A therapeutic vaccine for systemic lupus erythematosus, its preparation method and application

Abstract

This invention discloses a therapeutic vaccine for systemic lupus erythematosus, its preparation method, and its application. Compared with current treatment methods, this invention can induce a tolerant immune response, including regulatory T cells and tolerant dendritic cells, thereby exerting a therapeutic effect by appropriately regulating the immune response. Compared with the use of immunosuppressants such as rapamycin and cyclophosphamide alone, this invention avoids indiscriminately suppressing or eliminating all or a large class of beneficial immune cells, maintaining the body's ability to generate a protective immune response, and thus has a greater safety advantage.

Description

Technical Field

[0001] This invention belongs to the field of medicine, specifically relating to a therapeutic vaccine for systemic lupus erythematosus, its preparation method, and its application. Background Technology

[0002] Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by the production of autoantibodies and the deposition of immune complexes, affecting multiple systems. SLE presents with diverse clinical manifestations, impacting multiple organs including the skin, joints, kidneys, and central nervous system, severely impairing patients' quality of life and life-threatening conditions. Epidemiological data show that the positivity rate of anti-chromatin antibodies in SLE patients is approximately 50%–90%, and can even reach 100% in drug-induced lupus.

[0003] Currently, clinical treatment for SLE primarily relies on glucocorticoids and traditional immunosuppressants, such as cyclophosphamide, mycophenolate mofetil, and tacrolimus. However, these treatments have several limitations: on the one hand, long-term use of glucocorticoids can lead to serious complications such as osteoporosis, femoral head necrosis, and metabolic disorders; on the other hand, the non-specific effects of traditional immunosuppressants can disrupt the overall homeostasis of the immune system, and a significant proportion of patients still do not respond well to existing treatments or develop drug resistance. Therefore, there is an urgent need in this field to develop novel SLE treatment strategies to achieve more precise and safer immune modulation.

[0004] Chromatin, a DNA-protein complex composed of DNA, histones, and non-histone proteins, is the basic structural unit of the cell nucleus. Increasing research indicates that chromatin is a core self-antigen driving the autoimmune response in SLE. Histones, as core components of chromatin, are among the most recognized self-antigens in SLE. Nucleosomes, as basic structural units of chromatin, are both autoimmunogens driving immunity and major targets of autoantibodies in the body. During apoptosis, chromatin is cleaved into oligomeric nucleosomes and released into the extracellular space; the extracellular traps released by neutrophils also contain depolymerized chromatin, and various NET-related proteins can act as self-antigens to induce the production of autoantibodies. DNASE1L3 deficiency leads to impaired extracellular chromatin clearance, thereby causing autoantibody formation and immune complex deposition. The applicant's previous related patent (CN121466285A) also disclosed the application of lymphocyte chromatin in the preparation of drugs for treating systemic lupus erythematosus, which exerts its therapeutic effect by inducing tolerance-based immune responses such as regulatory T cells and tolerant dendritic cells. However, the therapeutic effect of inducing immune tolerance solely through chromatin autoantigens may be limited by the already prevalent intense inflammatory microenvironment in SLE patients. Under continuous inflammatory stimulation, the efficiency and durability of simply inducing tolerance may be insufficient, making it difficult to establish stable and long-term immune tolerance in patients already in an immune-activated state.

[0005] The mammalian target of rapamycin (mTOR) signaling pathway plays a crucial role in the pathogenesis of SLE. Aberrant activation of mTOR can induce CD4+ activation. + Aberrant activation of T cells promotes their differentiation into pro-inflammatory Th17 cells, leading to an imbalance in the Th17 / regulatory T cell ratio and thus driving the immunopathological process of SLE. Rapamycin, as a specific inhibitor of mTOR, can inhibit the abnormal activation of T cells and B cells, reduce the production of autoantibodies, and promote the proliferation and stabilization of Tregs by blocking the mTOR signaling pathway, thereby restoring the Th17 / Treg immune balance. However, as a broad-spectrum immunosuppressant, rapamycin lacks antigen specificity. While inhibiting pathogenic immune cells, it may also affect the body's normal immune defense function. Furthermore, the therapeutic effect of rapamycin in lupus nephritis still requires further investigation. The mTOR signaling pathway is widely present in various immune cells, and systemic inhibition of mTOR may bring significant side effects. Current research is also beginning to focus on specific targeting of mTORC2 in order to reduce side effects while ensuring efficacy.

[0006] The problems with using chromatin as an autoantigen to induce immune tolerance include the long treatment course and the corresponding long onset time of the therapy. Also, because lupus patients are in a state of immune activation for a long time, chromatin alone may not be able to reverse their immune response type, making it difficult to establish stable and long-term immune tolerance.

[0007] Problems with rapamycin-only treatment include immunosuppressive-related reactions: long-term use can lead to decreased immunity and increase the risk of bacterial, viral, or fungal infections (such as pneumonia, urinary tract infections), lymphoma, and skin cancer. Therefore, neither chromatin-induced immune tolerance alone nor rapamycin alone can achieve ideal treatment for SLE. Summary of the Invention

[0008] Purpose of the invention: The technical problem to be solved by the present invention is to provide a therapeutic vaccine for systemic lupus erythematosus that can slow down the disease progression and improve the disease phenotype in lupus animals.

[0009] Another technical problem to be solved by the present invention is to provide a method for preparing the aforementioned therapeutic vaccine for systemic lupus erythematosus.

[0010] The final technical problem to be solved by the present invention is to provide the use of the therapeutic vaccine in medicaments for the prevention and / or treatment of systemic lupus erythematosus.

[0011] Technical solution: In order to solve the above-mentioned technical problems, the present invention provides a therapeutic vaccine for systemic lupus erythematosus, wherein the therapeutic vaccine comprises chromatin and rapamycin.

[0012] The mass ratio of chromatin to rapamycin is 1:1 to 5:1.

[0013] The chromatin has a mass of 5-100 μg, and the rapamycin has a mass of 5-50 μg.

[0014] The chromatin is either commercially purchased chromatin or lymphocyte chromatin extracted from animals.

[0015] The therapeutic vaccine is administered as an injection.

[0016] The present invention also provides a method for preparing the aforementioned therapeutic vaccine for systemic lupus erythematosus, comprising the following steps:

[0017] (1) Rapamycin dry powder was dissolved in DMSO to prepare rapamycin stock solution;

[0018] (2) The rapamycin stock solution and chromatin are mixed in proportion to obtain the solution.

[0019] The present invention also provides the use of the aforementioned therapeutic vaccine for systemic lupus erythematosus in medicaments for the prevention and / or treatment of systemic lupus erythematosus.

[0020] The systemic lupus erythematosus mentioned above includes drug-induced lupus erythematosus and spontaneous lupus erythematosus.

[0021] The drug-induced lupus includes imiquimod-induced lupus or rethimod-induced lupus.

[0022] The drug is one that reduces the location of lupus-related lymph node swelling, reduces the incidence of skin lesions, induces immune tolerance with lower levels of urinary protein than untreated animals or humans, and / or induces immune tolerance with consistently lower levels of autoantibodies than untreated animals or humans.

[0023] The drug is one that improves the phenotype of systemic lupus erythematosus, induces immune tolerance to significantly reduce the expression level of inflammatory cytokines, and / or increases the number of regulatory cells after inducing tolerance compared to untreated patients.

[0024] In some embodiments of the present invention, vaccination with the therapeutic vaccine can effectively reduce lymph node swelling, and the administration method is subcutaneous, intramuscular, intradermal, or intraperitoneal injection with or without needles.

[0025] In some embodiments of the present invention, administration of the therapeutic vaccine significantly reduces the incidence of skin lesions, and the administration method is subcutaneous, intramuscular, intradermal, or intraperitoneal injection with or without needles.

[0026] In some embodiments of the present invention, the therapeutic vaccine is administered, and the level of urinary protein induced by immune tolerance is lower than that of untreated animals, and the level of autoantibodies induced by immune tolerance is always lower than that of untreated animals. The administration method is subcutaneous, intramuscular, intradermal, or intraperitoneal injection with or without needles.

[0027] In some embodiments of the present invention, in a lupus mouse model, vaccination with the therapeutic vaccine significantly improves the disease phenotype, induces immune tolerance and significantly reduces the level of inflammatory cytokines, and after tolerance is induced, the number of regulatory cells increases compared to untreated mice.

[0028] In some embodiments of the present invention, in a lupus mouse model, vaccination with the therapeutic vaccine can reduce the level of autoantibodies.

[0029] In some embodiments of the present invention, the therapeutic vaccine only inhibits the lupus autoantigen-specific immune response and does not impair the normal immune response capacity outside of lupus.

[0030] On the other hand, the present invention provides a vaccine for treating systemic lupus erythematosus, the vaccine containing lymphocyte chromatin.

[0031] Beneficial effects: Compared with the prior art, the present invention has the following advantages: The therapeutic vaccine of the present invention can specifically treat systemic lupus erythematosus. Compared with current treatment methods, it can induce tolerant immune responses such as regulatory T cells and tolerant dendritic cells, exerting a therapeutic effect by appropriately regulating the immune response, avoiding indiscriminate suppression or elimination of all or a large class of beneficial immune cells, and maintaining the body's ability to produce a protective immune response. Compared with the use of immunosuppressants such as rapamycin and cyclophosphamide alone, it maintains the body's ability to produce a protective immune response and has a greater safety advantage. Attached Figure Description

[0032] Figure 1 This is a diagram showing the effect of a therapeutic vaccine on an imiquimod-induced lupus mouse model.

[0033] Figure 2 This is a graph showing the effect of a therapeutic vaccine on a spontaneous lupus mouse model (MRL / lpr).

[0034] Figure 3 This is a safety test of a therapeutic vaccine, specifically its effect on other immune models besides lupus.

[0035] Figure 4 The effect of subcutaneous inoculation of autoantigen alone on the R848-induced lupus mouse model. Detailed Implementation

[0036] The following embodiments are provided to better understand the present invention, but are not intended to limit the scope of protection of the invention. Unless otherwise specified, the experimental methods, materials and reagents used in the following embodiments are conventional methods, and the materials and reagents used are commonly available in the laboratory and can be purchased commercially.

[0037] Experimental materials for this invention: SPF-grade 8-week-old female C57BL / 6J mice (approximately 18g, from Spiford (Beijing) Biotechnology Co., Ltd.), SPF-grade 8-week-old female MRL / Lpr mice (approximately 18g, from Spiford (Beijing) Biotechnology Co., Ltd.), isoflurane (Qingdao Aubofang Pharmaceutical Technology Co., Ltd.), imiquimod cream (Mingxin Lidi, Sichuan Mingxin Pharmaceutical Co., Ltd.), reverse transcription reagent (Nanjing Novizan Biotechnology Co., Ltd., catalog number R433-01), rapamycin (MedChemExpress, catalog number HY-10219), chromatin extraction kit (Abcam, catalog number ab117152), salmon sperm DNA (Thermo Fisher Scientific, catalog number AM9680), SYBR GreenPro Taq HS premixed qPCR kit (Aikerui (Shanghai) Biopharmaceutical Co., Ltd., catalog number AG11701), and mouse anti-dsDNA (IgG). ELISA kit (Wuhan Huamei Biotechnology Co., Ltd., catalog number CSB-E11194m), urine protein and creatinine assay kits (Nanjing Jiancheng Biotechnology Research Institute, catalog numbers C035-2-1 and C011-2-1 respectively), RNA extraction kit (Takara Bio Inc., catalog number 9109), erythrocyte lysis buffer (BioSharp Biotechnology Co., Ltd., catalog number BL503B), Annexin V-FITC / PI apoptosis detection kit (YEASEN Biotechnology Co., Ltd., catalog number 40302ES60), cell stimulation mixture (BD, BD Medical Devices (Shanghai) Co., Ltd., catalog number 550583), Transcription Factor Buffer Set 100Tst (BD, BD Medical Devices (Shanghai) Co., Ltd., catalog number 562574), mouse CD3 flow cytometry antibody (BD, BD Medical Devices (Shanghai) Co., Ltd., catalog number 553066), mouse CD4 flow cytometry antibody (Biolegend, catalog number 100553), mouse CD8 flow cytometry antibody (Biolegend, catalog number 100734), intracellular factor Foxp3 flow cytometry antibody (Biolegend, catalog number 126419), and IL-10 flow cytometry antibody (Biolegend, catalog number 505008).

[0038] Goat anti-mouse FITC-IgG antibody (ABclonal, catalog number AS001), goat anti-mouse IgG-HRP (Southern Biotech, catalog number SBA-1030-05), goat anti-mouse IgG1-HRP (Southern Biotech, catalog number SBA-1071-05), goat anti-mouse IgG2c-HRP (Southern Biotech, catalog number SBA-1071-05), goat anti-mouse IgG2c-HRP (Southern Biotech, catalog number SBA-1030-05). Biotech (product number SBA-1078-05), TMB chromogenic solution (Sangon Biotech (Shanghai) Co., Ltd., product number E661007-0100), ELISA stop solution (Fuzhou Feijing Biotechnology Co., Ltd., product number PMY001), environmentally friendly dewaxing and clearing solution (Wuhan Saiweier Biotechnology Co., Ltd., product number G1128), hematoxylin and eosin staining kit (Shanghai Beyotime Biotechnology Co., Ltd., product number C0105S); QuickBlock™ immunostaining blocking solution (Shanghai Beyotime Biotechnology Co., Ltd., product number P0260), DAPI staining solution (Shanghai Beyotime Biotechnology Co., Ltd., product number G1012-10ML). Cyclophosphamide (Anderson, Baxter Oncology GmbH), BD Cytofix / Cytoperm™ Fixation and Permeabilization Solution (BD, BD Medical Devices (Shanghai) Co., Ltd., catalog number 554714), OVA-specific MHC-I tetramer (Beijing Bomei Biotechnology Co., Ltd., catalog number TS-5001-1C), Fc receptor blocker (Miltenyi Biotech, catalog number 130-0925-35).

[0039] RPMI-1640 medium (Gibco, catalog number C11875500BT), 1xPBS solution (pH 7.4, Seville, catalog number G4202-500ML), DNA stock solution (10 mg / mL, Thermo Scientific, catalog number AM9680), and a LightCycler 96 real-time quantitative PCR instrument were purchased from Roche. Ovalbumin (OVA) protein (Sigma, catalog number A5503), 30 μg poly(I:C) (Invivogen, catalog number tlrl-picw), CpG ODNs (Invivogen, catalog number tlrl-1826), Chromatin Extraction kit (Abcam, catalog number ab223876), and HiScript IV All-in-One Ultra RT SuperMix for qPCR reverse transcription kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number R433-01) were also used.

[0040] Example 1: Formulation of one of the therapeutic vaccines

[0041] 1. Preparation of autoantigen chromatin

[0042] C57BL / 6J mice were euthanized by cervical dislocation. The abdomen was disinfected with 75% ethanol, and the spleen was removed and placed in pre-cooled RPMI-1640 medium. The spleen was minced and ground into a cell suspension, which was then filtered through a 40 μm sieve. The suspension was then repeatedly pipetted through a 5 mL Pasteur tube to prepare a single-cell suspension. The suspension was centrifuged at 500 g for 5 minutes at 4°C, and the supernatant was discarded. Red blood cell lysis buffer (2 mL / spleen) was added to the cell pellet, and the mixture was incubated at room temperature for 10 minutes. Lysis was terminated by adding 10 mL of 1xPBS solution at pH 7.4. The cell suspension was then centrifuged and washed again under the same conditions until no red blood cells remained. The final cell pellet was resuspended in complete medium and cultured with concanavalin A (ConA) at a final concentration of 5 ng / mL for 3 days.

[0043] ConA-stimulated splenic lymphocytes were collected and cultured, and the apoptosis rate was 87% according to the Annexin V-FITC / PI apoptosis detection kit. Chromatin was extracted according to the instructions of the Chromatin Extraction kit to obtain a chromatin stock solution with a concentration range of 10 mg / mL.

[0044] 2. Preparation of therapeutic vaccines

[0045] Weigh the dry rapamycin powder and dissolve it in DMSO to prepare a 50 mg / mL rapamycin stock solution. Mix the rapamycin stock solution and the chromatin stock solution to prepare a therapeutic vaccine containing 100 μg chromatin and 20 μg rapamycin per 100 μL.

[0046] Example 2: Preparation of the second therapeutic vaccine

[0047] 1. Preparation of autoantigen chromatin

[0048] MRL / Lpr mice were euthanized by cervical dislocation. The abdomen was disinfected with 75% ethanol, and the spleen was removed and placed in pre-chilled RPMI-1640 medium. The spleen was minced and ground into a cell suspension, which was then filtered through a 40 μM sieve. The suspension was then repeatedly pipetted through a 5 mL Pasteur tube to prepare a single-cell suspension. The suspension was centrifuged at 500 g for 5 minutes at 4°C, and the supernatant was discarded. Red blood cell lysis buffer (2 mL / spleen) was added to the cell pellet, and the mixture was incubated at room temperature for 10 minutes. Lysis was terminated by adding 10 mL of 1xPBS solution at pH 7.4. The cell suspension was then centrifuged and washed again under the same conditions until no red blood cells remained. Chromatin was extracted from the final cell pellet using a Chromatin Extraction Kit.

[0049] 2. Preparation of therapeutic vaccines

[0050] Weigh the dry rapamycin powder and dissolve it in DMSO to prepare a 50 mg / mL rapamycin stock solution. Mix the rapamycin stock solution and the chromatin stock solution to prepare a therapeutic vaccine containing 100 μg chromatin and 20 μg rapamycin per 100 μL.

[0051] Example 3: Formulation of the third therapeutic vaccine

[0052] Weigh the dry rapamycin powder and dissolve it in DMSO to prepare a 50 mg / mL rapamycin stock solution. Mix the rapamycin stock solution with the DNA stock solution (10 mg / mL, purchased from Thermo, catalog number AM9680) to prepare a 100 μL therapeutic vaccine containing 100 μg DNA and 20 μg rapamycin.

[0053] Example 4: Effect of therapeutic vaccine on imiquimod-induced lupus mice

[0054] 1. Establishment of an imiquimod-induced systemic lupus erythematosus model in C57BL / 6J mice

[0055] Imiquimod cream 15mg was applied to the skin of the right ear of 8-week-old female C57BL / 6J mice three times a week for 11 consecutive weeks. The experimental groups were as follows: (1) blank control group (no modeling) 3 mice; (2) IMQ modeling group 6 mice; (3) IMQ modeling + rapamycin treatment group 3 mice; (4) IMQ modeling + therapeutic vaccine treatment group 5 mice.

[0056] 2. Preparation and administration of therapeutic vaccines

[0057] Mice in each group were placed in an air anesthesia machine and, after anesthesia, were subcutaneously injected with the therapeutic vaccine prepared in Example 1 or rapamycin stock solution using a 1mL insulin syringe. Each mouse was injected with 100μL, and the injections were repeated for three consecutive days. The immunization was repeated two weeks later. The non-model group received no treatment.

[0058] 3. Cell extraction and flow cytometry

[0059] Eleven weeks after C57BL / 6J mouse modeling, spleens and lymph nodes were harvested, ground, filtered, and single-cell suspensions were obtained. Red blood cells were removed with erythrocyte lysis buffer, and the cells were centrifuged and resuspended. The cell suspension was then added at 200 μL / well to a U-bottom 96-well plate. Cell stimulation mixture was added to each well, and the cells were gently mixed by pipetting and incubated at 37°C in a 5% CO2 incubator for 6 hours in the dark. After stimulation, the cells were washed with 1xPBS, then Fc receptor blocker and live / dead staining solution were added. After incubation at room temperature for 20 minutes, mouse CD4 and other flow cytometry antibodies were added, and the cells were incubated at room temperature in the dark for 30 minutes. Excess antibodies were washed away with 1xPBS, and the cells were centrifuged at 500 g for 5 minutes at 4°C. Cells were then fixed and nucleated. After reacting at room temperature for 3 hours, excess fixation and cell lysis buffer was washed away with a special washing buffer. Cell pellet was obtained by centrifugation under the same conditions. Flow cytometry antibodies against intracellular factors Foxp3 or IL-10 were then added. After staining at room temperature in the dark for 1 hour, excess antibodies were washed away. After centrifugation, the cell pellet was resuspended in flow cytometry buffer and collected on a BD Fortessa flow cytometer. The experimental data were then analyzed using FlowJo software.

[0060] 4. Real-time quantitative PCR experiment

[0061] Eleven weeks after C57BL / 6J mouse modeling, kidney tissue was harvested. Total RNA was extracted and purified using Trizol reagent combined with chloroform-isopropanol-ethanol purification method, and RNA concentration was detected using a NanoDrop spectrophotometer (NanoDrop One / OneC, Thermo Fisher Scientific). Reverse transcription was performed using the HiScript IV All-in-One Ultra RT SuperMix for qPCR kit, with 1 µg of total RNA used in each reaction.

[0062] The qPCR reaction system was prepared using the SYBR Green Pro Taq HS premixed qPCR kit. The amplification system consisted of: 10 μL total volume: 5 μL SYBR Green Pro Taq HS Premix, 2.5 μL enzyme-free water, 2 μL cDNA, and 0.5 μL primer mix (refer to the kit instructions for details). The experimental procedure was as follows: pre-denaturation at 94℃ for 30 s; denaturation at 94℃ for 5 s; annealing at 60℃ for 30 s; after 40 cycles, the melting curve was detected. The primer sequences for the target gene are as follows:

[0063] Il-10:

[0064] SEQ ID NO.1:F:AGAGACTTGCTTCTGCACTACCAA

[0065] SEQ ID NO.2:R:GTAAGAGCAGGCAGCATAGCAGT

[0066] Ctla4:

[0067] SEQ ID NO.3:F:ACTCATGTACCCACCGCCATA

[0068] SEQ ID NO.4:R:GGGCATGGTTCTGGATCAAT

[0069] Il-1b:

[0070] SEQ ID NO.5:F:TCGCTCAGGGTCACAAGAAA

[0071] SEQ ID NO.6:R:CATCAGAGGCAAGGAGGAAAAC

[0072] The mRNA expression level of the target gene was normalized using a qPCR instrument. The relative expression level was calculated using the 2^(–ΔΔCt) method, with β-actin as the internal reference gene.

[0073] 5. Enzyme-linked immunosorbent assay (ELISA)

[0074] Eleven weeks after C57BL / 6J mouse modeling, orbital venous blood was collected from mice. After standing at room temperature for 2 hours, the serum samples were centrifuged at 3000 rpm for 10 minutes at 4°C to obtain the test samples, which were then aliquoted and frozen at -80°C for later use. Following the instructions of the mouse anti-dsDNA (IgG) ELISA kit, all reagents were brought to room temperature for 1 hour before the experiment. Standard wells and test sample wells were prepared. 100 μL of standard or test sample was added to each well, gently shaken to mix, and then the plate was covered with a plate patch and incubated at 37°C for 2 hours. The liquid was discarded and the plate was dried without washing. Then, 100 μL of biotin-labeled working solution was added to each well, and a new plate patch was placed on top, and the plate was incubated at 37°C for 1 hour. The liquid in the wells was discarded and the plate was dried. The plate was washed three times with 200 μL of washing buffer per well, soaking for 2 minutes each time, and then dried. Finally, 100 μL of horseradish peroxidase-labeled avidin working solution was added to each well, and the plate patch was placed on top, and the plate was incubated at 37°C for 1 hour. Discard the liquid in the wells and shake dry. Wash the plate 5 times with 200 μL / well washing buffer, soaking for 2 minutes each time, and shake dry. Then add 90 μL of substrate solution to each well in sequence, and develop the color at 37°C in the dark for 15-30 minutes. After color development, add 50 μL of stop solution and immediately measure the optical density (OD value) of each well at 450 nm using a microplate reader.

[0075] 6. Immunofluorescence staining

[0076] Mouse kidney tissue was embedded in frozen section embedding medium and sectioned using a cryostat to a thickness of 5 μm. After standing at room temperature for 30 minutes, the sections were immersed in 1xPBS solution and washed twice on a shaker for 5 minutes each time. Hydrophobic zones were then drawn around the tissue using an immunohistograph pen, and the slides were placed in a humidified chamber with blocking buffer added for 30 minutes at room temperature. The blocking buffer was discarded, and the tissue was washed twice on a shaker for 5 minutes each time with PBST (1xPBS buffer containing 0.05% Tween-20). After drying the surrounding liquid, goat anti-mouse FITC-IgG antibody (1:200 dilution) was added and incubated at room temperature in the dark for 1.5 hours. The tissue was then washed twice on a shaker with PBST for 5 minutes each time. After drying the surrounding liquid, DAPI staining solution was added and incubated at room temperature in the dark for 5 minutes. The DAPI was discarded, and an anti-fluorescence quenching mounting medium was added. A coverslip was slowly placed on top, avoiding air bubbles, and the immune deposition in the kidneys was observed under an upright fluorescence microscope.

[0077] 7. Experimental Results

[0078] Mice with systemic lupus erythematosus (SLE) were induced with imiquimod and administered a therapeutic vaccine during the process. Flow cytometry staining was performed on tissue samples 11 weeks after modeling, revealing IL-10 levels in the spleen. + Dendritic cells (DCs) increased compared to the IMQ model alone, and TNF-α... + DC showed a reduction in TNF-α compared to the IMQ modeling group alone. + DC and IL-10+ The DC ratio decreased significantly ( Figure 1 The results (A) suggest that therapeutic vaccines can reduce the induction of lupus phenotype in mice by IMQ to some extent; RT-qPCR detection after homogenization of kidney tissue revealed that therapeutic vaccines can increase the expression levels of IL-10 and CTLA4 mRNA in the kidneys, indicating upregulation of tolerance-related molecules (A). Figure 1 (B in the text); 11 weeks after modeling, the levels of anti-double-stranded DNA antibodies (anti-dsDNA) in mouse serum were detected, and it was found that the therapeutic vaccine could reduce the level of autoantibodies in mouse serum ( ). Figure 1 (C in the text); Simultaneously, IgG immunofluorescence staining of mouse kidney tissue sections revealed that the therapeutic vaccine could reduce the deposition of immune complexes in the kidney tissue of an IMQ-induced lupus mouse model (C in the text). Figure 1 (D in the figure, scale bar is 50 μm). The above results indicate that the therapeutic vaccine of the present invention has a therapeutic effect on the IMQ-induced lupus mouse model.

[0079] Example 5: Effect of therapeutic vaccine on spontaneous lupus mouse model

[0080] 1. Treatment with therapeutic vaccines

[0081] Eight-week-old female SPF-grade MRL / Lpr mice were placed in an air anesthesia machine and subcutaneously injected with the therapeutic vaccine prepared in Example 2 using a 1mL insulin syringe. Each mouse received 100μL of the vaccine for three consecutive days, and the immunization was repeated two weeks later. The experimental groups were as follows: (1) 6 mice in the blank control group; (2) 3 mice in the rapamycin treatment group; and (3) 6 mice in the therapeutic vaccine group.

[0082] 2. Urine protein and urine creatinine tests

[0083] From 8 to 20 weeks of age, urine was collected weekly, and urine protein and creatinine were measured according to the instructions of the urine protein and creatinine assay kit.

[0084] 3. Cell extraction and flow cytometry

[0085] Following step 1, mice in each group were treated. At 20 weeks of age, their spleens and lymph nodes were harvested, ground, filtered, and a single-cell suspension was obtained. Red blood cells were removed using erythrocyte lysis buffer, and the cells were centrifuged and resuspended. The cell suspension was then added at 200 μL / well to a U-bottom 96-well plate. Cell stimulation mixture was added to each well, and the cells were gently mixed by pipetting and incubated at 37°C in a 5% CO2 incubator for 6 hours in the dark. After stimulation, the cells were washed with 1x PBS, and then Fc receptor blocker and live / dead staining solution were added. After incubation at room temperature for 20 minutes, mouse CD4 and other flow cytometry antibodies were added, and the cells were incubated at room temperature in the dark for 30 minutes. Excess antibodies were washed away with 1x PBS, and the cells were centrifuged at 500 g for 5 minutes at 4°C. Cells were then fixed and nucleated. After reacting at room temperature for 3 hours, excess fixation and cell lysis buffer was washed away with a special washing buffer. Cell pellet was obtained by centrifugation under the same conditions. Flow cytometry antibodies against intracellular factors Foxp3 and IL-10 were then added. After staining at room temperature in the dark for 1 hour, excess antibodies were washed away. After centrifugation, the cell pellet was resuspended in a flow cytometry buffer and collected on a BD Fortessa flow cytometer. The experimental data were then analyzed using FlowJo software.

[0086] 4. Real-time quantitative PCR experiment

[0087] Mice in each group were treated as described in step 1. At 20 weeks of age, kidney tissue was harvested. Total RNA was extracted and purified using Trizol reagent combined with chloroform-isopropanol-ethanol purification. RNA concentration was detected using a NanoDrop spectrophotometer (NanoDrop One / OneC, ThermoFisher Scientific). Reverse transcription was performed using the HiScript IV All-in-One Ultra RTSuperMix for qPCR reverse transcription kit, with 1 µg of total RNA used in each reaction.

[0088] qPCR reactions were prepared using the SYBR Green Pro Taq HS premixed qPCR kit and detected using a LightCycler 96 real-time quantitative PCR instrument. β-actin was used as an internal reference gene. The mRNA expression level of the target gene was normalized, and its relative expression level was calculated using the 2^(–ΔΔCt) method.

[0089] 5. Preparation of mouse serum

[0090] At 20 weeks of age, orbital venous blood was collected from mice in each group of mice in step 1. After standing at room temperature for 2 hours, the blood samples were centrifuged at 4°C and 3000 rpm for 10 minutes to obtain serum samples, which were then aliquoted and frozen at -80°C for later use.

[0091] 6. Detection of anti-double-stranded DNA antibody IgG

[0092] Following the instructions for the mouse anti-double-stranded DNA antibody (IgG) ELISA kit, mice were treated as described in step 1. At 20 weeks of age, all reagents were brought to room temperature for 1 hour before the experiment. Standard wells and test sample wells were prepared. 100 μL of standard or test sample was added to each well, gently shaken to mix, and then the plate was covered with a substrate. The plate was incubated at 37°C for 2 hours. The liquid was discarded and the plate was dried without washing. Then, 100 μL of biotin-labeled working solution was added to each well, and a new substrate was placed on top. The plate was incubated at 37°C for 1 hour. The liquid in the wells was discarded and the plate was dried. The plate was washed 3 times with 200 μL / well washing buffer, soaking for 2 minutes each time, and then dried. Then, 100 μL of horseradish peroxidase-labeled avidin working solution was added to each well, and the plate was covered with a substrate. The plate was incubated at 37°C for 1 hour. The liquid in the wells was discarded and the plate was dried. The plate was washed 5 times with 200 μL / well washing buffer, soaking for 2 minutes each time, and then dried. Then, add 90 μl of substrate solution to each well in sequence, and develop the color at 37°C in the dark for 15-30 minutes. After the color development is complete, add 50 μl of stop solution and immediately measure the optical density (OD value) of each well at a wavelength of 450 nm using a microplate reader.

[0093] 7. Detection of antichromatin antibody IgG

[0094] The chromatin stock solution prepared in Example 1 was diluted to 5 μg / mL with 1xPBS, and 50 μL was added to each well of a 96-well microplate. The plate was incubated overnight at 4°C. The next day, the coating solution was discarded, and 200 μL of PBST (1x PBS solution containing 0.05% Tween-20) was added to each well. After standing for 2 minutes, the plate was patted dry. This process was repeated three times. Subsequently, 200 μL of blocking buffer (1x PBS solution containing 1% BSA) was added to each well, and the plate was incubated at room temperature for 2 hours. The buffer was then discarded, and the plate was washed three times with PBST and patted dry. The serum samples to be tested were diluted at different ratios and added to the microplate at 100 μL / well. After incubation at room temperature for 2 hours, the solution was discarded and the plate was washed 3 times with PBST. After drying, 100 μL / well of goat anti-mouse IgG-HRP, goat anti-mouse IgG1-HRP and goat anti-mouse IgG2c-HRP (1:5000 dilution) were added and incubated at room temperature for 2 hours. After discarding, the plate was washed repeatedly with PBST 6 times and dried. 100 μL / well of TMB chromogenic solution was added and the plate was incubated at room temperature in the dark for 30 minutes. Then, 80 μL / well of stop solution was added to stop the chromogenic reaction. The plate was immediately placed on a microplate reader to detect the OD value at 450 nm.

[0095] 8. Hematoxylin and eosin (HE) staining

[0096] The kidney tissue obtained in step 4 was embedded in paraffin and sectioned. The resulting paraffin sections were baked at 70°C for 2 hours using a slide warmer. Then, they were dewaxed in an environmentally friendly dewaxing and clearing solution for 10 minutes, followed by a second dewaxing for 10 minutes with fresh solution. Next, they were sequentially hydrated in anhydrous ethanol, 75% ethanol, 50% ethanol, and double-distilled water for 10 minutes each. The processed sections were then stained with hematoxylin for 5 minutes, followed by rinsing under running tap water for a few seconds to remove excess stain. Eosin staining was then performed for 30 seconds. After staining, the sections were sequentially dehydrated in 50% ethanol, 75% ethanol, and anhydrous ethanol for 2 minutes each. Clearing was then performed in an environmentally friendly dewaxing and clearing solution for 5 minutes, followed by a second clearing for 5 minutes with fresh solution. Finally, the sections were mounted with neutral resin. Under a microscope, the cell nuclei appeared blue, while the cytoplasm appeared pink or red.

[0097] 9. Experimental Results

[0098] Mice were treated using the method described in Step 1. From 8 to 20 weeks of age, urinary protein levels were monitored weekly, and skin lesions and lymph node swelling were observed and scored periodically. The results showed that the therapeutic vaccine provided a longer-lasting reduction in skin lesions and lymph node swelling, and also resulted in lower overall urinary protein levels. Figure 2 (A) At the experimental endpoint, flow cytometry staining revealed an increase in the proportion of regulatory T cells (Tregs) in lymph nodes compared to the control group; TNF-α + Dendritic cells (DCs) were reduced compared to the untreated group, and TNF-α was also reduced. + DC and IL-10 + The DC ratio decreased significantly; CD86 + DC was also significantly reduced, suggesting that the therapeutic vaccine can induce immune tolerance in Lpr mice and delay their spontaneous disease progression. Figure 2 (B in the text) Homogenization and RT-qPCR analysis of kidney tissue revealed that the therapeutic vaccine could reduce the expression level of inflammatory IL-1β mRNA in the kidneys ( Figure 2 (C) At the experimental endpoint (20 weeks of age of mice), the levels of anti-double-stranded DNA antibodies (anti-dsDNA) and anti-chromatin antibodies in the serum were measured, and it was found that the therapeutic vaccine could significantly reduce the level of autoantibodies in the serum of mice. Figure 2 (D in the middle) Figure 2 E in the figure represents HE staining of mouse kidney tissue sections, which showed that the therapeutic vaccine could significantly reduce the pathological damage of kidney tissue in the Lpr mouse model (scale bar is 50 μm).

[0099] The above results indicate that the therapeutic vaccine has a therapeutic effect on a mouse model of spontaneous lupus.

[0100] Example 6: The therapeutic vaccine fully retains the ability to generate a protective immune response.

[0101] To evaluate the safety advantages of therapeutic vaccines, we pre-treated mice with either a therapeutic vaccine or an immunosuppressant, then administered an OVA model vaccine, commonly used to evaluate immune responses, two weeks later. After another four weeks, the animals were treated to test whether the mice could produce an OVA-specific immune response.

[0102] 1. Preparation and administration of therapeutic vaccines and various immunosuppressants.

[0103] Cyclophosphamide powder was weighed and dissolved in physiological saline to prepare cyclophosphamide solution; rapamycin powder was weighed and dissolved in DMSO to prepare rapamycin stock solution, which was then diluted with physiological saline to prepare rapamycin working solution. Eight-week-old female C57BL / 6J healthy mice were selected and grouped as follows: (1) blank control group, i.e., untreated group; (2) OVA model vaccine injection group alone; (3) therapeutic vaccine + OVA model vaccine injection group; (4) rapamycin + OVA model vaccine injection group; (5) cyclophosphamide (CTX) + OVA model vaccine injection group, with 6 mice in each group. Each mouse in group (5) was injected intraperitoneally with cyclophosphamide solution at a dose of 30 mg / kg, three times a week for 6 weeks; each mouse in group (4) was injected intraperitoneally with rapamycin at a dose of 1 mg / kg, three times a week for 6 weeks; at the same time, each mouse in group (3) was subcutaneously injected with the therapeutic vaccine prepared in Example 3, 100 μL / time, for three consecutive days, and booster injection was given two weeks later. The other two groups of mice were not treated with inhibitors.

[0104] 2. OVA model vaccine administration

[0105] Preparation of OVA model vaccine: OVA model vaccine consisting of 5 μg OVA protein, 30 μg poly(I:C) and 3 μg CpG ODNs. Mice in each group except the blank control group were anesthetized with an air anesthesia machine and subcutaneously immunized with the OVA model vaccine. 100 μL per mouse per dose. Immunization was carried out for three consecutive days after two weeks of administration of immunosuppressants, and a booster vaccination was carried out two weeks later.

[0106] 3. Cell extraction and flow cytometry

[0107] Peripheral blood flow cytometry staining: Four weeks after vaccination with the OVA model vaccine, orbital venous blood was collected from mice. 50 μL of the blood was added to a 96-well U-bottom plate, and 200 μL of erythrocyte lysis buffer was added to each well. After lysis at room temperature for 10 minutes, the cells were centrifuged at 4°C and 500g for 5 minutes. The lysis was repeated until no erythrocytes remained to obtain a cell suspension.

[0108] To prepare a 100 μL staining system, 0.5 μL of Fc receptor blocker and 0.2 μL of OVA-specific tetramer staining solution were added to 1xPBS solution. This system was then added to the cell suspension and stained in the dark at 37°C with 5% CO2 for 40 minutes. Mouse CD3 flow cytometry antibody was then added and incubated in the dark for another 20 minutes. Unbound antibody was washed off, and the cells were analyzed using a BD Fortessa flow cytometer.

[0109] Splenic and lymph node flow cytometry staining: Four weeks after OVA model vaccine administration, mouse spleen and lymph nodes were taken, thoroughly ground and filtered to obtain single cell suspension, red blood cells were removed with red blood cell lysis buffer, centrifuged and resuspended, and the cell suspension was added to a U-bottom 96-well plate at 200 μL / well, and centrifuged again to obtain cell pellet.

[0110] A 100 μL staining system was prepared by adding 0.5 μL of Fc receptor blocker and 0.2 μL of OVA-specific tetramer staining solution to 1xPBS solution. This system was then added to the cell pellet and stained in the dark at 37°C with 5% CO2 for 40 minutes. Mouse CD3 flow cytometry antibody was then added and incubated in the dark for another 20 minutes. Unbound antibody was washed away, and the cells were analyzed using a BD Fortessa flow cytometer. Experimental data were analyzed using FlowJo software.

[0111] 4. Enzyme-linked immunosorbent assay

[0112] Four weeks after vaccination with the OVA model vaccine, orbital venous blood was collected from mice. After standing at room temperature for 2 hours, serum samples were obtained by centrifugation at 3000 rpm for 10 minutes at 4°C, aliquoted, and stored at -80°C for later use. The OVA protein was dissolved and diluted with 1 x PBS to 10 μg / mL, and 50 μL / well was added to a 96-well ELISA plate. The plate was incubated overnight at 4°C for coating.

[0113] The next day, discard the coating solution and add 200 μL of PBST (1x PBS solution containing 0.05% Tween-20) to each well. Let stand for 2 minutes, then blot dry. Repeat 3 times. Next, add 200 μL of blocking buffer (1x PBS solution of 1% BSA) to each well and incubate at room temperature for 2 hours. Discard the buffer and wash 3 times with PBST, then blot dry. Serially dilute the serum samples to be tested and add 100 μL / well to the ELISA plate. Incubate at room temperature for 2 hours, then discard the buffer and wash 3 times with PBST, then blot dry. Then add 100 μL / well of goat anti-mouse IgG-HRP, goat anti-mouse IgG1-HRP, and goat anti-mouse IgG2c-HRP (1:5000 dilution) to each well and incubate at room temperature for 2 hours. Discard the buffer. After washing with PBST 6 times and patting dry, add 100 μL / well of TMB chromogenic solution and develop at room temperature in the dark for 30 minutes. Then add 80 μL / well of stop solution to stop the chromogenic process and immediately place the well on a microplate reader to detect the OD value at 450 nm.

[0114] 6. Experimental Results

[0115] To evaluate the safety of therapeutic vaccines and investigate whether candidate therapies cause systemic, nonspecific immunosuppression, mice were pretreated with therapeutic vaccines and various immunosuppressants for two weeks, and then immunized with an OVA model vaccine unrelated to lupus. Four weeks later, the specific immune response induced by the model vaccine was detected. Figure 3 In the figure, A represents peripheral blood flow cytometry analysis, which revealed that the therapeutic vaccine did not impair the body's ability to respond to OVA-induced immune responses, while other immunosuppressants such as cyclophosphamide (CTX) effectively inhibited OVA-specific immune responses. Compared with the CTX and rapamycin groups, the therapeutic vaccine did not hinder the vaccine-induced immune response in the OVA model, specifically manifested in the presence of OVA-specific CD8+ in peripheral blood. + T cells were significantly increased, while OVA-specific CD8 cells were present in the CTX and rapamycin groups. + T cells were significantly reduced; flow cytometry staining was performed on spleen lymph nodes. Figure 3 B in the figure represents the immune cells in lymph nodes detected by flow cytometry. It was found that the immune response level in the therapeutic vaccine group was not different from that in the OVA model vaccine group alone, while the immune response in the treatment group with broad-spectrum inhibitors such as cyclophosphamide was significantly suppressed. This indicates that the therapeutic vaccine group had OVA-specific CD8+. + T cells increased, and germinal center B cells (GCBs) also increased significantly, while OVA-specific CD8 cells were present in the CTX and rapamycin groups. + T cells and GCB cells were significantly reduced; in addition... Figure 3 In the figure, C represents the detection of anti-OVA antibodies in mouse serum. We found that the level of anti-OVA antibodies produced by mice in the therapeutic vaccine group was significantly increased, consistent with the OVA model vaccine group alone, and the antibody titer was significantly higher than that in the rapamycin and CTX treatment groups.

[0116] The above results demonstrate that, compared to other immunosuppressant treatments, the therapeutic vaccine of this invention does not cause OVA-specific immunosuppression, preserves the body's ability to respond to normal immune responses, and highlights its significant safety advantages.

[0117] Example 7: Subcutaneous inoculation of autoantigen alone had no therapeutic effect on the R848-induced lupus mouse model.

[0118] To evaluate whether subcutaneous administration of autoantigen alone has a therapeutic effect on an induced lupus mouse model, we pretreated mice with autoantigen, therapeutic vaccine or immunosuppressant for two weeks, and then induced the lupus model by applying R848 to the skin of the mouse ears. We monitored the survival rate for 4 weeks after R848 induction and treated the animals 4 weeks later.

[0119] 1. Preparation of autoantigen chromatin and drug inoculation

[0120] The experimental groups were as follows: (1) blank control group (no modeling) 5 mice; (2) R848 modeling group 8 mice; (3) R848 modeling + autoantigen treatment group 8 mice; (4) R848 modeling + dexamethasone treatment group 6 mice; (5) R848 modeling + rapamycin treatment group 5 mice; (6) R848 modeling + therapeutic vaccine group 5 mice. The preparation method of autoantigen chromatin was the same as in Example 1; the therapeutic vaccine was the same as in Example 1.

[0121] Group (1) blank control group received no treatment; Group (2) R848 modeling group received only R848 to induce lupus modeling; Group (3) R848 modeling + autoantigen subcutaneous injection group: autoantigen injection protocol: prepare 2 mg / mL chromatin working solution, anesthetize C57BL / 6J mice in an air anesthesia machine and inject subcutaneously, 100 μL per mouse per injection, for three consecutive days, and booster injection after two weeks; Group (4) R848 modeling + dexamethasone treatment group: dexamethasone injection protocol: as a common clinical hormonal immunosuppressant, it was set as a positive control drug in this example, anesthetize C57BL / 6J mice in an air anesthesia machine and inject subcutaneously, prepare dexamethasone working solution at a dose of 1.5 mg / kg and administer intraperitoneally, 200 μL per mouse per injection, three times a week for 6 weeks. Group (5) R848 modeling + rapamycin alone group: C57BL / 6J mice were anesthetized with an air anesthesia machine and then subcutaneously injected with rapamycin at a dose of 1 mg / kg per mouse, three times a week for 6 weeks. Group (6) R848 modeling + therapeutic vaccine group: C57BL / 6J mice were anesthetized with an air anesthesia machine and then subcutaneously injected with the therapeutic vaccine of Example 1, 100 μL / time, for three consecutive days, with a booster vaccination two weeks later.

[0122] 2. Establishment of a resimilar (R848)-induced systemic lupus erythematosus model in C57BL / 6J mice.

[0123] After treatment in step 1, 100 μg of resimilarto (R848) was applied to the skin of the right ear of each group of mice three times a week for four consecutive weeks. The blank control group did not receive this treatment.

[0124] 3. Enzyme-linked immunosorbent assay

[0125] The detection method is the same as in Example 4.

[0126] 4. Urine protein and urine creatinine tests

[0127] Test according to the instructions for the Nanjing Jiancheng reagent kits (product numbers: C035-2-1 and C011-2-1).

[0128] 5. Experimental Results

[0129] After applying R848 for four weeks, Figure 4 In the figure, A represents the survival curves of mice in each group during the experimental process. We found that during the induction of lupus modeling, compared with the non-modeling group and the dexamethasone treatment group, the inoculation of autoantigen alone did not alleviate the progression of the disease in mice. The survival rate of mice in the autoantigen inoculation treatment group and the simple modeling group was significantly reduced. Figure 4 In the figure, B represents the level of anti-double-stranded DNA antibodies. The level of anti-double-stranded DNA antibodies in the serum of the autoantigen vaccination treatment group was significantly increased, and not lower than the antibody level in the spontaneous lupus model MRL / LPR mice. These results indicate that subcutaneous administration of the autoantigen alone in the therapeutic vaccine of this invention does not have a therapeutic effect and may even aggravate the disease; it must be combined with rapamycin to achieve a preventive effect against systemic lupus erythematosus.

Claims

1. A therapeutic vaccine for systemic lupus erythematosus, characterized in that, The therapeutic vaccine comprises chromatin and rapamycin.

2. The therapeutic vaccine for systemic lupus erythematosus according to claim 1, characterized in that, The mass ratio of chromatin to rapamycin is 1:1 to 5:

1.

3. The therapeutic vaccine for systemic lupus erythematosus according to claim 1, characterized in that, The chromatin is commercially purchased chromatin or lymphocyte chromatin extracted from animals.

4. The therapeutic vaccine for systemic lupus erythematosus according to claim 1, characterized in that, The therapeutic vaccine is administered as an injection.

5. A method for preparing a therapeutic vaccine for systemic lupus erythematosus according to any one of claims 1 to 4, characterized in that, Includes the following steps: (1) Rapamycin dry powder was dissolved in DMSO to prepare rapamycin stock solution; (2) The rapamycin stock solution and chromatin are mixed together to obtain the solution.

6. The use of the systemic lupus erythematosus therapeutic vaccine according to any one of claims 1 to 4 in the preparation of a medicament for the prevention and / or treatment of systemic lupus erythematosus.

7. The application according to claim 6, characterized in that, The systemic lupus erythematosus includes drug-induced lupus erythematosus or spontaneous lupus erythematosus.

8. The application according to claim 7, characterized in that, The drug-induced lupus includes imiquimod-induced lupus or rethimod-induced lupus.

9. The application according to claim 6, characterized in that, The drug is one that reduces the location of lupus-related lymph node swelling, reduces the incidence of skin lesions, induces immune tolerance with lower levels of urinary protein than untreated animals or humans, and / or induces immune tolerance with consistently lower levels of autoantibodies than untreated animals or humans.

10. The application according to claim 6, characterized in that, The drug is a drug that improves the phenotype of systemic lupus erythematosus, induces immune tolerance, significantly reduces the expression level of inflammatory cytokines, and / or increases the number of regulatory cells compared to untreated patients after inducing tolerance.

Images