Aerosolizable RNA and uses thereof

Abstract

The application develops RNA, including siRNA or circRNA, which can be atomized and inhaled, is connected with special modified components, enhances the stability, cell absorption rate and targeting of the RNA, so that the RNA can be directly delivered to lung cells through atomization and inhalation without the protection of a delivery carrier such as a lipid nanoparticle, thereby treating lung-related diseases such as pneumonia, pulmonary fibrosis, chronic obstructive pulmonary disease and the like.

Description

Technical Field

[0001] This invention relates to the field of medical gene therapy technology, and more specifically, to the design, preparation, and use of atomized RNA. Background Technology

[0002] Gene therapy is a promising treatment approach that uses lipid nanoparticles or similar membranes to encapsulate various nucleic acids and deliver them to target cells for gene regulation and editing, thereby treating or preventing diseases. However, lipid nanoparticle membranes have various side effects such as lipotoxicity and immunogenicity, and long-term use can harm human health. Meanwhile, naked nucleic acids themselves are prone to degradation and poor absorption, making direct delivery into the body impossible. Summary of the Invention

[0003] To address at least one technical problem in the prior art, this invention develops an atomizable RNA, including siRNA or circRNA, which is linked to special modifying components to enhance RNA stability, cellular uptake, and targeting. This allows the RNA to be delivered directly to lung cells via atomization without the need for drug delivery carriers such as lipid nanoparticles, thereby treating lung-related diseases such as pneumonia, pulmonary fibrosis, and chronic obstructive pulmonary disease (COPD).

[0004] To achieve the above objectives, the technical solution provided in this application is as follows:

[0005] On one hand, the present invention provides RNA that can be atomized and inhaled, said RNA including siRNA and circRNA.

[0006] Preferably, the RNA further includes modifying components; the modifying components include one or more of chemical modifications, lipid modifications, peptide modifications, and glycan modifications.

[0007] In the above technical solution, the nebulizable RNA consists only of RNA and modified components. It can enter the trachea and alveoli of the lungs and be absorbed by the corresponding cells through nebulization without the need for encapsulation with materials such as lipid nanoparticles.

[0008] Preferably, the chemical modification includes: 2'-O-methylation (40%-80%), m6A modification (10%-30%), 2'-O-fluorination (20%-30%), or phosphorylation (5%-15%).

[0009] Preferably, the lipid modification includes PEG modification or cholesterol modification.

[0010] Preferably, the polypeptide modification includes: cationic peptide (including TAT peptide modification, R8 peptide modification, R9 peptide modification) or Penetratin peptide modification.

[0011] Preferably, the glycan modification includes: N-GlcNAc modification, mannitol modification, trehalose modification, glucose modification, cyclodextrin modification, or hyaluronic acid modification.

[0012] On the other hand, the present invention also provides a method for preparing the aforementioned atomizable inhalable RNA, comprising the following steps:

[0013] 1) Obtain RNA and activated modified components (containing carboxyl groups) through artificial synthesis;

[0014] 2) Use cross-linking agents and NHS to link RNA with activated modified components, wherein the cross-linking agents include EDC or DCC;

[0015] 3) Purify the modified RNA.

[0016] On the other hand, the present invention also provides the application of the aforementioned atomizable inhalable RNA in the prevention and / or treatment of lung-related diseases, including pneumonia, pulmonary fibrosis, or COPD.

[0017] On the other hand, the present invention provides a method for preparing atomized inhalable RNA.

[0018] 1) Obtain RNA and activated modification components through artificial synthesis;

[0019] 2) Use cross-linking agents and NHS to link RNA with activated modified components, wherein the cross-linking agents include EDC or DCC;

[0020] 3) Purify the modified RNA and then freeze or freeze-dry it for preservation.

[0021] On the other hand, the present invention also provides a method for using nebulized RNA inhalation.

[0022] The prepared RNA was dissolved in a protective solution and then atomized into particles with a diameter of 2–5 μm using an atomizer.

[0023] Preferably, the protective solution solvent includes PBS or physiological saline, and the solute includes one or more of hyaluronic acid, PEG-2000, mannitol, and glycerol.

[0024] Preferably, the concentration of hyaluronic acid is 0.1-1%, the concentration of PEG-2000 is 0.5-2%, the concentration of mannitol is 1-5%, and the concentration of glycerin is 1-5%.

[0025] Preferably, the specific dosage is as follows: RNA is inhaled into the lungs via nebulization, 1-10 mg of RNA each time, with a nebulized particle diameter of 2-5 μm, 1-2 times per day, and the treatment cycle is 1-6 months.

[0026] Preferably, the above-mentioned nebulized RNA can treat lung-related diseases, including but not limited to pneumonia, pulmonary fibrosis, and COPD.

[0027] In summary, the present invention has the following beneficial effects:

[0028] 1. This invention develops an RNA system that can be atomized and inhaled, including siRNA or circRNA, which does not require delivery by carriers such as lipid nanoparticles, nor does it require injection into the circulatory system, thus reducing side effects such as lipotoxicity and immunogenicity, and simplifying production and usage.

[0029] 2. The RNA of this invention is linked to special modifying components, which greatly enhances the stability, cell uptake rate and targeting of the RNA;

[0030] 3. The RNA of the present invention can treat a variety of lung-related diseases, including but not limited to pneumonia, pulmonary fibrosis, chronic obstructive pulmonary disease (COPD), etc.

[0031] 4. The RNA modification method of the present invention can be used on any siRNA or circRNA, not limited to the targets described in the present invention, thereby treating the lungs. Detailed Implementation

[0032] I. Preparation of atomized inhalable RNA

[0033] 1. RNA Acquisition

[0034] siRNA and circRNA are obtained through artificial synthesis.

[0035] The target of siRNA is one or more of CTHRC1, HMGB1, NLRP3, RAGE, Fli1, TNF-α, IL-8, IL-6, IL-11, IL-17, NF-κB, MMP-9, MMP-12, CXCR2, TGF-β, and PDGF.

[0036] The circRNA is one or more of circ_0004015, circ_0001649, circ_0004015, circHECTD1, circ_0001946, circ_0026344, circHIPK3, circFASN, circZNF652, circSOD2, circFOXO3, circANRIL, and circCCDC66.

[0037] 2. RNA modification

[0038] Modifying components include one or more of the following: chemical modification, lipid modification, peptide modification, and glycan modification.

[0039] Chemical modifications to RNA include 2'-O-methylation (40%-80%), m6A modification (10%-30%), 2'-O-fluorination (20%-30%), and phosphorylation (5%-15%). These modifications can be achieved artificially by using nucleotide substrates containing these modifications directly during RNA synthesis, with an amino group attached to both the 5' and 3' ends for easier subsequent modifications.

[0040] Lipid, peptide, and glycan modifications of RNA can be performed using cross-linking agents (EDC or DCC) and NHS. Add appropriate ratios of RNA and modification components to PBS buffer, followed by the cross-linking agent (EDC or DCC) and NHS; the molar ratio of RNA to cross-linking agent should be 1:1 to 1:3, and the concentration of the reaction system should be 1-10 μM; incubate the solution at room temperature for 1-4 hours. The three modifications should be performed sequentially and separately.

[0041] Lipid modifications of RNA include PEG modification (1-10% by mass) and cholesterol modification (1%-5% by mass).

[0042] Peptide modifications of RNA include cationic peptides (1%-10% by mass, including TAT peptide modification, R8 peptide modification, and R9 peptide modification) and pentetrin peptide modification (1%-5% by mass).

[0043] Glycan modifications of RNA include N-GlcNAc modification, mannitol modification, trehalose modification, glucose modification, cyclodextrin modification, hyaluronic acid modification, etc., with a mass ratio of 1%-5%.

[0044] 3. RNA purification

[0045] After the cross-linking reaction, the RNA was purified using methods such as silica gel column chromatography, column chromatography, RNA purification kits, polyacrylamide gel electrophoresis, or reversed-phase high-performance liquid chromatography to remove small molecule impurities. The purity and modification status of the RNA were then analyzed by spectrophotometry or mass spectrometry. Finally, the purified RNA was stored at -80℃ or lyophilized.

[0046] II. Treatment methods for nebulized RNA inhalation

[0047] The prepared RNA was dissolved in a protective solution, and atomized into particles with a diameter of 2-5 μm was sprayed using a nebulizer. The protective solution was prepared using PBS or physiological saline, and the solute was one or more of hyaluronic acid, PEG-2000, mannitol, and glycerol. The concentrations of hyaluronic acid, PEG-2000, mannitol, and glycerol were 0.1-1%, 0.5-2%, 1-5%, and 1-5%, respectively.

[0048] RNA is inhaled into the lungs via nebulization, 1-10 mg of RNA per dose, with nebulized particles of 2-5 μm in diameter, 1-2 times per dose, for a treatment period of 1-6 months.

[0049] Results analysis:

[0050] Example 1:

[0051] CTHRC1 siRNA was synthesized artificially, using a partially 2'-O-methylated nucleotide substrate to achieve 60% 2'-O-methylation in the siRNA, with an amino group linked at both the 5' and 3' ends. The siRNA and modification components were added to PBS buffer, followed by 3% PEG. EDC and NHS were then added; the molar ratio of RNA to EDC was 1:3, and the amounts of NHS and EDC were equal. The solution was then incubated at room temperature for 4 hours. Next, 4% TAT peptide was added, along with the same EDC and NHS, and the reaction was continued at room temperature for 4 hours. Finally, 1% hyaluronic acid was added, along with the same EDC and NHS, and the reaction was continued at room temperature for 4 hours. After the cross-linking reaction, the RNA was purified by column chromatography to remove small molecule impurities. Mass spectrometry analysis was used to determine the purity and modification status of the RNA. The purified RNA was then stored at -80°C.

[0052] Bleomycin was used to induce pulmonary fibrosis in mice. 2 mg / kg bleomycin was delivered to the lungs of mice via local intratracheal injection. Significant fibrosis was observed in the lungs of mice after one week, with a fibrotic area of ​​36.2%. RNA was dissolved in a protective solution containing 0.1% hyaluronic acid, 1% PEG-2000, 1% mannitol, and 1% glycerol. Mice were administered the drug via nebulizer, with a particle diameter of 2-5 μm, once daily for 4 weeks. Results showed that the fibrotic area in the lungs of mice decreased to 10.2%, improving fibrosis by 71.8%.

[0053] Comparative Example 1:

[0054] CTHRC1 siRNA was synthesized artificially and purified using column chromatography to remove small molecule impurities. The purity and modification status of the RNA were then analyzed by mass spectrometry. Finally, the purified RNA was stored at -80℃.

[0055] Bleomycin was used to induce pulmonary fibrosis in mice. 2 mg / kg bleomycin was delivered to the lungs of mice via local intratracheal injection. Significant fibrosis was observed in the lungs of mice after one week, with a fibrotic area of ​​36.2%. RNA was dissolved in a protective solution containing 0.1% hyaluronic acid, 1% PEG-2000, 1% mannitol, and 1% glycerol. Mice were administered the drug via nebulizer, with a particle diameter of 2-5 μm, once daily for 4 weeks. Results showed that the fibrotic area in the lungs of mice decreased to 32.4%, representing an improvement of 10.5% in fibrosis.

[0056] Example 2:

[0057] circ_0001649 was obtained through artificial synthesis. During the synthesis, a partially 2'-O-methylated nucleotide substrate was used, resulting in 40% 2'-O-methylation, with an amino group linked at both the 5' and 3' ends. circ_0001649 and the modified components were added to PBS buffer, along with 3% PEG by mass. EDC and NHS were then added; the molar ratio of RNA to EDC was 1:3, and the amounts of NHS and EDC were equal. The solution was then incubated at room temperature for 4 hours. Next, 2% Penetratin peptide was added, along with the same EDC and NHS, and the reaction was continued at room temperature for 4 hours. Finally, 2% hyaluronic acid was added, along with the same EDC and NHS, and the reaction was continued at room temperature for 4 hours. After the cross-linking reaction, the RNA was purified by column chromatography to remove small molecule impurities. The purity and modification status of the RNA were analyzed by mass spectrometry. The purified RNA was then stored at -80°C.

[0058] Bleomycin was used to induce pulmonary fibrosis in mice. 2 mg / kg bleomycin was delivered to the lungs of mice via local intratracheal injection. Significant fibrosis was observed in the lungs of mice after one week, with a fibrotic area of ​​36.2%. RNA was dissolved in a protective solution containing 0.1% hyaluronic acid, 1% PEG-2000, 1% mannitol, and 1% glycerol. Mice were administered the drug via nebulizer, with a particle diameter of 2-5 μm, once daily for 4 weeks. Results showed that the fibrotic area in the lungs of mice decreased to 8.6%, improving fibrosis by 76.2%.

[0059] Comparative Example 2:

[0060] circ_0001649 was obtained through artificial synthesis and purified using column chromatography to remove small molecule impurities. The purity and modification status of the RNA were then analyzed by mass spectrometry. Finally, the purified RNA was stored at -80℃.

[0061] Bleomycin was used to induce pulmonary fibrosis in mice. 2 mg / kg bleomycin was delivered to the lungs of mice via local intratracheal injection. Significant fibrosis was observed in the lungs of mice after one week, with a fibrotic area of ​​36.2%. RNA was dissolved in a protective solution containing 0.1% hyaluronic acid, 1% PEG-2000, 1% mannitol, and 1% glycerol. Mice were then administered the drug via nebulizer, with a particle diameter of 2-5 μm, once daily for 4 weeks. Results showed that the fibrotic area in the lungs of mice decreased to 31.7%, representing a 12.4% improvement in fibrosis.

[0062] Table 1

[0063]

[0064] Table 1 shows the therapeutic effects of the nebulizable inhalable RNA of the present invention on pulmonary fibrosis.

[0065] siRNA modified group: The treatment group that inhaled modified siRNA; siRNA group: The treatment group that inhaled unmodified siRNA; circRNA modified group: The treatment group that inhaled modified circRNA; circRNA group: The treatment group that inhaled unmodified circRNA.

[0066] In summary, this invention develops an atomized RNA, including siRNA or circRNA, which is linked to special modifying components to enhance RNA stability, cellular uptake, and targeting. This allows it to be delivered directly to lung cells via atomized inhalation without the need for protective drug delivery carriers such as lipid nanoparticles, thereby treating lung-related diseases such as pneumonia, pulmonary fibrosis, and chronic obstructive pulmonary disease (COPD).

[0067] In addition, the nucleic acid-related information involved in this invention is as follows (5'-3'):

[0068] CTHRC1 siRNA:

[0069] AAGAUCUAUGCCAUAAUUCAA (referred to as SEQ ID NO: 1);

[0070] GAAUUAUGGCAUAGAUCUUGG (referred to as SEQ ID NO: 2);

[0071] It should be noted that CTHRC1 siRNA has a double-stranded structure; during synthesis, the bases in SEQ ID: 1 and SEQ ID: 2 will naturally pair to form a double-stranded structure. The same applies to the following siRNAs: HMGB1 siRNA, NLRP3 siRNA, RAGE siRNA, Fli1 siRNA, TNF-α siRNA, IL-8 siRNA, IL-6 siRNA, IL-11 siRNA, IL-17 siRNA, NF-κB siRNA, MMP-9 siRNA, MMP-12 siRNA, CXCR2 siRNA, TGF-β siRNA, and PDGF siRNA.

[0072] HMGB1 siRNA:

[0073] UGCAUAUGAUGACAUUUUGCC (referred to as SEQ ID NO: 3);

[0074] CAAAAUGUCAUCAUAUGCAUU (referred to as SEQ ID NO: 4)

[0075] NLRP3 siRNA:

[0076] UCUUAAAUUUCUUCAAGUCCA (referred to as SEQ ID NO: 5);

[0077] GACUUGAAGAAAUUUAAGAUG (referred to as SEQ ID NO: 6)

[0078] RAGE siRNA:

[0079] UUUCCAUUCCUGUUCAUUGCC (referred to as SEQ ID NO: 7);

[0080] CAAUGAACAGGAAUGGAAAGG (referred to as SEQ ID NO: 8)

[0081] Fli1 siRNA:

[0082] AUUCUUCUCGUCCAUAUAGCU (referred to as SEQ ID NO: 9);

[0083] CUAUAUGGACGAGAAGAAUGG (referred to as SEQ ID NO: 10)

[0084] TNF-αsiRNA:

[0085] AGAUAGAUGGGCUCAUACCAG (referred to as SEQ ID NO: 11);

[0086] GGUAUGAGCCCAUCUAUCUGG (referred to as SEQ ID NO: 12)

[0087] IL-8 siRNA:

[0088] AGCUUUACAAUAAUUUCUGUG (referred to as SEQ ID NO: 13);

[0089] CAGAAAUUAUUGUAAAGCUUU (referred to as SEQ ID NO: 14)

[0090] IL-6 siRNA:

[0091] ACAUCUUUGGAAUCUUCUCCU (referred to as SEQ ID NO: 15);

[0092] GAGAAGAUUCCAAAGAUGUAG (referred to as SEQ ID NO: 16)

[0093] IL-11 siRNA:

[0094] AGGUCAAGAUGGUUCAUUAUG (referred to as SEQ ID NO: 17);

[0095] UAAUGAACCAUCUUGACCUUG (referred to as SEQ ID NO: 18)

[0096] IL-17 siRNA:

[0097] AUUGGUAUUCCGGUUAUGGAU (denoted as SEQ ID NO: 19); CCAUAACCGGAAUACCAAUAC (denoted as SEQ ID NO: 20)

[0098] NF-κB siRNA:

[0099] AAAUAUGGAUCAUCUUCUGCC (denoted as SEQ ID NO: 21); CAGAAGAUGAUCCAUAUUUGG (denoted as SEQ ID NO: 22)

[0100] MMP-9 siRNA:

[0101] UCCAAUAGGUGAUGUUGUGGU (denoted as SEQ ID NO: 23); CACAACAUCACCUAUUGGAUC (denoted as SEQ ID NO: 24)

[0102] MMP-12 siRNA:

[0103] AUCUUUCACCAAAUAGCACAU (designated as SEQ ID NO: 25); GUGCUAUUUGGUGAAAGAUAC (designated as SEQ ID NO: 26)

[0104] CXCR2 siRNA:

[0105] UAAUUACUAAGAUCUUCACCU (designated as SEQ ID NO: 27); GUGAAGAUCUUAGUAAUUACA (designated as SEQ ID NO: 28)

[0106] TGF-β siRNA:

[0107] UGAACUUGUCAUAGAUUUCGU (designated as SEQ ID NO: 29); GAAAUCUAUGACAAGUUCAAG (designated as SEQ ID NO: 30)

[0108] PDGF siRNA:

[0109] UCAUUUGGAAGGAUAGAGGGU (designated as SEQ ID NO: 31);

[0110] CCUCUAUCCUUCCAAAUGAAA (designated as SEQ ID NO: 32)

[0111] circ_0004015 (designated as SEQ ID NO: 33):

[0112] ATATGTGTCACAAAGATGTCTACACGGAACTGCCAGGGAATGGACTCAGTGATCAAACCCCTGGACACAATTCCTGAGGATAAAAAAGTCAGAGTTCAGAGGACACAGAGCACTTTTGACCCATTTGAGAAACCAGCTAATCAAGTAAAGAGGGTGCATTCTGAGAACAATGCTTGCATTAACTTTAAGACCTCCTCCACTGGCAAAGAGTCACCTAAAGTTAGGCGGCACTCCAGCCCCAGCTCGCCAACAAGTCCCAAATTTGGAAAAGCTGACTCATATGAAAAGCTGGAAAAACTAGGGGAAGGATCTTATGCTACAGTATACAAAGGGAAAAGCAA

[0113] circ_0001649 (recorded as SEQ ID NO: 34):

[0114] GGCAGCCATTCTACAAAAGTGGAAGCTGTGGTCAGAACTCTGATGAAAATACAGCTTAGAGATCCAGGGGCCAAAGCACTCGTTTTCTCAACGTGGCAAGATGTATTAGATATTATTTCAAAAGCTCTTACTGACAACAACATGGAATTTGCACAAATCAGTCGTGTTAAGACATTTCAGGAGAACCTTTCAGCATTTAAACGTGATCCCCAAATCAATATTTTGCTGCTGCCCCTGCACACAGGTTCTAATGGATTAACTATCATTGAAGCAACTCATGTTCTCTTGGTGGAGCCCATATTGAACCCTGCCCATGAGCTTCAGGCCATAGGGAGGGTGCACCGAATTGGACAGACAAAACCTACTATTGTACACAGATTCTTAATTAAAGCAACAATAGAAGAAAGAATGCAGGCAATGCTGAAAACTGCTGAGAGAAG

[0115] circ_0004015 (recorded as SEQ ID NO: 35):

[0116] ATATGTGTCACAAAGATGTCTACACGGAACTGCCAGGGAATGGACTCAGTGATCAAACCCCTGGACACAATTCCTGAGGATAAAAAAGTCAGAGTTCAGAGGACACAGAGCACTTTTGACCCATTTGAGAAACCAGCTAATCAAGTAAAGAGGGTGCATTCTGAGAACAATGCTTGCATTAACTTTAAGACCTCCTCCACTGGCAAAGAGTCACCTAAAGTTAGGCGGCACTCCAGCCCCAGCTCGCCAACAAGTCCCAAATTTGGAAAAGCTGACTCATATGAAAAGCTGGAAAAACTAGGGGAAGGATCTTATGCTACAGTATACAAAGGGAAAAGCAA

[0117] circHECTD1 (recorded as SEQ ID NO: 36):

[0118]

[0119] circ_0001946 (denoted as SEQ ID NO: 37):

[0120]

[0121]

[0122] circHIPK3 (denoted as SEQ ID NO: 39):

[0123]

[0124] circFASN (denoted as SEQ ID NO: 40):

[0125]

[0126] circZNF652 (designated as SEQ ID NO: 41):

[0127] AACTGTGACGAAAGGTTTCAGTACAAGTACCAGCTACGCTCCCACATGAGCATTCATATTGGGCACAAACAGTTCATGTGCCAGTGGTGTGGCAAGGATTTCAACATGAAGCAGTACTTCGACGAACACATGAAAACACACACTG

[0128] circSOD2 (designated as SEQ ID NO: 42):

[0129] GGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCAAAAAGTAAACCACGATCGTTATGCTGA

[0130] circFOXO3 (designated as SEQ ID NO: 43):

[0131]

[0132] circANRIL: Holdt, L.M., Stahringer, A., Sass, K., Pichler, G., Kulak, N.A., Wilfert, W., ... & Teupser, D. (2016). Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans. Nature Communications, 7, 12429.

[0133] circCCDC66 (designated as SEQ ID NO: 44):

[0134] ATGGGAAATAAGGCCAAGATTGCAAAATGTCCTTTAAGAACAAAAACTGGGCACATTCTAAAATCAACACAAGATACTTGTATTGGGAGTGAAAAACTTTTGCAAAAGAAGCCAGTTGGTTCAGAAACATCACAGGCAAAAGGTGAAAAAAATGGAATGACTTTTTCATCCACTAAGG ATTTATGTAAACAATGTATAGATAAAGACTGTCTTCATATCCAGAAAGAGATTTCACCTGCAACCCCTAATATGCAGAAGACTAGAAACACCGTAAATACATCTCTAGTAGGTAAACAGAAGCCTCACAAAAAACACATCACAGCTGAAAACATGAAGAGCAGTTTGGTGTGTCTAAC ACAAGACCAACTACAACAGATTTTGATGACTGTAAACCAAGGAAATAGATCTCTTTCCCTGACTGAGAATGGAAAGGAGGCAAAAAGTCAATATAGTCTATATTTAAACAGTATTTCTAATCAGCCAAAGGATGAGAACATTATGGGATTATTCAAAAAAACTGAAATGGTTTCATCT GTCCCAGCTGAAAATAAATCTGTCTTAAATGAACATCAGGAGACATCTAAACAGTGTGAGCAAAAAATTGCCATAGAGAATGAATGGAAACCAGCTGATATATTCAGTACTCTGGGGGAAAGGGAATGTGATAGAAGTTCGTTGGAAGCAAAAAAAGCCCAGTGGAGGAAAGAGCTAG

[0135] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principle of the present invention should also be considered within the scope of protection of the present invention.

Claims

1. Inhalable RNA via atomization, characterized by: The RNAs include siRNA and circRNA.

2. The nebulized RNA according to claim 1, characterized in that: The target sites of the siRNA include one or more of CTHRC1, HMGB1, NLRP3, RAGE, Fli1, TNF-α, IL-8, IL-6, IL-11, IL-17, NF-κB, MMP-9, MMP-12, CXCR2, TGF-β, and PDGF.

3. The atomizable inhalable RNA according to claim 2, characterized in that: The circRNA includes one or more of circ_0004015, circ_0001649, circ_0004015, circHECTD1, circ_0001946, circ_0026344, circHIPK3, circFASN, circZNF652, circSOD2, circFOXO3, circANRIL, and circCCDC66.

4. The atomizable inhalable RNA according to claim 2 or 3, characterized in that: The RNA also includes modifying components; the modifying components include one or more of chemical modifications, lipid modifications, peptide modifications, and glycan modifications.

5. The atomizable inhalable RNA according to claim 4, characterized in that: The chemical modifications include: 2'-O-methylation, 2'-O-fluorination, or phosphorylation. And / or, the lipid modification includes: PEG modification or cholesterol modification; And / or, the peptide modification includes: TAT peptide modification, R8 peptide modification, R9 peptide modification or Penetratin peptide modification; And / or, the sugar chain modification includes: N-GlcNAc modification, mannitol modification, trehalose modification, glucose modification, cyclodextrin modification, or hyaluronic acid modification.

6. The method for preparing atomizable inhalable RNA according to any one of claims 1 to 5, characterized in that: Includes the following steps: 1) Obtain RNA and activated modification components through artificial synthesis; 2) Use cross-linking agents and NHS to link RNA with activated modified components, wherein the cross-linking agents include EDC or DCC; 3) Purify the modified RNA.

7. The method of using the atomized inhalable RNA as described in any one of claims 1 to 6, characterized in that: The prepared RNA was dissolved in a protective solution and atomized into particles with a diameter of 2–5 μm was sprayed out using an atomizer.

8. The method of using the atomized inhalable RNA according to claim 7, characterized in that: The protective solution is a solvent of PBS or physiological saline, and the solute is one or more of hyaluronic acid, PEG-2000, mannitol, and glycerol.

9. The use of the nebulizable inhalable RNA according to any one of claims 1 to 8 in the prevention and / or treatment of lung-related diseases, including pneumonia, pulmonary fibrosis, or COPD.

Images