition to known enzymes derived from yeast, bacteria, or mammals, commercially available enzymes can be used. However, uridine monophosphate kinase derived from yeast or bacteria is preferred, specifically from bacteria, preferably from Gram-negative bacteria, and even more preferably from *Escherichia coli*.

[0076] In the method for synthesizing dCTP or CTP in this application, deoxycytidine monophosphate kinase or cytidine monophosphate kinase is used as an enzyme in the reaction from dCMP to dCDP or from CMP to CDP. Deoxycytidine monophosphate kinase or cytidine monophosphate kinase is an enzyme (EC 2.7.4.14, EC 2.7.4.25) that uses dCTP or CTP, ATP, etc., as a phosphate source to catalyze the phosphorylation of dCMP to dCDP or CMP to CDP. It is also called cytidine kinase or cytidylate kinase (cmK). There are no particular limitations on the source of this deoxycytidine monophosphate kinase or thymidine monophosphate kinase. In addition to known enzymes derived from yeast, bacteria, or mammals, commercially available enzymes can be used. However, deoxycytidine monophosphate kinase or cytidine monophosphate kinase derived from yeast or bacteria is preferred. Examples include deoxycytidine monophosphate kinase or cytidine monophosphate kinase derived from bacteria, preferably from Gram-negative bacteria, and more preferably from *Escherichia coli*. Examples of deoxycytidine monophosphate kinases (CMPs) or cytidine monophosphate kinases derived from *Escherichia coli* include: polypeptides (CMKs) consisting of the amino acid sequence shown in Serial No. 12; or polypeptides consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 12, and possessing the aforementioned deoxycytidine monophosphate kinase or cytidine monophosphate kinase activities; and polypeptides consisting of an amino acid sequence having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence shown in Serial No. 12, and possessing deoxycytidine monophosphate kinase or cytidine monophosphate kinase activities. Furthermore, any reaction from dCMP to dCDP can proceed, and either deoxycytidine monophosphate kinase or cytidine monophosphate kinase can be used in this reaction. Similarly, any reaction from CMP to CDP can proceed, and either deoxycytidine monophosphate kinase or cytidine monophosphate kinase can be used in this reaction.

[0077] In the method for synthesizing dNTP or NTP of this application, pyruvate kinase is used as an enzyme in (1) the reaction from dADP to dATP or from ADP to ATP, (2) the reaction from dGDP to dGTP or from GDP to GTP, (3) the reaction from dTDP to dTTP, (4) the reaction from m5UDP to m5UTP or from UDP to UTP, or (5) the reaction from dCDP to dCTP or from CDP to CTP. Pyruvate kinase is an enzyme that uses phosphoenolpyruvate (PEP) as a phosphate source to catalyze the phosphorylation of deoxyadenosine diphosphate (dADP), deoxyguanosine diphosphate (dGDP), deoxythymidine diphosphate (dTDP), or deoxycytidine diphosphate (dCDP), or the phosphorylation of adenosine diphosphate (ADP), guanosine diphosphate (GDP), 5'-methyluridine diphosphate (m5UDP), uridine diphosphate (UDP), and cytidine diphosphate (CDP), sequentially generating one molecule of pyruvate and one molecule of dATP, dGTP, dTTP, dCTP, or ATP, GTP, m5UTP, UTP, CTP (EC 2.7.1.40). There are no particular limitations on the source of this pyruvate kinase. In addition to known enzymes derived from yeast, bacteria, or mammals, commercially available enzymes may be used. However, pyruvate kinases derived from yeast or bacteria are preferred. Examples of pyruvate kinases derived from bacteria, preferably from Gram-negative bacteria, and even more preferably from *Escherichia coli* are given. Examples of pyruvate kinases derived from *Escherichia coli* include polypeptides consisting of the amino acid sequence shown in Serial No. 3 (PykA) and polypeptides consisting of the amino acid sequence shown in Serial No. 4 (PykF). Furthermore, examples include polypeptides consisting of amino acid sequences obtained by deleting, substituting, or adding one or more amino acids to the amino acid sequence shown in Serial No. 3 or 4, and possessing pyruvate kinase activity; and polypeptides consisting of amino acid sequences having 90% or more, 93% or more, 95% or more, or 98% or more sequence identity with the amino acid sequence shown in Serial No. 3 or 4, and possessing pyruvate kinase activity. In addition, examples of yeast-derived pyruvate kinases include: a polypeptide (CDC19) consisting of the amino acid sequence shown in Serial No. 5; or a polypeptide consisting of an amino acid sequence obtained by deleting, substituting, or adding one or more amino acids in the amino acid sequence shown in Serial No. 5, and having pyruvate kinase activity; or a polypeptide consisting of an amino acid sequence having more than 90%, more than 93%, more than 95%, or more than 98% sequence identity with the amino acid sequence shown in Serial No. 5, and having pyruvate kinase activity.

[0078] The amino acid and base sequences of the aforementioned kinases can be obtained from the database of NCBI (National Center for Biotechnology Information) (www.ncbi.nlm.nih.gov / ), etc.

[0079] Whether a kinase is active can be evaluated, for example, by confirming whether the substrate reacts with the kinase to generate a reaction product, as shown in the examples described later.

[0080] It should be noted that nucleoside diphosphate kinases (NDPKs), such as adenosine diphosphate (ADP) kinase, can also be considered for reactions from dADP to dATP or from ADP to ATP. However, depending on the enzyme used, the reaction may stop at an equilibrium state due to the concentration balance between dADP and dATP or between ADP and ATP, making it difficult to proceed to a state with a high concentration of dATP or ATP. Furthermore, even if the reaction takes time, the concentration of dATP or ATP cannot be increased. On the other hand, unlike NDPKs, by using pyruvate kinase, which uses PEP as a substrate, the reverse reaction is avoided, and the reaction proceeds towards the synthesis of dATP or ATP until PEP is almost depleted. From this perspective, in the method for synthesizing dATP or ATP in this application, it is preferable to use a kinase that does not involve the reaction from dATP to dADP or from ATP to ADP; pyruvate kinase is employed. In cases involving reactions from dGDP to dGTP or from GDP to GTP, from dTDP to dTTP, from m5UDP to UTP or from UDP to UTP, or from dCDP to dCTP or from CDP to CTP, nucleoside diphosphate kinases (NDPKs), such as guanosine diphosphate kinase, thymidine diphosphate kinase, and cytidine diphosphate kinase, can also be considered. However, from the same perspective as above, it is preferable to use a kinase that does not involve reactions from dGTP to dGDP or from GTP to GDP, from dTTP to dTDP, from m5UTP to m5UDP or from UTP to UDP, or from dCTP to dCDP or from CTP to CDP; therefore, pyruvate kinase was employed.

[0081] In the method for synthesizing dNTPs or NTPs in this application, other kinases may be included in the reaction solution. However, from the viewpoint of reducing costs and increasing yield, it is preferable to avoid including nucleoside diphosphate kinase (NDPK), acetate kinase, and other kinases. Even if other kinases are included, their concentrations are preferably 0.1 mg / mL or less, more preferably 0.05 mg / mL or less, even more preferably 0.02 mg / mL or less, and more preferably 0 mM. In particular, if NDPK is used, in the case of the method for synthesizing dATP or ATP in this application, when dADP and dATP or ADP and ATP reach equilibrium, the reaction to dATP or ATP no longer proceeds, resulting in a lower yield.

[0082] In the method for synthesizing dATP or ATP in this application, there are no particular restrictions on the combination of sources of deoxyadenosine kinase or adenosine kinase, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase, and pyruvate kinase. In addition to known enzymes derived from yeast, bacteria, or mammals, commercially available enzymes can be used. However, it is preferred that all kinases are derived from yeast or bacteria, and it is preferable that kinases derived from fruit flies are not included. Alternatively, one kinase can be derived from yeast, and other kinases from bacteria. It is also possible that deoxyadenosine kinase or adenosine kinase is derived from yeast, and deoxyadenosine monophosphate kinase or adenosine monophosphate kinase and pyruvate kinase are derived from *Escherichia coli*. Generally, when multiple enzymes are mixed and reacted using a one-pot method, it is preferable to use kinases from the same source from the viewpoint of adjusting the pH and composition of the reaction solution and the enzyme activity. However, kinases from different sources can also be used as long as the pH, composition, and enzyme activity of the reaction solution can be adjusted to maintain kinase activity. The same applies to combinations of sources of deoxyguanosine kinase or guanosine kinase, deoxyguanosine monophosphate kinase or guanosine monophosphate kinase, and pyruvate kinase in the synthesis methods of dGTP or GTP of this application; combinations of sources of deoxythymidine kinase, deoxythymidine monophosphate kinase, and pyruvate kinase in the synthesis methods of dTTP of this application; combinations of sources of uridine kinase, uridine monophosphate kinase, and pyruvate kinase in the synthesis methods of m5UTP or UTP of this application; and combinations of sources of deoxycytidine kinase or cytidine kinase, deoxycytidine monophosphate kinase or cytidine monophosphate kinase, and pyruvate kinase in the synthesis methods of dCTP or CTP of this application.

[0083] In the synthesis methods of dATP or ATP of this application, the amounts of deoxyadenosine kinase or adenosine kinase, deoxyadenosine monophosphate kinase or adenosine monophosphate kinase, and pyruvate kinase contained in the reaction solution can be appropriately adjusted according to the concentration of deoxyadenosine (dAd) or adenosine (Ad) as the starting material and the activity of each enzyme. The same applies to the synthesis methods of dGTP or GTP of this application, the synthesis methods of dT ...

[0084] In the methods for synthesizing dTP or ATP, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP of this application, from the viewpoint of reaction efficiency, it is preferable that the enzyme added to the reaction vessel is not immobilized on a carrier such as a polyacrylamide gel.

[0085] (Phosphoric acid donor) In the synthesis methods of dATP or ATP of this application, nucleoside triphosphates or deoxynucleoside triphosphates can be used as phosphate donors in the reaction from dAd to dAMP or from Ad to AMP. Similarly, in the synthesis methods of dGTP or GTP of this application, the reaction from dGua to dGMP or from Gua to GMP, the synthesis method of dTTP of this application, the reaction from dThy to dTMP, the synthesis method of m5UTP or UTP of this application, the reaction from m5Uri to m5UMP or from Uri to UMP, or the synthesis method of dCTP or CTP of this application, the reaction from dCyt to dCMP or from Cyt to CMP, nucleoside triphosphates or deoxynucleoside triphosphates can be used as phosphate donors. The aforementioned nucleoside triphosphates or deoxynucleoside triphosphates include any one of ATP, guanosine triphosphate (GTP), 5'-methyluridine triphosphate (m5UTP), uridine triphosphate (UTP), and cytidine triphosphate (CTP), or any one of dATP, deoxyguanosine triphosphate (dGTP), deoxythymidine triphosphate (dTTP), and deoxycytidine triphosphate (dCTP), or combinations thereof. In the case of the synthesis method of dATP or ATP of this application, dATP or ATP is preferably used as the phosphate donor; in the case of the synthesis method of dGTP or GTP of this application, dGTP or GTP is preferably used as the phosphate donor; in the case of the synthesis method of dTTP of this application, dTTP or TTP is preferred; in the case of the synthesis method of m5UTP or UTP of this application, UTP is preferred; and in the case of the synthesis method of dCTP or CTP of this application, dCTP or CTP is preferably used as the phosphate donor, but there are no particular limitations. That is, taking the synthesis method of dATP or ATP of this application as an example, the phosphate donor is not limited to ATP or dATP, but can also be any of guanosine triphosphate (GTP), cytidine triphosphate (CTP), 5'-methyluridine triphosphate (m5UTP), uridine triphosphate (UTP), or any of deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), deoxythymidine triphosphate (dTTP), or combinations thereof. The phosphate donor is also the same in the synthesis methods of dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP of this application.It should be noted that the dATP or ATP, dGTP or GTP, dTTP or TTP, m5UTP or UTP, dCTP or CTP added as phosphate donors have the function of reaction initiators in the synthesis methods of dATP or ATP, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP of this application.

[0086] Furthermore, in method 1 for synthesizing dATP or ATP of this application, dATP or ATP is generated and utilized once the reaction proceeds. Therefore, the initial concentration ratio (dNTP or NTP / dAd or Ad) of deoxynucleoside triphosphate (dNTP) or nucleoside triphosphate (NTP) as a phosphate donor relative to deoxyadenosine (dAd) or adenosine (Ad) can be set to 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, further preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. From the viewpoint of cost reduction, it is preferable to reduce the concentration ratio of dNTP or NTP relative to dAd or Ad.

[0087] Similarly, in the synthesis methods 1 of dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP of this application, once the reaction proceeds, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP will be generated respectively, and used in the synthesis reactions of dATP or ATP, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP. Therefore, the initial concentration ratio of deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs) as phosphate donors relative to deoxyguanosine (dGua) or guanosine (Gua), deoxythymidine (dThy), 5-methyluridine (m5Uri) or uridine (Uri), or deoxycytidine (dCyt) or cytidine (Cyt) can be set to 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, further preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. From the viewpoint of cost reduction, it is preferable to reduce the concentration ratio of dNTPs or NTPs relative to dGua or Gua, dThy, m5Uri or Uri, dCyt or Cyt.

[0088] Furthermore, in method 2 for synthesizing dATP or ATP of this application, dATP or ATP is generated and utilized once the reaction proceeds. Therefore, the initial concentration ratio of deoxynucleoside triphosphate (dNTP) or nucleoside triphosphate (NTP) as a phosphate donor to deoxyadenosine monophosphate (dAMP) or adenosine monophosphate (AMP) can be set to 1.0 or less, 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, further preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. From the viewpoint of cost reduction, it is preferable to reduce the concentration ratio of dNTP or NTP to dAMP or AMP.

[0089] Similarly, in the second method of synthesizing dGTP or GTP, the second method of synthesizing dTTP, the second method of synthesizing m5UTP or UTP, or the second method of synthesizing dCTP or CTP of this application, once the reaction proceeds, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP will be generated respectively, and used in the synthesis reaction of dATP or ATP, dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP. Therefore, the initial concentration ratio of deoxynucleoside triphosphates (dNTPs) or nucleoside triphosphates (NTPs) as phosphate donors relative to deoxyguanosine monophosphate (dGMP) or guanosine monophosphate (GMP), deoxythymidine monophosphate (dTMP), 5'-methyluridine monophosphate (m5UMP) or uridine monophosphate (UMP), or deoxycytidine monophosphate (dCMP) or cytidine monophosphate (CMP) can be set to 1.0 or less, 0.5 or less, preferably 0.2 or less, more preferably 0.1 or less, further preferably 0.05 or less, particularly preferably 0.02 or less, and most preferably 0.01 or less. From the viewpoint of cost reduction, it is preferable to reduce the concentration ratio of dNTPs or NTPs relative to dGMP or GMP, dTMP, m5UMP or UMP, or dCMP or CMP.

[0090] (Enzyme reaction conditions) The pH of the reaction solution in the method for synthesizing dNTP or NTP, specifically the method for synthesizing dATP or ATP, the method for synthesizing dGTP or GTP, the method for synthesizing dTTP, the method for synthesizing m5UTP or UTP, or the method for synthesizing dCTP or CTP, can be appropriately adjusted according to the enzyme used. Examples of pH values ​​are 4.5 to 10.0, preferably 5.0 to 9.0, more preferably 5.5 to 8.5, and even more preferably 6.0 to 8.0.

[0091] The temperature of the reaction solution in the method for synthesizing dNTP or NTP, specifically the method for synthesizing dATP or ATP, the method for synthesizing dGTP or GTP, the method for synthesizing dTTP, the method for synthesizing m5UTP or UTP, or the method for synthesizing dCTP or CTP, can be appropriately adjusted according to the enzyme used, and examples include 25~40°C, preferably 28~37°C.

[0092] The reaction time in the method for synthesizing dNTPs or NTPs according to this application, specifically the method for synthesizing dATP or ATP, the method for synthesizing dGTP or GTP, the method for synthesizing dTTP, the method for synthesizing m5UTP or UTP, or the method for synthesizing dCTP or CTP according to this application, can be appropriately adjusted according to the concentration of the enzyme used, dAd or Ad, dGua or Gua, dThy, m5Uri or Uri, dCyt or Cyt, dAMP or AMP, dGMP or GMP, dTMP, m5UMP or UMP, or dCMP or CMP. Examples of such adjustments are 0.1 to 24 hours, preferably 0.5 to 12 hours, and more preferably 1 to 4 hours. If the reaction time exceeds 24 hours, the amount of synthesized dATP or ATP and other deoxyribonucleotide triphosphates or ribonucleotide triphosphates will decrease. Therefore, it is preferable to control the reaction time within 24 hours.

[0093] In the synthesis method 1 of dNTP or NTP of this application, specifically the synthesis method 1 of dATP or ATP of this application, the synthesis method 1 of dGTP or GTP of this application, the synthesis method 1 of dTTP of this application, the synthesis method 1 of m5UTP or UTP of this application, or the synthesis method 1 of dCTP or CTP of this application, the concentration of phosphoenolpyruvate (PEP) can be appropriately adjusted according to the enzyme, deoxyribonucleoside or ribonucleoside used, specifically the concentration of dAd or Ad, the concentration of dGua or Gua, the concentration of dThy, the concentration of m5Uri or Uri, and the concentration of dCyt or Cyt. The concentration ratio of PEP to deoxyribonucleoside or ribonucleoside (PEP / deoxyribonucleoside or ribonucleoside) can be 1 or more, preferably 2 or more, more preferably 3 or more, further preferably 5 or more, even more preferably 6 or more, particularly preferably 9 or more, and most preferably 5 to 10.

[0094] In the dNTP or NTP synthesis method 2 of this application, specifically the dATP or ATP synthesis method 2 of this application, the dGTP or GTP synthesis method 2 of this application, the dTTP synthesis method 2 of this application, the m5UTP or UTP synthesis method 2 of this application, and the dCTP or CTP synthesis method 2 of this application, the concentration of phosphoenolpyruvate (PEP) can be appropriately adjusted according to the enzyme used, the concentration of deoxynucleoside monophosphate or nucleoside monophosphate, specifically the concentration of dAMP or AMP, the concentration of dGMP or GMP, the concentration of dTMP, the concentration of m5UMP or UMP, and the concentration of dCMP or CMP. The concentration ratio of PEP to deoxynucleoside monophosphate or nucleoside monophosphate (PEP / deoxynucleoside monophosphate or ribonucleoside monophosphate) can be 1 or more, preferably 2 or more, more preferably 3 or more, further preferably 5 or more, even more preferably 6 or more, particularly preferably 9 or more, and most preferably 5 to 10.

[0095] In the methods for synthesizing dATP or ATP, specifically the methods for synthesizing dGTP or GTP, the methods for synthesizing dTTP, the methods for synthesizing m5UTP or UTP, or the methods for synthesizing dCTP or CTP of this application, in order to promote the enzyme reaction, ionic compounds such as magnesium ions, potassium ions, and manganese ions, or magnesium sulfate may be included. Magnesium chloride and potassium chloride can be used as sources of magnesium ions and potassium ions. The concentration in the reaction solution containing magnesium chloride can be 2-200 mM, preferably 5-100 mM, and more preferably 10-80 mM. The concentration in the reaction solution containing potassium chloride can be 3-300 mM, preferably 10-70 mM.

[0096] In the synthesis methods of dNTP or NTP of this application, specifically the synthesis methods of dATP or ATP of this application, the synthesis methods of dGTP or GTP of this application, the synthesis methods of dTTP of this application, the synthesis methods of m5UTP or UTP of this application, or the synthesis methods of dCTP or CTP of this application, the concentration of phosphoenolpyruvate in the reaction solution can be 5 to 120 mM, preferably 10 to 100 mM, and more preferably 30 to 90 mM.

[0097] In the methods for synthesizing dATP or ATP in this application, specifically the methods for synthesizing dGTP or GTP, the methods for synthesizing dTTP, the methods for synthesizing m5UTP or UTP, or the methods for synthesizing dCTP or CTP, by adjusting the concentration of phosphoenolpyruvate, the phosphate used in the reaction can be entirely derived from phosphoenolpyruvate. Therefore, theoretically, depending on the reaction solution, approximately one molecule of dNTP or NTP can be synthesized from one molecule of deoxyribonucleoside or ribonucleoside as a starting material. Specifically, approximately one molecule of dATP or ATP can be synthesized from one molecule of dAd or Ad, approximately one molecule of dGTP or GTP can be synthesized from one molecule of dGua or Gua, approximately one molecule of dTTP can be synthesized from one molecule of dThy, approximately one molecule of m5UTP or Uri can be synthesized from one molecule of m5Uri or Uri, and approximately one molecule of dCTP or CTP can be synthesized from one molecule of dCyt or Cyt. This is because, taking the synthesis method of dATP or ATP in this application as an example, in the reaction pathway, each molecule of dAd or other deoxynucleoside or Ad or other nucleoside consumes one molecule of dATP or other deoxynucleoside triphosphate or ATP or other nucleoside triphosphate. dATP or other deoxynucleoside triphosphate or ATP or other deoxynucleoside triphosphate loses one phosphate group, thereby producing dADP or other deoxynucleoside diphosphate or ADP or other nucleoside diphosphate. This dADP or other deoxynucleoside diphosphate or ADP or other nucleoside diphosphate uses PEP as a phosphate donor and utilizes pyruvate kinase to produce dATP or other deoxynucleoside triphosphate or ATP or other nucleoside triphosphate. It should be noted that, in order to initiate the reaction, the reaction solution initially contains dATP or ATP, but as the reaction progresses, the produced dATP or ATP is consumed. Therefore, it is sufficient to initially contain only the minimum amount of dATP or ATP required to initiate the reaction. The same applies to the synthesis methods of dGTP or GTP, dTTP, m5UTP or UTP, or dCTP or CTP of this application.

[0098] In the synthesis method of dNTP or NTP of this application, any one of the synthesis methods of dATP or ATP, dGTP or GTP, dTTP, m5UTP or UTP, and dCTP or CTP of this application can be carried out by using a one-pot method, that is, by reacting in the same reaction vessel. Alternatively, any combination of any two of the above synthesis methods, any combination of three synthesis methods, a combination of four synthesis methods, or a combination of all synthesis methods can be carried out by using a one-pot method.

[0099] For example, it can be implemented using only the synthesis method of dATP or ATP of this application, only the synthesis method of dGTP or GTP of this application, only the synthesis method of dTTP of this application, only the synthesis method of m5UTP or UTP of this application, or only the synthesis method of dCTP or CTP of this application.

[0100] In addition, as combinations of the above two synthesis methods, examples include the synthesis method of dATP or ATP of this application with the synthesis method of dGTP or GTP of this application, the synthesis method of dATP or ATP of this application with the synthesis method of dTTP of this application, the synthesis method of dATP or ATP of this application with the synthesis method of m5UTP or UTP of this application, the synthesis method of dATP or ATP of this application with the synthesis method of dCTP or CTP of this application, the synthesis method of dGTP or GTP of this application with the synthesis method of dTTP of this application, the synthesis method of dGTP or GTP of this application with the synthesis method of m5UTP or UTP of this application, the synthesis method of dGTP or GTP of this application with the synthesis method of dCTP or CTP of this application, the synthesis method of dTTP of this application with the synthesis method of m5UTP or UTP of this application, the synthesis method of dTTP of this application with the synthesis method of dCTP or CTP of this application, or combinations of the synthesis method of m5UTP or UTP of this application with the synthesis method of dCTP or CTP of this application.

[0101] Furthermore, combinations of the above three synthesis methods can include: the synthesis method of dATP or ATP of this application; the synthesis method of dGTP or GTP of this application and the synthesis method of dTTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dGTP or GTP of this application and the synthesis method of m5UTP or UTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dGTP or GTP of this application and the synthesis method of dCTP or CTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dTTP of this application and the synthesis method of m5UTP or UTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dTTP of this application and the synthesis method of dCTP or CTP of this application. Methods for synthesizing TP; methods for synthesizing dATP or ATP, methods for synthesizing m5UTP or UTP, and methods for synthesizing dCTP or CTP; methods for synthesizing dGTP or GTP, methods for synthesizing dTTP, and methods for synthesizing m5UTP or UTP; methods for synthesizing dGTP or GTP, methods for synthesizing dTTP, and methods for synthesizing dCTP or CTP; methods for synthesizing dGTP or GTP, methods for synthesizing m5UTP or UTP, and methods for synthesizing dCTP or CTP; or combinations of methods for synthesizing dTTP, methods for synthesizing m5UTP or UTP, and methods for synthesizing dCTP or CTP.

[0102] In addition, combinations of the above four synthesis methods can include: the synthesis method of dATP or ATP of this application; the synthesis method of dGTP or GTP of this application; the synthesis method of dTTP of this application and the synthesis method of m5UTP or UTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dGTP or GTP of this application; the synthesis method of dTTP of this application and the synthesis method of dCTP or CTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dGTP or GTP of this application; the synthesis method of m5UTP or UTP of this application and the synthesis method of dCTP or CTP of this application; the synthesis method of dATP or ATP of this application; the synthesis method of dTTP of this application; the synthesis method of m5UTP or UTP of this application and the synthesis method of dCTP or CTP of this application; or combinations of the synthesis methods of dGTP or GTP of this application, the synthesis method of dTTP of this application, the synthesis method of m5UTP or UTP of this application and the synthesis method of dCTP or CTP of this application.

[0103] Specifically, the following example illustrates a combination of the one-pot synthesis method of dATP or ATP and the synthesis method of dGTP or GTP of this application. The same applies to combinations of other synthesis methods.

[0104] A method for preparing a reaction solution by adding the following (i) to (iii) into a reaction vessel and carrying out the reaction using a one-pot method: (i) Deoxyadenosine or adenosine as a starting material; and deoxyguanosine or guanosine. (ii) as an enzyme Deoxyadenosine kinase or adenosine kinase, and deoxyguanosine kinase or guanosine kinase, Deoxyadenosine monophosphate kinase or adenosine monophosphate kinase, and deoxyguanosine monophosphate kinase or guanosine monophosphate kinase, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

[0105] In the methods for synthesizing dATP or ATP in this application, specifically the methods for synthesizing dGTP or GTP, the methods for synthesizing dTTP, the methods for synthesizing m5UTP or UTP, or the methods for synthesizing dCTP or CTP, the reaction solution may contain a buffer solution to suppress pH fluctuations. Examples of the concentration of the buffer solution include 0.01 to 1.0 M, preferably 0.05 to 0.8 M, and more preferably 0.1 to 0.6 M. Furthermore, there are no particular limitations on the buffer solution, and examples include Tris ((hydroxymethyl)aminomethane) hydrochloric acid buffer, phosphate buffer, borate buffer, carbonate buffer, MES (2-morpholinoethanesulfonic acid) buffer, HEPES (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid) buffer, MOPS (3-(N-morpholino)propanesulfonic acid), TEA (Tris-Acetate-EDTA) buffer, Tricine buffer, etc.

[0106] (Enzyme reaction solution) With regard to the enzyme used in method 1 for the synthesis of dNTPs or NTPs in this application, namely at least one, preferably two, and more preferably three enzymes selected from the group consisting of (i) nucleoside kinases such as adenosine kinase, (ii) nucleoside monophosphate kinases such as adenosine monophosphate kinase, and (iii) pyruvate kinase, the enzyme reaction solution obtained by the method described below can be used directly as the enzyme. The method is a method for preparing an enzyme reaction solution by extracting the aforementioned enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase while maintaining enzyme activity. The method includes a step of treating the aforementioned bacteria or yeast at 25-95°C with the following enzyme extract solution for 0.1 hours to 4 days, wherein the enzyme extract solution is a 0.05-1.0M buffer solution containing 0-3% nonionic surfactant or amphoteric surfactant and the pH is adjusted to 6-11. The method does not include a step of lysing or breaking down the bacteria or yeast (hereinafter also referred to as "Method 1 for Preparing the Enzyme Reaction Solution of this Application").

[0107] Furthermore, regarding the enzyme used in method 2 of this application for the synthesis of dNTPs or NTPs, specifically at least one, preferably two, enzymes selected from the group consisting of (ii) nucleoside monophosphate kinases such as adenosine monophosphate kinase and (iii) pyruvate kinase, the enzyme reaction solution obtained by the following method can be used directly as the enzyme. The method is a method for preparing an enzyme reaction solution by extracting the aforementioned enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside monophosphate kinase and pyruvate kinase while maintaining enzyme activity. The method includes a step of treating the aforementioned bacteria or yeast at 25 to 95°C with the following enzyme extract: a 0.05 to 1.0 M buffer solution containing 0 to 3% nonionic surfactant or amphoteric surfactant, and the pH is adjusted to 6 to 11. The method does not include a step of lysing or breaking down the bacteria or yeast (hereinafter also referred to as "method 2 for preparing the enzyme reaction solution of this application").

[0108] The following describes methods 1 and 2 for preparing the enzyme reaction solution of this application (hereinafter, methods 1 and 2 for preparing the enzyme reaction solution of this application will be collectively referred to as "the preparation method of the enzyme reaction solution of this application").

[0109] (Bacteria or yeast) In the preparation method of the enzyme reaction solution of this application, the bacteria used can be any bacteria that are taxonomically classified, without particular restrictions. They can be either Gram-negative or Gram-positive bacteria. Examples of Gram-negative bacteria include *Escherichia coli*, *Pseudomonas*, and *Streptomyces*. Examples of Gram-positive bacteria include *Bacillus* (such as *Bacillus subtilis*), *Streptococcus*, *Staphylococcus*, *Bacillus brevis*, *Corynebacterium*, *Lactobacillus*, and lactic acid bacteria. Furthermore, mutant strains of these bacteria are also included. It should be noted that, to further increase the amount of the specified enzyme in the enzyme reaction solution, it is preferable to use transforming bacteria or transforming yeast that integrate a polynucleotide encoding the specified enzyme. This polynucleotide can be a polynucleotide encoding an enzyme derived from the host being transformed, or it can be a polynucleotide or a mutant polynucleotide obtained by optimizing the codons of a polynucleotide encoding an enzyme derived from a different species within the host.

[0110] In the preparation method of the enzyme reaction solution of this application, the yeast used can be any yeast that belongs to the yeast family in taxonomy, without particular restrictions. For example, yeasts of the genera *Saccharomyces*, *Kluyveromyces*, *Candida*, and *Pichia pastoris* can be cited. Specifically, *Saccharomyces cerevisiae*, *Kluyveromyces lactis*, *Candida utilis*, and *Pichia pastoris* can be cited. In addition, mutant strains of these yeasts are also included among the above-mentioned yeasts.

[0111] (Enzyme extract and its processing conditions) Examples of surfactants used in the preparation method of the enzyme reaction solution of this application include nonionic surfactants, amphoteric surfactants, or their salts. Examples of nonionic surfactants include ether-based nonionic surfactants such as Triton X-100 and NP40. Examples of amphoteric surfactants include MEGA-10 and CHAPS. It should be noted that the above-mentioned nonionic surfactants can also be used in combination with the above-mentioned amphoteric surfactants or their salts. Furthermore, it is preferable that the surfactant does not contain cationic surfactants and / or anionic surfactants or their salts. Examples of cationic surfactants include sulfonic acid surfactants such as 1-dodecanesulfonic acid and hexadecyltrimethylammonium bromide (CTAB). Examples of anionic surfactants include sodium dodecyl sulfate (SDS), lauryltrimethylammonium chloride (Lauryltrimethylammonium chloride), and sodium deoxycholate. It should be noted that in the enzyme reaction solution obtained using the preparation method of the enzyme reaction solution of this application, surfactants, preferably nonionic surfactants or amphoteric surfactants, may be added for purposes such as enzyme stabilization.

[0112] In the method for preparing the enzyme reaction solution of this application, the concentration of the nonionic surfactant or amphoteric surfactant in the enzyme extract can be appropriately adjusted according to the molecular weight of the extracted enzyme and the type of bacteria or yeast. Examples include 0-3%, and concentrations can be set to 0%, 0-0.01%, 0-0.1%, 0-0.25%, 0-0.5%, or 0.1-2%, 0.5-1.5%, or 0.8-1.2%. It should be noted that the above concentrations are % (v / v) when the nonionic surfactant or amphoteric surfactant is a liquid, and % (w / v) when prepared by dissolving powder.

[0113] In the preparation method of the enzyme reaction solution of this application, the pH of the enzyme extract can be appropriately adjusted according to the stability of the extracted enzyme. Examples of pH values ​​include 6 to 11, 6.3 to 10.5, more preferably 6.5 to 10.2, even more preferably 7 to 10, and particularly preferably 8 to 9.

[0114] In the preparation method of the enzyme reaction solution of this application, a buffer solution can be used for the enzyme extract to suppress pH fluctuations. Examples of buffer concentrations include 0.05 to 1.0 M, and preferably 0.1 to 0.6 M. Furthermore, there are no particular limitations on the buffer solution used, and examples include Tris ((hydroxymethyl)aminomethane) hydrochloric acid buffer, phosphate buffer, borate buffer, carbonate buffer, MES (2-morpholine ethanesulfonic acid) buffer, HEPES (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid) buffer, MOPS (3-(N-morpholine)propanesulfonic acid) buffer, TEA (Tris-Acetate-EDTA) buffer, Tricine buffer, etc.

[0115] The temperature for processing with enzyme extract can be adjusted appropriately according to the heat resistance of the extracted enzyme, and examples include 4~95℃, with 25~90℃ and 40~60℃ being preferred.

[0116] There are no particular restrictions on the treatment time with enzyme extract, but it is preferred to be 0.1 hours or more. Examples include 0.5 hours to 4 days, 1 hour to 2 days, and 3 hours to 24 hours.

[0117] (Crush or lyse) The method for preparing the enzyme reaction solution in this application does not include the process of disrupting or lysing bacteria or yeast. Here, the disruption or lysing of bacteria or yeast refers to: physical treatment of bacteria or yeast using methods such as ultrasound, zirconia beads, glass beads, or a pressure homogenizer; and chemical treatment using methods such as acid or alkali treatment, alkali SDS treatment, or enzymatic treatment with lysozyme or cytolytic enzymes, thereby rendering them in a state without residual cells. The presence or absence of residual cells can be confirmed by microscopic observation of the bacteria or yeast.

[0118] To determine whether the enzyme in the obtained enzyme reaction solution is in an active state, the enzyme reaction solution can be added to the enzyme substrate, and the enzyme reaction product can be obtained to confirm this.

[0119] In the preparation method of the enzyme reaction solution of this application, a purification step for removing impurities after enzyme extraction by treatment with enzyme extract solution is preferably omitted. Conventionally, when extracting enzymes by lysing or breaking down bacteria or yeast, a purification step is required to remove impurities such as broken or dissolved cell walls, DNA, RNA, and other nucleic acids, using commercially available nucleic acid purification kits or methods such as polyethyleneimine precipitation, in order to remove these impurities. However, in the preparation method of the enzyme reaction solution of this application, the enzyme is extracted without lysing or breaking down bacteria or yeast, therefore a purification step for removing the aforementioned impurities is unnecessary. It should be noted that the step of separating unlysed or unlysaturated bacterial or yeast cells by centrifugation or the like is not included in the purification step for removing the aforementioned impurities. Furthermore, the purification step does not include the step of removing polypeptides other than the aforementioned impurities and the target enzyme by means of chromatographic methods such as affinity chromatography, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography, or ultrafiltration after treatment with enzyme extract solution, thereby removing substances that inhibit the enzyme activity of the target enzyme.

[0120] In the method for preparing the enzyme reaction solution of this application, when the enzyme reaction solution obtained by treating with enzyme extract is used directly for the enzyme reaction, it is sometimes not necessary to obtain only the specified enzyme. In this case, a peptide that does not contain the tag sequence or other modifications necessary to obtain only the specified enzyme can be used.

[0121] (Products of enzyme reaction) In the method for preparing the enzyme reaction product of this application, there are no particular limitations on the enzyme reaction product. For example, deoxyribonucleoside triphosphate can be used as the substrate, and a DNA polymerase reaction solution prepared by extracting DNA polymerase can be used as the enzyme reaction solution to perform a PCR reaction, thereby obtaining a PCR amplification product as the enzyme reaction product. Alternatively, a compound to be phosphorylated can be used as the substrate, and a phosphorylase reaction solution prepared by extracting phosphorylase using the method for preparing the enzyme reaction solution of this application can be used as the enzyme reaction solution to perform an enzyme reaction, thereby obtaining a phosphorylated compound formed by phosphorylation of the substrate as the enzyme reaction product.

[0122] In addition to substrate and enzyme reaction solution, PCR reaction solution may also contain template DNA, primers, probes, and buffer. It should be noted that the enzyme reaction solution can be used directly as the buffer.

[0123] In the method for preparing the enzyme reaction product of this application, the solution to be subjected to the enzyme reaction may contain 0.1 to 20% (v / v) of the enzyme reaction solution prepared by the method of this application.

[0124] All patent and non-patent documents referenced in this specification are incorporated herein by reference in their entirety.

[0125] The present invention will be described in more detail below with reference to examples, but the technical scope of the present invention is not limited to these examples.

[0126] [Example 1] Extraction of enzyme (DNA polymerase) from Escherichia coli First, in the examples described later, PCR was performed to confirm the synthesis of dATP. The DNA polymerase used for this PCR was extracted from *E. coli* strains that highly express DNA polymerase using the following method.

[0127] (Cultivation of Escherichia coli expressing DNA polymerase) Using Escherichia coli as a host, the following methods were employed for transformation.

[0128] A plasmid containing Pfu DNA polymerase was prepared by integrating a polynucleotide encoding Pfu DNA polymerase into the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, 912-923 (2018)) to replace eEmRFP. Pfu DNA polymerase is a thermostable DNA polymerase derived from Pyrococcus furiosus.

[0129] To transform 30 μL of pre-treated ice-bath competent E. coli cells, 1 μL of the plasmid containing Pfu DNA polymerase was added. The mixture was stirred for 1 second, followed by an ice bath treatment at 42°C for 45 seconds. This process yielded E. coli expressing Pfu DNA polymerase. Next, 50 μL of sterile water was added, and the Pfu DNA polymerase-expressing E. coli was inoculated into an agar medium containing glucose, yeast extract, peptone, and ampicillin. The mixture was spread evenly using beads and incubated at 37°C for 1 day. Colonies growing on the agar medium were scraped off to approximately 3 cm using an inoculation loop and inoculated onto AB medium (Yamaguchi Technology Licensing Organization, Ltd.). The culture was then incubated at 37°C with gentle shaking for 1 day.

[0130] 500 mL of AB culture medium was added to a 1 L beaker. It should be noted that the beaker used was sterilized and covered with aluminum foil.

[0131] (Extraction of DNA polymerase) 50 mL of the culture medium obtained from culturing *E. coli* in the above-mentioned AB medium was dispensed into ten 50 mL tubes. The tubes were centrifuged at 12000 rpm for approximately 5 minutes, and the supernatant was removed. Next, 5 mL of the extract was resuspended in 0.1 M or 0.6 M Tris-HCl (pH adjusted to 7, 8, 9, or 10) with surfactants (Triton X-100, MEGA-10 (348-05093: Tongjin Chemical Research Institute), CHAPS, SDS, 1-Dodecanesulfonic Acid, and Lauryltrimethylammonium Chloride) at a final concentration of 1%. The extract was then treated at 50°C for 1 hour to extract Pfu DNA polymerase. The supernatant was then centrifuged at 12000 rpm for approximately 5 minutes and used as the enzyme reaction solution (pH set to 7, 8, 9, or 10) for the enzyme reaction (PCR reaction) described later.

[0132] (Confirmation of enzyme extraction based on SDS-PAGE) SDS-PAGE was used to confirm whether the enzyme had been extracted from the enzyme reaction solution.

[0133] Transfer 10 μL of the enzyme reaction solution (DNA polymerase extract) obtained by treating at 50°C for 1 hour to a 0.2 mL PCR 8-tube. Add 2 μL of 6× sample buffer for SDS-PAGE (trade number 09499-14: Nacalai Tesque) and mix thoroughly. Incubate at 95°C for 5 minutes. Load the sample into the gel at a rate of 1.2 μL / lane. 10-20% of a pre-made gel (SuperSep: Wako Pure Chemical Industries, Ltd.) was used.

[0134] The results of enzyme extraction confirmed by SDS-PAGE are shown below. Figure 1 The arrows on the right side of the figure indicate the molecular weight position of Pfu DNA polymerase. Bands were observed at positions corresponding to the molecular weight of Pfu DNA polymerase at any pH, confirming that Pfu DNA polymerase can be extracted without damaging or lysing *E. coli*. Furthermore, as surfactants, it was confirmed that large amounts were extracted, particularly with Triton X-100, MEGA10, CHAPS, SDS, and 1-dodecanesulfonic acid.

[0135] (Confirmation of polymerase activity based on PCR) PCR was used to confirm whether the Pfu DNA polymerase in the obtained enzyme reaction solution had enzymatic activity.

[0136] The PCR reaction solution is as follows.

[0137] 1M Tris-HCl pH 8.5 1.5μL Enzyme reaction solution (pH 7, 8, 9, 10) 0.2 μL Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dNTP mixture (10mM NEB) 0.5μL 5.3 μL of distilled water Total 10.0 μL The PCR reaction was performed in 30 cycles at 98°C for 5 seconds and 68°C for 5 seconds. Using the pAmp-srlAp-eEGFP plasmid described in the literature by Nakamura et al. as template DNA, a 711 bp polynucleotide encoding EGFP was amplified using eEGFP+1 (35) (Sequence No. 6) as the forward primer and eEGFP+711c (35) (Sequence No. 7) as the reverse primer. If DNA can be amplified by PCR, then the DNA polymerase has enzymatic activity.

[0138] Forward primer eEGFP+1 (35): atggtgagcaaaggtgaagaactgtttaccggtgt (Sequence number 6) Reverse primer eEGFP+711c(35): ttattcatccatacccagggtaatacctgctgcgg (Sequence number 7) The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 2 .

[0139] like Figure 2As shown, when extraction was performed using Triton X-100, MEGA10, or CHAPS as surfactants, PCR amplification products were confirmed at pH 7–10, indicating that the extracted DNA polymerase maintained its activity. Furthermore, when extraction was performed using lauryltrimethylammonium chloride, PCR amplification products were confirmed at pH 7, indicating that the extracted DNA polymerase maintained its activity. On the other hand, when extraction was performed using SDS or dodecanesulfonic acid as surfactants, no PCR amplification products were confirmed, and the extracted DNA polymerase lost its activity. Therefore, it can be concluded that when extraction was performed using Triton X-100, MEGA10, or CHAPS at pH 7–10, or when extraction was performed using lauryltrimethylammonium chloride at pH 7, the enzyme was extracted while maintaining its activity. It should be noted that… Figure 2 The results were obtained using 0.1M Tris-HCl with the pH adjusted to 7, 8, 9, or 10 in the preparation of the enzyme reaction solution described above. However, the same band was detected when using 0.6M Tris-HCl as when using 0.1M Tris-HCl.

[0140] The above results confirm that by directly using the enzyme reaction solution obtained by the method described in this application in the PCR reaction as an enzyme, it can directly react with the substrate to generate enzyme reaction products.

[0141] [Example 2] Extraction of enzymes (phosphorylase: kinase) from Escherichia coli (1) Referring to the method for preparing the enzyme reaction solution in Example 1, the kinase was extracted from *E. coli* expressing the kinase without disrupting the *E. coli*, and the enzyme reaction solution was prepared. This method is described below.

[0142] A plasmid was prepared by integrating a polynucleotide encoding ECadk (Sequence No. 8), a phosphorylase (adenosine monophosphate kinase) derived from *E. coli*, or a polynucleotide encoding ECpykF (Sequence No. 9), a phosphorylase (pyruvate kinase) derived from *E. coli*, into the psrlAp-eEmRFP plasmid (Nakamura et al., Molecular Biotechnology volume 60, 912-923 (2018)) to replace eEmRFP. Then, the plasmid was added to *E. coli* and transformed using the same method as in Example 1. The transformed *E. coli* was then cultured in AB medium using the same method as in Example 1.

[0143] Next, 5 mL of the extract obtained by adding a surfactant (Triton X-100) to 0.1 M Tris-HCl (pH adjusted to 9) at a final concentration of 1% (v / v) was resuspended, and an enzyme reaction solution was prepared using the same method as in Example 1. The SDS-PAGE results of the obtained enzyme reaction solution are shown below. Figure 3 Bands were observed at positions corresponding to the molecular weights of ECadk or ECpykF, confirming that Ecadk or ECpykF can be extracted without damaging or lysing E. coli.

[0144] The enzyme activities of phosphorylase ECadk and phosphorylase ECpykF in the obtained enzyme reaction solution are demonstrated by the PCR-based reactants obtained in the examples described later.

[0145] [Example 3] Extraction of enzyme (phosphorylase) from yeast Example 2 demonstrated the extraction of ECadk and ECpykF enzymes from E. coli. Next, in order to synthesize dAMP from dAd, the ScADO1 enzyme was extracted from yeast.

[0146] (Cultivation of yeast expressing phosphorylase) Using yeast (Saccharomyces cerevisiae) as the host, transformation was performed using the following method. A plasmid containing ScADO1 was prepared by integrating a polynucleotide (sequence number 10) encoding the Saccharomyces cerevisiae phosphorylase ScADO1 into the YHp plasmid (Misumi et al., YeastVolume36, Issue 5 Special Issue: May 2019, pp. 249-257) to replace yEmRFP.

[0147] The plasmid containing ScADO1 was added to 30 μL of competent yeast cells, and the cells were transformed by heating at 42°C for approximately 30 minutes. Then, 100 μL of sterile water was added, and the transformed yeast was inoculated into uracil-deficient synthetic medium, spread evenly using beads, and cultured at 30°C for 3 days. Colonies were scraped and inoculated into 50 mL of YPD medium in a 250 mL Erlenmeyer flask with a baffle, and cultured with shaking at 30°C for 1 day. Next, 5 mL of the extract was suspended in 0.1 M Tris-HCl (pH adjusted to 9) with a surfactant (Triton X-100) at a final concentration of 1%, and incubated at 30°C for 1 day to extract ScADO1. The extract was then centrifuged at 12000 rpm for approximately 5 minutes, and the supernatant was used as the enzyme reaction solution (pH 9) for the SDS-PAGE and enzyme reaction described later. The results of the SDS-PAGE of the enzyme reaction solution are shown below. Figure 4 Enzyme reaction solutions prepared from two different clones were loaded into individual lanes. A band was observed at a position corresponding to the molecular weight of ScADO1, confirming that ScADO1 could be extracted without damaging or lysing the yeast. The enzyme activity of the phosphorylase ScADO1 in the resulting enzyme reaction solution is shown in the examples described later. It should be noted that the yeast cell walls were not ruptured or lysed due to the above-described surfactant treatment.

[0148] [Example 4] Activity of the extracted enzyme (phosphorylase) (1) The phosphorylases ECadk and ECpykF extracted in Example 2 and the phosphorylase ScADO1 extracted in Example 3 were used as enzyme reaction solutions to investigate the reaction from deoxyadenosine (dAd) to deoxyadenosine triphosphate (dATP). It should be noted that the above-described reaction from deoxyadenosine (dAd) to deoxyadenosine triphosphate (dATP) is schematically illustrated in [the diagram]. Figure 5 .

[0149] Add the following substances to a 1.5 mL container and react at 30 °C for about 2 hours using a one-pot method to synthesize dATP and prepare a dATP solution.

[0150] 1M Tris-HCl pH8 2μL 0.5M KCl 2μL 100mM MgCl2 2μL 300mM PEP (phosphoenolpyruvate) 2μL 1mM dATP 2μL 100mM dAd 2μL 2 μL of the enzyme reaction solution (ScADO1: pH 9) prepared in Example 3 The enzyme reaction solution (ECadk: pH 9, 2 μL) prepared in Example 2 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution.

[0151] 0.2 μL of the enzyme reaction solution (Pfu: pH 9) prepared in Example 1 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dATP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dGTP (10mM) 0.5μL dCTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The PCR reaction was performed in 30 cycles at 98°C for 5 seconds and 68°C for 5 seconds. The pAmp-srlAp-eEGFP plasmid was used as template DNA, and eEGFP+1 (35) (Sequence No. 6) was used as the forward primer, and eEGFP+711c (35) (Sequence No. 7) was used as the reverse primer to amplify a 711 bp polynucleotide encoding EGFP. If the DNA could be amplified by PCR, then the added dATP solution contained dATP, meaning that the phosphorylases ECadk and ECpykF extracted in Example 2 and the phosphorylase ScADO1 extracted in Example 3 had enzymatic activity. It should be noted that in the dATP synthesis reaction, an initial concentration of 0.1 mM of dATP was added to initiate the reaction. Furthermore, since the initial concentration of dATP was 0.1 mM, and 0.5 μL of the dATP synthesis reaction solution was added to a total 10 μL PCR reaction solution, the initial concentration of added dATP was 0.005 mM. The concentration of each dNTP required for PCR is about 0.5 mM. Therefore, it can be said that the PCR reaction can proceed not because of the initial addition of dATP, but because of the dATP synthesized from 10 mM dAd as a substrate.

[0152] The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 6 . Figure 6 In the image, the left lane contains molecular weight markers, and the right lane contains the lane where PCR amplification products have been loaded. Figure 6 It was found that PCR amplification products were obtained, confirming that the phosphorylases ECadk and ECpykF extracted in Example 2 and the phosphorylase ScADO1 extracted in Example 3 possessed enzyme activity. Therefore, it is evident that, according to the method for preparing the above-mentioned enzyme reaction solution, enzymes can be extracted from bacteria and yeast while maintaining their enzyme activity; and, even without purification to remove impurities from the enzyme reaction solution, it can be directly mixed as an enzyme and reacted using a one-pot method to synthesize ATP or dATP.

[0153] It should be noted that the enzyme reaction solution described above was prepared without the previous methods of crushing and lysing. Therefore, the obtained enzyme can be used directly for enzyme reactions without purification. Furthermore, using the enzyme extraction solution directly for enzyme reactions simplifies the process preceding the preparation of the enzyme reaction product, ATP or dATP, from the enzyme reaction solution in the synthesis of ATP or dATP.

[0154] [Example 5] Activity of the extracted enzyme (phosphorylase) (2) In Example 4, ECpykF was used. In contrast, ECpykA was used instead of ECpykF, and the pH and PEP conditions were further changed for analysis.

[0155] ECpykA was extracted using the same method as in Example 2. A plasmid was prepared by integrating a polynucleotide (serial number 11) encoding ECpykA, a phosphorylase (pyruvate kinase) derived from *E. coli*, into the psrlAp-eEmRFP plasmid (Nakamura et al., *Molecular Biotechnology*, volume 60, pp. 912-923 (2018)) to replace eEmRFP, and then utilized. MOPS was used as the buffer to maintain a pH of 6.0, PEP concentrations of 30 mM, 60 mM, and 90 mM, and reaction times of 1 hour or 24 hours.

[0156] Add the following substances to a 1.5 mL container and react at 30°C for about 1 or 2 hours using a one-pot method to synthesize dATP and prepare a dATP solution.

[0157] 1M MOPS pH6.0 2μL 0.5M KCl 2μL 100mM MgCl2 2μL 300, 600, or 900 mM PEP (phosphoenolpyruvate) 2 μL 1mM dATP 2μL 100mM dAd 2μL 2 μL of the enzyme reaction solution (ScADO1: pH 9) prepared in Example 4 2 μL of the enzyme reaction solution (ECadk: pH 9) prepared in Example 3 2 μL of the enzyme reaction solution (ECpykA: pH 9) prepared in Example 5 2 μL of distilled water Total 20μL The PCR reaction was performed in the same manner as in Example 4. The resulting PCR reaction solution was diluted to 1 / 2, 1 / 4, and 1 / 8, and then subjected to agarose gel electrophoresis along with the undiluted solution. The results of agarose gel electrophoresis after a 24-hour reaction are shown below. Figure 7 .

[0158] like Figure 7 As shown, even when ECpykA was used instead of ECpykF, PCR amplification products were still obtained, confirming that the phosphorylase ECadk extracted in Example 2, the phosphorylase ECpykA extracted in this example, and the phosphorylase ScADO1 extracted in Example 3 possessed enzymatic activity. Furthermore, when 6-fold or 9-fold PEP was added relative to dAd, the bands were darker compared to when 3-fold PEP was added, confirming that for dATP synthesis, a PEP-to-dAd concentration ratio of 6-9 is preferred.

[0159] In addition, the concentration of dATP in the obtained dATP solution was investigated using an AKTA starter (Cytiva). First, 1 mL of a standard (a 1 / 10 dilution of 10 mM dAd, 10 mM dAMP, or 10 mM dATP) was loaded into a QHP column. Initially, the column was washed with water, followed by gradient elution from T1 (0–0.3 M NH4HCO3). The position, height, and area of ​​the peak in the standard were then confirmed as baseline values. Next, the dATP solution to be measured was loaded into the QHP column in the same manner and eluted. The concentration of dATP in the dATP solution was determined based on the peak position, height, and area. The results of investigating the concentration of dATP in dATP solutions obtained by reacting at 60 mM or 90 mM PEP for 1 hour or 24 hours using the above method are shown below. Figure 8 , 9 middle.

[0160] according to Figure 8 The concentrations of dATP in the solutions obtained by reacting PEP at 60 mM for 1 hour and 24 hours were 6.5 mM and 8.4 mM, respectively. Furthermore, according to... Figure 9 The concentrations of dATP in the solutions obtained by reacting with PEP at 90 mM for 1 hour or 24 hours were 5.2 mM and 8.4 mM, respectively. The initial concentration of dAd was 10 mM. This confirms that dATP was obtained with 84% reaction rate when the enzyme reaction was carried out from dAd at 60 mM or 90 mM PEP for 24 hours.

[0161] [Example 6] Extraction of enzymes (phosphorylase: kinase) from Escherichia coli (2) In Example 2, referring to the method for preparing the enzyme reaction solution in Example 1, the kinase was extracted from *Escherichia coli* expressing adenosine monophosphate kinase (ECadk) without disrupting the *E. coli*, and the enzyme reaction solution was prepared. Here, ECcmk, ECgmk, and ECtmk were extracted and the enzyme reaction solution was prepared using the same method as described above. The method will be described below.

[0162] A plasmid was prepared by integrating a polynucleotide encoding ECcmk (Sequence No. 12), a polynucleotide encoding ECgmk (Guanine-1-phosphokinase / Guanine kinase), a polynucleotide encoding ECtmk (Thymidine-1-phosphokinase / Thymidine kinase), or a polynucleotide encoding ECpykF (Pyruvate kinase), a polynucleotide encoding ECtmk (Thymidine-1-phosphokinase), a polynucleotide encoding ECpykF (Pyruvate kinase), a polynucleotide encoding ECpF (Thyruvate kinase), a polynucleotide encoding ECtmk (Thymidine-1-phosphokinase), a polynucleotide encoding ECpF (Pyruvate kinase), a polynucleotide encoding ECpF (Pyruvate kinase), a polynucleotide encoding ECpF (Pyruvate kinase), a polynucleotide encoding ECtmk (Thymidine ...tmk (Thymidine kinase), a polynucleotide encoding ECtmk (Thymidine kinase), a polynucleotide encoding ECtmk (Thymidine kinase), a polynucleotide encoding ECtm

[0163] Next, 5 mL of the extract obtained by adding a surfactant (Triton X-100) to 0.1 M Tris-HCl (pH adjusted to 9) at a final concentration of 1% (v / v) was resuspended, and an enzyme reaction solution was prepared using the same method as in Example 1. The SDS-PAGE results of the obtained enzyme reaction solution are shown below. Figure 10Bands were observed at positions corresponding to the molecular weights of ECcmk, ECgmk, or ECtmk, confirming that ECcmk, ECgmk, or ECtmk can be extracted without damaging or lysing E. coli.

[0164] The enzyme activity of phosphorylases ECcmk, ECgmk, or ECtmk in the obtained enzyme reaction solution is demonstrated by the PCR-based reactants obtained in the examples described later.

[0165] [Example 7] Synthesis of dNMP to dNTP based on the extracted enzyme (phosphatase) <1> Synthesis from dAMP to dATP The phosphorylases ECadk and ECpykF extracted in Example 2 were used as enzyme reaction solutions to investigate the reaction from deoxyadenosine monophosphate (dAMP) to deoxyadenosine triphosphate (dATP). This reaction is... Figure 5 The process involves two stages: the synthesis of dAMP into dADP and the synthesis of dADP into dATP.

[0166] Add the following substances to a 1.5 mL container and react at 30 °C for about 2 hours using a one-pot method to synthesize dATP and prepare a dATP solution.

[0167] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 4μL (final concentration 25mM) 1mM dATP 2μL (final concentration 0.1mM) 100mM dAMP 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ECadk: pH 9) prepared in Example 2 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution.

[0168] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dATP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dGTP (10mM) 0.5μL dCTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The PCR reaction was performed in 30 cycles at 98°C for 5 seconds and 60°C for 5 seconds. As template DNA, a plasmid was obtained by replacing eEmRFP with a plasmid obtained by integrating eEGFP into pAmp-srlAp-eEmRFP (Nakamura et al., Molecular Biotechnology volume 60, pp. 912-923 (2018)). A 711 bp polynucleotide encoding EGFP was amplified using eEGFP+1 (35) (Sequence No. 6) as the forward primer and eEGFP+711c (35) (Sequence No. 7) as the reverse primer. If the DNA could be amplified by PCR, the added dATP solution contained dATP, meaning that the phosphorylases ECadk and ECpykF extracted in Example 2 had enzymatic activity. It should be noted that in the dATP synthesis reaction, an initial concentration of 0.1 mM of dATP was added to initiate the reaction. Furthermore, since the initial concentration of dATP was 0.1 mM, and 0.5 μL of dATP synthesis reaction solution was added to the total 10 μL PCR reaction solution, the initial concentration of added dATP was 0.005 mM. The concentrations of the individual dNTPs required for PCR are approximately 0.5 mM. Therefore, it can be said that the PCR reaction proceeds not because of the initially added dATP, but because of the dATP synthesized from the 10 mM dAMP substrate.

[0169] The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 11 . Figure 11 In the diagram, the left lane is labeled with molecular weight markers, and the right lane contains the lanes for PCR amplification products (dATP reaction solution), distilled water (DW), and 10 mM dATP as a standard. Figure 11It was also observed that PCR amplification products were obtained, confirming that the phosphorylases ECadk and ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dATP was synthesized from dAMP.

[0170] <2> Synthesis from dGMP to dGTP In (1) above, the synthesis of dATP from dAMP was carried out. In contrast, it was investigated whether dGTP could be synthesized from dGMP.

[0171] The reaction from deoxyguanosine monophosphate (dGMP) to deoxyguanosine triphosphate (dGTP) was investigated using ECgmk, a phosphorylase (guanosine monophosphate kinase) extracted in Example 6, and ECpykF, a phosphorylase extracted in Example 2, as enzyme reaction solutions.

[0172] Add the following substances to a 1.5 mL container and react them at 30 °C for about 2 hours using a one-pot method to synthesize dGTP and prepare a dGTP solution.

[0173] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 4μL (final concentration 25mM) 1 mM dGTP 2 μL (final concentration 0.1 mM) 100mM dGMP 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ECgmk: pH 9) prepared in Example 6 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution.

[0174] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dGTP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dATP (10mM) 0.5μL dCTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The PCR reaction is the same as described above in this embodiment. <1> The method described in the synthesis of dAMP to dATP is the same.

[0175] The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 12 . Figure 12 In the image, the left lane contains molecular weight markers, and the right lane contains the lane where PCR amplification products have been loaded. Figure 12 It was found that PCR amplification products were obtained, confirming that the phosphorylase ECgmk extracted in Example 6 and ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dGTP was synthesized from dGMP.

[0176] <3> Synthesis from dTMP to dTTP In (1) above, the synthesis of dATP from dAMP was carried out. In contrast, it was investigated whether dTTP could be synthesized from dTMP.

[0177] The reaction from deoxythymidine monophosphate (dTMP) to deoxythymidine triphosphate (dTTP) was investigated using ECtmk, a phosphorylase (thymidine monophosphate kinase) extracted in Example 6, and ECpykF, a phosphorylase extracted in Example 2, as enzyme reaction solutions.

[0178] Add the following substances to a 1.5 mL container and react them at 30 °C for about 2 hours using a one-pot method to synthesize dTTP and prepare a dTTP solution.

[0179] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 4μL (final concentration 25mM) 1mM dTTP 2μL (final concentration 0.1mM) 100mM dTMP 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ECtmk: pH 9) prepared in Example 6 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution.

[0180] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dTTP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dATP (10mM) 0.5μL dCTP (10mM) 0.5μL dGTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The PCR reaction is the same as described above in this embodiment. <1> The method described in the synthesis of dAMP to dATP is the same.

[0181] The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 13 . Figure 13 In the image, the left lane contains molecular weight markers, and the right lane contains the lane where PCR amplification products have been loaded. Figure 13 It was found that PCR amplification products were obtained, confirming that the phosphorylase ECtmk extracted in Example 6 and ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dTTP was synthesized from dTMP.

[0182] <4> Synthesis from dCMP to dCTP In (1) above, the synthesis of dATP from dAMP was carried out. In contrast, it was investigated whether dCTP could be synthesized from dCMP.

[0183] Using ECcmk, a phosphorylase (cytidine monophosphate kinase) extracted in Example 6, and ECpykF, a phosphorylase extracted in Example 2, as enzyme reaction solutions, the reaction from deoxycytidine monophosphate (dCMP) to deoxycytidine triphosphate (dCTP) was investigated.

[0184] Add the following substances to a 1.5 mL container and react them at 30 °C for about 2 hours using a one-pot method to synthesize dCTP and prepare a dCTP solution.

[0185] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 4μL (final concentration 25mM) 1mM dCTP 2μL (final concentration 0.1mM) 100mM dCMP 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ECcmk: pH 9) prepared in Example 6 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution.

[0186] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dCTP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dATP (10mM) 0.5μL dGTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The PCR reaction is the same as described above in this embodiment. <1> The method described in the synthesis of dAMP to dATP is the same.

[0187] The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 14 . Figure 14 In the image, the left lane contains molecular weight markers, and the right lane contains the lane where PCR amplification products have been loaded. Figure 14 It was found that PCR amplification products were obtained, confirming that the phosphorylase ECcmk extracted in Example 6 and ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dCTP was synthesized from dCMP.

[0188] [Example 8] Extraction of enzymes (phosphorylase: kinase) from yeast (2) Example 2 involved the extraction of ECadk as a phosphorylase (adenosine monophosphate kinase) and ECpykF as a phosphorylase (pyruvate kinase) from *E. coli*. Next, extraction of phosphorylases (adenosine monophosphate kinase) and phosphorylases (pyruvate kinase) from yeast was attempted.

[0189] Using yeast (Saccharomyces cerevisiae) as the host, transformation was performed using the following methods. A plasmid containing ScADK1 was prepared by integrating a polynucleotide (Sequence No. 15) encoding ScADK1, a phosphorylase (adenosine monophosphate kinase) of Saccharomyces cerevisiae, into the YHp plasmid (Misumiet al., Yeast Volume 36, Issue 5 Special Issue: May 2019, pp. 249-257) to replace yEmRFP. A plasmid containing ScADK1 was also prepared by integrating a polynucleotide (Sequence No. 16) encoding ScCDC19, a phosphorylase (pyruvate kinase) of Saccharomyces cerevisiae, into the aforementioned YHp plasmid to replace yEmRFP.

[0190] Add the plasmid containing ScADK1 or ScCDC19 to 30 μL of competent yeast cells and treat at 42°C for approximately 30 minutes on a heating module to induce transformation. Then add 100 μL of sterile water and inoculate the transformed yeast into uracil-deficient synthetic medium, spreading it evenly with beads and incubating at 30°C for 3 days. Scrape off the grown colonies and inoculate them into 10 mL of YPD medium in a 125 mL Erlenmeyer flask with a baffle, and incubate at 30°C with shaking for 1 day. Next, suspend the yeast in 5 mL of the extract obtained by adding surfactant (Triton X-100) to 0.1 M Tris-HCl (pH adjusted to 8 for ScADK1 extraction) or 0.1 M Tris-HCl (pH adjusted to 9 for ScCDC19 extraction) at a final concentration of 1%, and incubate at 30°C for 1 day to extract ScADK1 or ScCDC19. Then, centrifuge at 12000 rpm for approximately 5 minutes, and use the supernatant as the enzyme reaction solution for SDS-PAGE and the enzyme reaction described later. The SDS-PAGE results of the obtained enzyme reaction solution are shown below. Figure 15Bands were observed at molecular weights comparable to ScADK1 and ScCDC19, confirming that ScADK1 and ScCDC19 can be extracted without damaging or lysing the yeast. It should be noted that the yeast cell walls did not rupture or lyse due to the aforementioned surfactant treatment.

[0191] The reaction solution of ScADK1 enzyme and ScCDC19 enzyme extracted above was used to investigate the reaction from deoxyadenosine monophosphate (dAMP) to deoxyadenosine triphosphate (dATP). It should be noted that ScADK is deoxyadenosine monophosphate kinase, and ScCDC19 is pyruvate kinase.

[0192] Add the following substances to a 1.5 mL container and react at 30 °C for about one day using a one-pot method to synthesize dATP and prepare a dATP solution.

[0193] 1M Tris-HCl pH8 2μL 2.0M KCl 2μL 100mM MgCl2 2μL 250mM PEP (phosphoenolpyruvate) 4μL 1mM dATP 2μL 100mM dAMP 2μL The enzyme reaction solution (ScADK1) prepared above: pH 8, 2 μL The enzyme reaction solution (ScCDC19) prepared above: pH 9, 2 μL 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution.

[0194] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dATP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dGTP (10mM) 0.5μL dTTP (10mM) 0.5μL dCTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The PCR reaction was the same as in Example 7. <1> The method described in the synthesis of dAMP to dATP is the same.

[0195] The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 16 .Depend on Figure 16 It was found that PCR amplification products were obtained, confirming that the phosphorylases ScADK1 and ScCDC19 extracted from yeast in this embodiment possessed enzymatic activity. Furthermore, it was confirmed that dATP was synthesized from dAMP.

[0196] [Example 9] Extraction of enzymes (phosphorylase: kinase) from Escherichia coli (3) In Example 2, referring to the method for preparing the enzyme reaction solution in Example 1, the kinase was extracted from *E. coli* expressing kinase ECadk without disrupting the *E. coli*, and the enzyme reaction solution was prepared. Here, ECgsk (as guanosine monophosphate kinase), ECtdk (as cytidine monophosphate kinase), and ECudk (as thymidine monophosphate kinase) were extracted using the same method as described above, and the enzyme reaction solution was prepared. The method will be described below.

[0197] A plasmid was prepared by integrating polynucleotides encoding ECgsk (serum 17), a phosphorylase (thymidine kinase) derived from *E. coli*, and ECudk (serum 19), a phosphorylase (uridine kinase) derived from *E. coli*, into the psrlAp-eEmRFP plasmid (Nakamura et al., *Molecular Biotechnology*, volume 60, pp. 912-923 (2018)) to replace eEmRFP. Then, the plasmids were added to *E. coli* and transformed using the same method as in Example 1. The transformed *E. coli* were then cultured in AB medium using the same method as in Example 1.

[0198] Next, 5 mL of the extract obtained by adding a surfactant (Triton X-100) to 0.1 M Tris-HCl (pH adjusted to 9) at a final concentration of 1% (v / v) was resuspended, and an enzyme reaction solution was prepared using the same method as in Example 1. The SDS-PAGE results of the obtained enzyme reaction solution are shown below. Figure 17Bands were observed at molecular weights equivalent to ECgsk, ECtdk, and ECudk, confirming that ECgsk, ECtdk, and ECudk can be extracted without damaging or lysing E. coli.

[0199] [Example 10] Activity of the extracted enzyme (phosphorylase) (3) The synthesis of dNMP to dNTP was confirmed in Example 8. Therefore, the synthesis of dN to dNTP was further investigated.

[0200] <1> Synthesis from dA to dATP The phosphorylase ScADO1 extracted in Example 3 and the phosphorylases ECadk and ECpykF extracted in Example 2 were used as enzyme reaction solutions to investigate the reaction from deoxyadenosine (dA) to deoxyadenosine triphosphate (dATP).

[0201] Add the following substances to a 1.5 mL container and react at 30 °C for about 2 hours using a one-pot method to synthesize dATP and prepare a dATP solution.

[0202] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 2μL (final concentration 25mM) 1mM dATP 2μL (final concentration 0.1mM) 100mM dA 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ScADO1: pH 9) prepared in Example 3 The enzyme reaction solution (ECadk: pH 9, 2 μL) prepared in Example 2 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution. Furthermore, the PCR reaction was the same as in Example 7. <1> The method described in the synthesis of dAMP to dATP is the same.

[0203] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dATP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dGTP (10mM) 0.5μL dCTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 18 . Figure 18 In the diagram, the left lane is labeled with molecular weight markers, and the right lane contains the lanes for PCR amplification products (dATP reaction solution), distilled water (DW), and 10 mM dATP as a standard. Figure 18 It was also observed that PCR amplification products were obtained, confirming that the phosphorylase ScADO1 extracted in Example 3, and the phosphorylases ECadk and ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dATP was synthesized from dA.

[0204] <2> Synthesis from dG to dGTP The phosphorylase ECgsk extracted in Example 9, the phosphorylase ECgmk extracted in Example 6, and the phosphorylase ECpykF extracted in Example 2 were used as enzyme reaction solutions to investigate the reaction from deoxyguanosine (dG) to deoxyguanosine triphosphate (dGTP).

[0205] Add the following substances to a 1.5 mL container and react them at 30 °C for about 2 hours using a one-pot method to synthesize dGTP and prepare a dGTP solution.

[0206] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 2μL (final concentration 25mM) 1 mM dGTP 2 μL (final concentration 0.1 mM) 100mM dG 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ECgsk: pH 9) prepared in Example 9 2 μL of the enzyme reaction solution (ECgmk: pH 9) prepared in Example 6 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution. Furthermore, the PCR reaction was the same as in Example 7. <1> The method described in the synthesis of dAMP to dATP is the same.

[0207] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dGTP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dATP (10mM) 0.5μL dCTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 19 . Figure 19 In the image, the left lane is labeled with molecular weight markers, and the right lane contains the lanes for PCR amplification products (dGTP reaction solution), distilled water (DW), and 10 mM dGTP as a standard. Figure 19 It was also observed that PCR amplification products were obtained, confirming that the phosphorylase ECgsk extracted in Example 9, the phosphorylase ECgmk extracted in Example 6, and the phosphorylase ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dGTP was synthesized from dG.

[0208] <3> Synthesis from dT to dTTP The phosphorylase ECtdk extracted in Example 9, the phosphorylase ECtmk extracted in Example 6, and the phosphorylase ECpykF extracted in Example 2 were used as enzyme reaction solutions to investigate the reaction from deoxythymidine (dT) to deoxythymidine triphosphate (dTTP).

[0209] Add the following substances to a 1.5 mL container and react them at 30 °C for about 2 hours using a one-pot method to synthesize dTTP and prepare a dTTP solution.

[0210] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 2μL (final concentration 25mM) 1mM dTTP 2μL (final concentration 0.1mM) 100mM dT 2μL (final concentration 10mM) 2 μL of the enzyme reaction solution (ECtdk: pH 9) prepared in Example 9 2 μL of the enzyme reaction solution (ECtmk: pH 9) prepared in Example 6 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution. Furthermore, the PCR reaction was the same as in Example 7. <1> The method described in the synthesis of dAMP to dATP is the same.

[0211] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dTTP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dATP (10mM) 0.5μL dCTP (10mM) 0.5μL dGTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 20 . Figure 20In the image, the left lane shows the molecular weight marker, and the right lane contains the lanes for PCR amplification products (dTTP reaction solution), distilled water (DW), and 10 mM dTTP as a standard. Figure 20 It was also observed that PCR amplification products were obtained, confirming that the phosphorylase ECtdk extracted in Example 9, the phosphorylase ECtmk extracted in Example 6, and the phosphorylase ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dTTP was synthesized from dT.

[0212] <4> Synthesis from dC to dCTP The phosphorylase ECudk extracted in Example 9, the phosphorylase ECcmk extracted in Example 6, and the phosphorylase ECpykF extracted in Example 2 were used as enzyme reaction solutions to investigate the reaction from deoxycytidine (dC) to deoxycytidine triphosphate (dCTP).

[0213] Add the following substances to a 1.5 mL container and react them at 30 °C for about 2 hours using a one-pot method to synthesize dCTP and prepare a dCTP solution.

[0214] 1M Tris-HCl pH8 2μL (final concentration 100mM) 0.5M KCl 2μL (final concentration 50mM) 125mM MgCl2 2μL (final concentration 12.5mM) 250mM PEP (phosphoenolpyruvate) 2μL (final concentration 25mM) 1mM dCTP 2μL (final concentration 0.1mM) 100mM dC 2μL (final concentration 10mM) The enzyme reaction solution (ECudk: pH 9) prepared in Example 9, 2 μL 2 μL of the enzyme reaction solution (ECcmk: pH 9) prepared in Example 6 2 μL of the enzyme reaction solution (ECpykF: pH 9) prepared in Example 2 2 μL of distilled water Total 20μL Next, PCR was performed using the following reaction solution. Furthermore, the PCR reaction was the same as in Example 7. <1> The method described in the synthesis of dAMP to dATP is the same.

[0215] Helix DNA polymerase (Helix Extension) 0.2 μL 1M Tris-HCl pH 8.5 1.5μL 0.5 μL of the above dCTP solution Template DNA (1 ng / μL) 1.0 μL Forward primer (10 μM) 0.5 μL Reverse primer (10 μM) 0.5 μL MgSO4 (50mM) 0.5μL dATP (10mM) 0.5μL dGTP (10mM) 0.5μL dTTP (10mM) 0.5μL 3.8 μL of distilled water Total 10.0 μL The results of confirming the PCR amplification products by agarose gel electrophoresis are shown below. Figure 21 . Figure 21 In the image, the left lane is labeled with molecular weight markers, and the right lane contains lanes loaded with PCR amplification products (dCTP reaction solution), lanes loaded with distilled water (DW), and lanes loaded with 10 mM dCTP as a standard. Figure 21 It was also observed that PCR amplification products were obtained, confirming that the phosphorylase ECudk extracted in Example 9, the phosphorylase ECcmk extracted in Example 6, and the phosphorylase ECpykF extracted in Example 2 possessed enzymatic activity. Furthermore, it was confirmed that dCTP was synthesized from dC.

[0216] All patent and non-patent documents referenced in this specification are incorporated herein by reference in their entirety.

Claims

1. A method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleosides or ribonucleosides from ribonucleosides, said method being characterized in that a reaction solution is prepared by adding the following (i) to (iii) into a reaction vessel, and the reaction is carried out in a one-pot manner: (i) Deoxyribonucleoside or ribonucleoside as starting material; (ii) as an enzyme Nucleoside kinases capable of generating deoxyribonucleoside monophosphate from said deoxyribonucleoside or ribonucleoside monophosphate from said ribonucleoside. Nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate from said deoxyribonucleoside monophosphate or ribonucleoside diphosphate from said ribonucleoside monophosphate, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

2. The method as described in claim 1, characterized in that, In the reaction solution at the start of the reaction, the concentration ratio of phosphoenolpyruvate (PEP) to the deoxyribonucleoside or the ribonucleoside (PEP / deoxyribonucleoside or ribonucleoside) is 3.0 or higher.

3. The method as described in claim 1 or 2, characterized in that, At the start of the reaction, the concentration ratio of the deoxyribonucleoside triphosphate (dNTP) or ribonucleoside triphosphate (NTP) to the deoxyribonucleoside or ribonucleoside (dNTP or NTP / deoxyribonucleoside or ribonucleoside) in the reaction solution is less than 0.

5.

4. The method according to any one of claims 1 to 3, characterized in that, The nucleoside kinase, the nucleoside monophosphate kinase, and the pyruvate kinase are derived from yeast or bacteria.

5. The method according to any one of claims 1 to 4, characterized in that, The reaction time is 0.1 to 24 hours.

6. The method according to any one of claims 1 to 5, characterized in that, The enzyme reaction solution obtained by the following method can be used directly as the enzyme, wherein the enzyme is prepared by extracting the enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside kinase, nucleoside monophosphate kinase, and pyruvate kinase while maintaining the enzyme activity. The method includes treating the bacteria or yeast at 4-95°C for 0.1 hours to 4 days with an enzyme extract containing 0-3% nonionic or amphoteric surfactants in a 0.01-1.0M buffer solution, with the pH adjusted to 6-11. The method does not include the process of lysing or breaking down the bacteria or yeast.

7. The method according to any one of claims 1 to 6, characterized in that, Use deoxyadenosine or adenosine as the starting material. Adenosine kinase, adenosine monophosphate kinase, and pyruvate kinase were used as enzymes. The adenosine kinase is a yeast-derived adenosine kinase, and the adenosine monophosphate kinase is a yeast- or bacterial-derived adenosine kinase.

8. A method for synthesizing deoxyribonucleoside triphosphate (dNTP) from deoxyribonucleoside monophosphate or ribonucleoside triphosphate (NTP), characterized in that a reaction solution is prepared by adding the following (i) to (iii) into a reaction vessel, and the reaction is carried out in a one-pot manner: (i) Deoxyribonucleoside monophosphate or ribonucleoside monophosphate as starting material; (ii) as an enzyme Nucleoside monophosphate kinases capable of generating deoxyribonucleoside diphosphate from said deoxyribonucleoside monophosphate or ribonucleoside diphosphate, and Pyruvate kinase; and (iii) Phosphoenolpyruvate (PEP) as a phosphate donor, and nucleoside triphosphate or deoxynucleoside triphosphate.

9. The method as described in claim 8, characterized in that, The enzyme reaction solution obtained by the following method can be used directly as the enzyme, wherein the enzyme is prepared by extracting the enzyme from bacteria or yeast expressing at least one enzyme selected from nucleoside monophosphate kinase and pyruvate kinase while maintaining the enzyme activity. The method includes treating the bacteria or yeast at 4-95°C for 0.1 hours to 4 days with an enzyme extract containing 0-3% nonionic or amphoteric surfactants in a 0.01-1.0M buffer solution, with the pH adjusted to 6-11. The method does not include the process of lysing or breaking down the bacteria or yeast.

Citation Information

Patent Citations

  • Process for producing adenosine 5'-triphosphate and use thereof

    WO1998048031A1