Drugs targeting march4 to induce differentiation of tumor cells and uses thereof

Abstract

The application provides a drug for targeting MARCH4 to induce tumor cell differentiation and an application thereof, in particular, provides application of E3 ubiquitin ligase MARCH4 as a target in screening and / or preparation of a drug for tumor differentiation treatment or in preparation of a preparation for inducing tumor cell differentiation, application of an E3 ubiquitin ligase MARCH4 antagonist in preparation of a drug and / or a preparation for inducing tumor cell differentiation, application of a reagent for detecting an expression level of E3 ubiquitin ligase MARCH4 in preparation of a detection agent for evaluating prognosis and survival period of a tumor patient after immunotherapy / chemotherapy, and an E3 ubiquitin ligase MARCH4 antagonist, a drug for tumor differentiation treatment and related applications.

Description

Technical Field

[0001] This invention relates to a drug that targets MARCH4 to induce tumor cell differentiation and its application, specifically to a drug that induces tumor cells to reverse to a normal or benign phenotype by downregulating the expression level of the E3 ubiquitin ligase MARCH4, and the use of this drug in tumor treatment, belonging to the field of biomedical technology. Background Technology

[0002] Differentiation therapy is a treatment strategy that inhibits tumor proliferation and promotes apoptosis by inducing malignant tumor cells to redifferentiate, restore their normal phenotype, or reach terminal maturity. Unlike traditional cytotoxic chemotherapy, this strategy does not directly kill tumor cells but reverses their malignant phenotype by regulating cell differentiation-related signaling pathways. The most successful example of differentiation therapy is the combination of all-trans retinoic acid (ATRA) and arsenic in the treatment of acute promyelocytic leukemia (APL). ATRA induces promyelocytic cells carrying the PML (Promyelocytic leukemia)-RARα fusion gene to differentiate into mature granulocytes by binding to the retinoic acid receptor (RAR)α, ​​making APL a curable type of leukemia. This breakthrough demonstrated the feasibility of differentiation-induced strategies in the treatment of malignant tumors and spurred further exploration of this strategy in solid tumors. However, differentiation therapy for solid tumors faces greater challenges.

[0003] Compared with hematologic malignancies, solid tumors have a more complex microenvironment, higher heterogeneity, and a more disordered differentiation regulatory network. Taking lung cancer as an example, although early studies suggested that retinoic acid compounds may have anti-cancer effects, no evidence of differentiation induction has been found, and no studies have been conducted to evaluate the differentiation-inducing effect of retinoic acid on lung cancer. The main reasons include: (1) Lung cancer cells often have high methylation of the RARβ receptor promoter or gene deletion, which leads to reduced sensitivity to retinoic acid; (2) Tumor cells have high expression of retinoic acid metabolizing enzymes (such as CYP26), which accelerates drug degradation; (3) There is a lack of effective differentiation markers to assess treatment response.

[0004] Lung cancer is broadly classified into two categories: small-cell lung carcinoma (SCLC, approximately 15%) and non-small-cell lung cancer (NSCLC, approximately 85%). The latter includes subtypes such as adenocarcinoma (approximately 50%) and squamous cell carcinoma (approximately 30%). In recent years, classification has shifted from morphological to molecularly guided precise classification, such as transcription factor-based SCLC subtypes (SCLC-A / N / P / Y) and NSCLC molecular subtypes like EGFR-mutant and ALK-fusion types. Over the past decade, omics technologies have deepened our understanding of lung cancer mechanisms, and the discovery of driver gene mutations has fundamentally changed the landscape of treatment. Tyrosine kinase inhibitors (TKIs) targeting EGFR L858R / 19del and ALK fusion have become standard treatments: EGFR-TKIs have extended median progression-free survival (PFS) from 4-6 months to 18-19 months, with osimertinib as first-line therapy achieving a median overall survival (OS) of 38.6 months; alectinib treatment for ALK-positive patients has achieved a median progression-free survival (PFS) of 34.8 months. Advances in adjuvant therapy after surgery have also been made, with the ADAURA trial showing an 88% 5-year OS rate with osimertinib adjuvant therapy and the ALINA trial showing a 93.6% DFS rate with alectinib adjuvant therapy after 2 years. However, drug resistance remains a significant challenge; T790M / C797S mutations, MET amplification, or ALK kinase domain mutations can all lead to treatment failure after EGFR-TKI treatment. While immunotherapy for driver gene-negative patients has seen breakthroughs, the overall 5-year survival rate still does not exceed 20%. Therefore, there is a significant clinical need to develop novel treatment strategies, especially precision treatments that target the biological characteristics of lung cancer.

[0005] The ubiquitin-proteasome system (UPS) is a major pathway for intracellular protein degradation, and E3 ubiquitin ligases determine substrate recognition specificity. The MARCH (Membrane-associated RING-CH) family is a class of E3 ubiquitin ligases located in the cell membrane system. All members contain an N-terminal transmembrane domain and a C-terminal RING-CH domain, and their main function is to regulate the internalization, sorting, and degradation of membrane proteins through ubiquitination modification. MARCH4 is an important member of the MARCH family. It was initially identified by Bartee et al. through binding experiments, who found that it interacts with the membrane protein B cell receptor associated protein 31 (Bap31). This protein is mainly located in the Golgi apparatus and endoplasmic reticulum and participates in the ubiquitination regulation of various membrane proteins, including MHC class I molecules, the Cluster of Differentiation (CD) protein CD4, and CD81. MARCH4 expression is tissue-specific, primarily expressed in the brain and placental tissues in normal humans. In recent years, the role of MARCH family members in tumorigenesis and development has gradually attracted attention. Studies have shown that MARCH7 is highly expressed in neural stem cells and hematopoietic stem cells, participating in neural differentiation and the maintenance of stem cell characteristics. MARCH8 expression in pancreatic cancer is associated with patient prognosis. However, research on the function of MARCH4 in tumors is relatively limited, and its role in tumorigenesis, development, and differentiation regulation has not yet been reported. Summary of the Invention

[0006] The inventors in this case discovered that MARCH4 is a key molecule for regulating tumor cell differentiation, and thus provided relevant applications of MARCH4 in inducing terminal differentiation of tumor cells.

[0007] On the one hand, the present invention provides the use of E3 ubiquitin ligase MARCH4 as a target in screening and / or preparing drugs for tumor differentiation therapy or preparations for inducing tumor cell differentiation.

[0008] On the other hand, the present invention also provides the use of E3 ubiquitin ligase MARCH4 antagonists in the preparation of drugs and / or formulations for inducing tumor cell differentiation.

[0009] According to a specific embodiment of the present invention, the E3 ubiquitin ligase MARCH4 antagonist comprises: Reagents that downregulate the expression level of the E3 ubiquitin ligase MARCH4; and / or A reagent to inhibit the activity of the E3 ubiquitin ligase MARCH4.

[0010] According to a specific embodiment of the present invention, the downregulation of the expression level of the E3 ubiquitin ligase MARCH4 includes inhibiting MARCH4 gene transcription, promoting MARCH4 mRNA degradation, and / or inhibiting MARCH4 protein synthesis.

[0011] On the other hand, the present invention also provides the application of reagents for detecting the expression level of E3 ubiquitin ligase MARCH4 in the preparation of diagnostic agents for assessing the prognosis and survival of cancer patients after ICI / CT treatment.

[0012] According to a specific embodiment of the present invention, the E3 ubiquitin ligase MARCH4 is used as a biomarker to predict the efficacy of tumor differentiation therapy.

[0013] According to a specific embodiment of the present invention, the efficacy assessment indicators include pathological complete response (pCR / MPR), objective response rate (ORR), or progression-free survival (PFS).

[0014] According to a specific embodiment of the present invention, any feasible method can be used to detect the expression level of MARCH4 in patient tumor tissue. For example, the detection methods include immunohistochemistry, Western blot, real-time quantitative PCR, or high-throughput sequencing. Patients with high MARCH4 expression are more sensitive to differentiation therapy.

[0015] Unless otherwise specified, "high expression" of MARCH4 as used herein means that if the MARCH4 protein expression level in a test sample is greater than or equal to 1.2 times the MARCH4 protein expression level in normal tissue (adjacent tissue), then the test sample is considered to have "high expression" of MARCH4. According to a specific embodiment of the present invention, the test sample may be a tumor tissue biopsy specimen, a surgically resected specimen, or circulating tumor cells.

[0016] According to a specific embodiment of the present invention, the tumor is a malignant tumor.

[0017] According to a specific embodiment of the present invention, the tumor is a solid tumor.

[0018] According to specific embodiments of the present invention, the tumors mentioned in the present invention include, but are not limited to, squamous cell carcinoma of the lung, adenocarcinoma of the lung, small cell lung cancer; one or more of the following: gastrointestinal tumors (e.g., squamous cell carcinoma of the esophagus, adenocarcinoma of the esophagus, gastric cancer, colorectal cancer), squamous cell carcinoma of the head and neck, cervical cancer, bladder cancer, and squamous cell carcinoma of the skin.

[0019] According to a specific embodiment of the present invention, the tumor is squamous cell carcinoma.

[0020] On the other hand, the present invention also provides an E3 ubiquitin ligase MARCH4 antagonist, comprising: (1) Knockdown of the expression level of E3 ubiquitin ligase MARCH4 using sgRNA, shRNA, or an antibody against E3 ubiquitin ligase MARCH4; and / or (2) Compounds that can activate retinoic acid receptor (RAR) and / or retinoic acid X receptor (RXR).

[0021] According to a specific embodiment of the present invention, the compound capable of activating retinoic acid receptor (RAR) and / or retinoic acid X receptor (RXR) includes one or more of the following compounds: (2-1) Natural retinoic acid or a pharmaceutically acceptable salt, ester or amide derivative thereof; optionally, the natural retinoic acid is selected from all-trans retinoic acid (ATRA), 9-cis retinoic acid, 13-cis retinoic acid or a combination thereof; (2-2) Synthesize a selective retinoic acid receptor agonist, wherein the synthesized selective retinoic acid receptor agonist is a RAR selective agonist or an RXR selective agonist; Optionally, the RAR selective agonist is selected from tazarotene, adapalene, amovitine, TTMNPB (4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid, or a pharmaceutically acceptable salt thereof; Optionally, the RXR selective agonist is selected from bexarotene, LG100268, or a pharmaceutically acceptable salt thereof; (2-3) Aryl retinoic acid compounds; Optionally, the aryl retinoic acid compound has an Ar¹-CH=CH-C(R¹)=C(R²)-COOH structure; wherein Ar¹ is a substituted or unsubstituted phenyl, naphthyl, or tetrahydronaphthyl; and R¹ and R² are independently selected from hydrogen, C1-C4 alkyl, or halogen.

[0022] According to a specific embodiment of the present invention, the E3 ubiquitin ligase MARCH4 antagonist can knock down the expression level of MARCH4 to "low expression", or antagonize or inhibit the activity of MARCH4 to a low expression level.

[0023] Unless otherwise specified, “low expression” of MARCH4 in this article means that if the MARCH4 protein expression level in a test sample is less than or equal to 0.8 times the MARCH4 protein expression level in normal tissue (adjacent tissue), then the test sample is judged to have “low expression” of MARCH4.

[0024] According to some specific embodiments of the present invention, the present invention provides shRNA that can be used to knock down the expression level of the E3 ubiquitin ligase MARCH4, comprising the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0025] SEQ ID NO: 1: CCAGTATTTCTTGGCTCATCTAGATGAGCCAAGAAATACTGG. SEQ ID NO: 2: CGTCATCGCCATAAGCACAAATTTGTGCTTATGGCGATGACG.

[0026] On the other hand, the present invention also provides a pharmaceutical composition comprising: (1) E3 ubiquitin ligase MARCH4 antagonist; and (2) One or more of the following: chemotherapy drugs, targeted drugs, immune checkpoint inhibitors or traditional Chinese medicine.

[0027] According to a specific embodiment of the present invention, the pharmaceutical composition of the present invention can induce lung cancer cells to differentiate into normal or benign phenotypes and inhibit their malignant proliferation.

[0028] According to a specific embodiment of the present invention, in the pharmaceutical composition of the present invention, the E3 ubiquitin ligase MARCH4 antagonist includes one or more of the E3 ubiquitin ligase MARCH4 antagonists of the present invention as described above.

[0029] According to a specific embodiment of the present invention, the chemotherapeutic drug in the pharmaceutical composition of the present invention includes one or more of platinum-based drugs (such as cisplatin, carboplatin, etc.), paclitaxel-based drugs (such as paclitaxel, docetaxel, etc.) or gemcitabine.

[0030] According to a specific embodiment of the present invention, the targeted drug in the pharmaceutical composition of the present invention includes one or more of EGFR inhibitors (such as erlotinib, gefitinib, etc.), ALK inhibitors (such as crizotinib) or VEGF inhibitors (such as bevacizumab).

[0031] According to a specific embodiment of the present invention, the immune checkpoint inhibitor in the pharmaceutical composition of the present invention includes one or more of anti-PD-1 antibodies (such as pembrolizumab, nivolumab) or anti-PD-L1 antibodies (such as atezolizumab, durvalumab, etc.).

[0032] According to a specific embodiment of the present invention, the traditional Chinese medicine in the pharmaceutical composition of the present invention includes one or more of Centipeda minima or its extract, Tripterygium wilfordii or its extract.

[0033] According to some specific embodiments of the present invention, the pharmaceutical composition of the present invention includes ATRA, an anti-PD-1 antibody, platinum-based chemotherapy, and paclitaxel. The corresponding treatment regimen is ATRA combined with an anti-PD-1 antibody and platinum / paclitaxel chemotherapy as neoadjuvant therapy.

[0034] According to specific embodiments of the present invention, the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier.

[0035] According to specific embodiments of the present invention, the drug of the present invention may be an oral preparation (such as tablets, capsules, granules), an injectable preparation (such as intravenous injection, lyophilized powder injection), an inhaled preparation (such as nebulized inhalation solution, dry powder inhaler), or a topical preparation (such as patch, ointment).

[0036] On the other hand, the present invention also provides the use of the pharmaceutical composition in the preparation of pharmaceutical formulations for tumor differentiation therapy.

[0037] According to a specific embodiment of the present invention, in the application of the pharmaceutical composition of the present invention, the drug is used to induce terminal differentiation of tumor cells, inhibit tumor growth, prevent tumor metastasis, reduce tumor recurrence rate and / or prolong patient survival.

[0038] According to a specific embodiment of the present invention, in the application of the pharmaceutical composition of the present invention, the differentiation is manifested as changes in cell morphology, cell cycle arrest, upregulation or downregulation of differentiation marker expression, or downregulation of stem cell marker expression.

[0039] According to specific embodiments of the present invention, in the application of the pharmaceutical composition of the present invention, the drug may be used alone or in combination with radiotherapy, chemotherapy, immunotherapy, or targeted therapy. The combination use includes simultaneous administration or sequential administration in chronological order. Optionally, the drug may be administered to the subject simultaneously or separately, either in combination with other drugs or independently, at time intervals; the time interval being 0-24 hours.

[0040] According to a specific embodiment of the present invention, in the application of the pharmaceutical composition of the present invention, the drug is used for preoperative neoadjuvant therapy, postoperative adjuvant therapy, and first-line or second-line treatment for patients with advanced lung cancer.

[0041] According to a specific embodiment of the present invention, in the application of the pharmaceutical composition of the present invention, the pharmaceutical preparation is an oral preparation, an injectable preparation, an inhaled preparation, or a topical administration preparation.

[0042] In some specific embodiments of the present invention, in mouse cancer models, the body weight of mice treated with retinoic acid drugs (all-trans retinoic acid, bexarotine) was not significantly different from that of the control group, indicating that retinoic acid drugs did not produce significant toxic side effects on mice.

[0043] In some specific embodiments of the present invention, retinoids can significantly enhance the antitumor effect of immune checkpoint inhibitors. Experimental results show that the combined use of retinoids and anti-PD-L1 antibodies (αPD-L1) exhibits a stronger antitumor effect. Retinoids increase tumor infiltration CD8... + T-cell enhancement of αPD-L1 efficacy.

[0044] According to a specific embodiment of the present invention, in the application of the pharmaceutical composition of the present invention, the tumor is a solid tumor.

[0045] According to specific embodiments of the present invention, in the application of the pharmaceutical composition of the present invention, the tumor includes, but is not limited to, one or more of the following: squamous cell carcinoma of the lung, adenocarcinoma of the lung, small cell lung cancer; gastrointestinal tumors (e.g., squamous cell carcinoma of the esophagus, adenocarcinoma of the esophagus, gastric cancer, colorectal cancer), squamous cell carcinoma of the head and neck, cervical cancer, bladder cancer, and squamous cell carcinoma of the skin.

[0046] According to a specific embodiment of the present invention, in the application of the pharmaceutical composition of the present invention, the tumor is squamous cell carcinoma.

[0047] On the other hand, the present invention also provides a method for inducing lung cancer cell differentiation, comprising contacting an effective amount of the above-mentioned drug with lung cancer cells to induce the cells to differentiate into a normal or benign phenotype.

[0048] According to a specific embodiment of the present invention, the contact can be performed externally or internally.

[0049] According to a specific embodiment of the present invention, the in vivo administration route includes oral, intravenous injection, inhalation, or local administration.

[0050] According to a specific embodiment of the present invention, the present invention induces lung cancer cell differentiation by downregulating the expression or activity of the E3 ubiquitin ligase MARCH4; the differentiation is manifested by changes in cell morphology (such as smaller cell volume and decreased cell nucleus-cytoplasm ratio), cell cycle arrest (such as G0 / G1 phase arrest), upregulation of differentiation marker expression or downregulation of stem cell marker expression.

[0051] According to some specific embodiments of the present invention, the method for inducing lung cancer cell differentiation is not for therapeutic purposes.

[0052] In some specific embodiments of the present invention, the present invention provides clinical evidence of successful differentiation induction in the treatment of squamous cell carcinoma of the lung by combining MARCH4 inhibitors with chemotherapy and immune checkpoint inhibitors. Eleven patients with squamous cell carcinoma of the lung underwent ATRA combined with chemotherapy and immune checkpoint inhibitor treatment, and pathological examination and efficacy evaluation were performed. Eight of these patients achieved pathological complete response (pCR) or major pathological response (MPR), demonstrating significant clinical translational potential.

[0053] Overall, this invention reveals that the E3 ubiquitin ligase MARCH4 is highly expressed in lung cancer stem cells or poorly differentiated cells, but its expression is significantly downregulated in retinoic acid-induced terminally differentiated cells. MARCH4 expression levels are negatively correlated with the degree of lung cancer cell differentiation, and downregulation of MARCH4 can effectively induce lung cancer cells to differentiate into normal phenotypes. This discovery fills a gap in the field of MARCH4 regulation of tumor differentiation and provides a new target for molecular subtyping and treatment of lung cancer. This invention establishes a novel strategy for inducing lung cancer cell differentiation by downregulating MARCH4. By elucidating the MARCH4-mediated differentiation mechanism, this invention provides a theoretical basis and experimental support for the application of retinoic acid drugs in lung cancer, expanding the clinical application scope of such drugs. The retinoic acid compounds provided by this invention induce terminal differentiation of lung cancer cells by specifically downregulating MARCH4 expression, rather than through direct cytotoxicity. This differentiation therapy strategy avoids the toxic side effects of traditional chemotherapy, is less likely to induce drug resistance, and can restore the normal function of tumor cells, possessing unique therapeutic advantages. This invention also provides a strategy for combined application with immune checkpoint inhibitors, targeted drugs, or traditional Chinese medicine to achieve synergistic anti-tumor effects. Furthermore, this invention provides MARCH4 as a biomarker for predicting the response of lung cancer patients to differentiation therapy. By detecting the expression level of MARCH4 in tumor tissue, suitable patient groups for differentiation therapy can be screened, achieving precision medicine. The drug components provided by this invention are clearly defined, and the mechanism of action is clear, allowing for the preparation of various dosage forms to suit different clinical scenarios (such as neoadjuvant therapy and advanced treatment). Compared with existing treatment methods, this invention has advantages such as high specificity, low toxicity and side effects, and the ability to overcome drug resistance, showing promising prospects for translational applications. Attached Figure Description

[0054] Figures 1A to 1D The study showed a correlation between MARCH4 expression levels and prognosis and treatment response in lung cancer patients. Among these, Figure 1A Overall survival analysis of patients with high and low MARCH4 expression is shown. P-values ​​were determined using the log-rank test. Tumor samples from 24 patients who underwent ICI / CT treatment were analyzed for MARCH4 immunohistochemistry (IHC). Figure 1BThese are representative images from immunohistochemical experiments. Figure 1C The results of the Immunoreactive Score (IRS) are displayed. Figure 1D The statistical results are displayed.

[0055] Figures 2A to 2D This study demonstrates the effects of retinoic acid compounds on lung cancer cell differentiation at the cellular level. Among them, Figure 2A Lung cancer cells were treated with all-trans retinoic acid (ATRA) for 15 days, collected, stained with hematoxylin and eosin (H&E), and observed and imaged under a microscope. Figure 2B Displaying statistical analysis of cell nuclear area. Figure 2C The results of transmission electron microscopy (TEM) observations are shown. Figure 2D The results of the cell nucleus area calculation are displayed.

[0056] Figure 3A and Figure 3B This study investigated the effects of retinoic acid compounds on the expression of differentiation markers in lung cancer cells. Specifically, lung squamous cell carcinoma cells H520 and H226 were treated with specified concentrations of ATRA and BXRT for 48 hours, respectively. After lysis, proteins were extracted, and Western blot (WB) was performed using specified antibodies to detect protein markers.

[0057] Figures 4A to 4E The effects of retinoic acid compounds on lung cancer cell differentiation were demonstrated using patient-derived organoids (PDOs) and mouse models. Figure 4A The morphological changes of patient-derived organoids after 15 days of treatment with 10 μM ATRA or BXRT were observed and photographed under a microscope. Figure 4B Organoids derived from a 48-year-old female patient with poorly differentiated lung cancer were treated with ATRA / BXRT for 15 days, fixed, and then subjected to multiplex immunohistochemistry (mIHC) to detect the expression of cell markers. Figure 4C H520 cells (2×10⁻⁶) were injected intravenously. 5 A xenograft model was constructed subcutaneously in NCG mice. After ATRA treatment (50 or 100 mg / kg / day for 14 days), the mice were sacrificed, and the lung tumor tissue was stained with H&E. Figure 4D Effect of ATRA treatment on the nuclear area of ​​tumor cells in H520 tumor-bearing mice. Figure 4E The expression of cellular markers in lung tumor tissues of mice in the ATRA treatment group and the control group was analyzed by mIHC.

[0058] Figures 5A to 5F This study demonstrates the effect of MARCH4 on lung cancer cell differentiation. Among other things, Figure 5A H520 cells were transfected with a virus containing a shMARCH4 knockdown plasmid for 7 days. Cells grown on coverslips were then stained with hematoxylin and eosin (H&E) to analyze morphological changes. Figure 5B The results of the cell nucleus area calculation are displayed. Figure 5C H520 cells were transfected with shMARCH4 and lysed 48 hours later. Western blot analysis of the proteins was performed using the indicated antibody. Figure 5D H520 cells were transfected with PCDH-MARCH4, then treated with ATRA / BXRT, H&E staining was performed, and the cells were observed and imaged under a microscope. Figure 5E The results of the cell nucleus area measurement are shown. Figure 5F H520 cells were transfected with PCDH-MARCH4, then treated with ATRA / BXRT, and after lysis, were detected by Western blot using the indicated antibody.

[0059] Figures 6A to 6D This shows the results of ATRA-induced tumor cell differentiation analysis in lung cancer patients. Among them, Figure 6A The pathological response rate and baseline demographic characteristics of 8 patients treated with ATRA combined with αPD-L1 and chemotherapy (ATRA / αPD-L1 / CT) were analyzed (Un: unknown). Figure 6B H&E staining of tumor tissues before and after surgery in patients with cases 6-8 (ATRA / αPD-L1 / CT treatment) and case 9 (αPD-L1 / CT treatment). Figure 6C Quantitative analysis of tumor cell nuclear area before and after surgery: 3 slides for each patient, 100 cancer cells were counted in each slide. Figure 6D The expression of differentiation-related markers was detected by multiple immunohistochemistry (mIHC) in tumor tissues before and after surgery. Detailed Implementation

[0060] To better understand the above technical solutions, exemplary embodiments of the present invention will be described in more detail below with reference to the accompanying drawings and experiments. While exemplary embodiments of the present invention are shown in the drawings and experiments, it should be understood that those skilled in the art can implement the present invention in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present invention and to fully convey the scope of the invention to those skilled in the art.

[0061] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, the two endpoints of each numerical range and any value between the two endpoints may be selected.

[0062] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art.

[0063] In addition to the specific methods, equipment, and materials used in the embodiments, based on the knowledge of those skilled in the art and the description of this invention, any prior art methods, equipment, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention can be used to implement this invention. Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in this field.

[0064] Example 1

[0065] Tissue samples were collected from lung cancer surgery patients, flash-frozen in liquid nitrogen, and Western blot was used to detect the expression level of MARCH4 in different lung cancer patients. MARCH4 expression levels were standardized (corrected for each patient's MARCH4 protein expression level against internal reference and normal tissue expression levels), and patients were divided into high-expression and low-expression groups using a tumor / normal (T / N) ratio of 1.2 as the cut-off value. Overall survival was analyzed using the Kaplan-Meier method for patients with high and low MARCH4 expression; results are shown below. Figure 1A The log-rank test was used for intergroup comparisons.

[0066] Tumor samples from 24 patients before ICI / CT treatment were collected, and MARCH4 immunohistochemistry (IHC) was used to detect the expression level of MARCH4 molecules in lung tissues with different treatment effects (MARCH4, thermo, 1:100). The results are as follows: Figures 1B to 1D As shown, Figure 1B As representative images, Figure 1C The immunohistochemical immunoreactive score (IRS) for each patient is displayed. Figure 1D The statistical results are displayed. In the figure, PR: Partial response, the sum of the largest diameters of the target tumor lesions decreased by ≥30% and remained so for at least 4 weeks; SD: Stable disease, the sum of the largest diameters of the target tumor lesions decreased but did not reach PR, or increased but did not reach PD; PD: Progressive disease, the sum of the largest diameters of the target tumor lesions increased by at least ≥20%, or new lesions appeared. TNM: Tumor node metastasis. LUSC: Lung squamous cell carcinoma. LUAD: Lung adenocarcinoma. SCLC: Small-cell lung carcinoma.

[0067] The results of this embodiment show that high expression of MARCH4 in tumor tissue is associated with poor treatment efficacy.

[0068] Example 2

[0069] Human lung cancer cell lines H520 and H1703 were purchased from the American Type Culture Collection (ATCC) and cultured in RPMI-1640 medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator. Human lung cancer cell line SK-MES-1 was also purchased from ATCC and cultured in EMEM medium containing 10% fetal bovine serum at 37°C in a 5% CO2 incubator.

[0070] Lung cancer cells (H520, H1703, etc.) were seeded in culture dishes and cultured to the logarithmic growth phase. The experimental group was treated with all-trans retinoic acid (ATRA, 0-10 μM) for 15 days, while the control group was treated with an equal volume of solvent (DMSO). After treatment, cells were collected, fixed with 4% paraformaldehyde, and stained with hematoxylin and eosin (H&E). Cell morphological changes were observed and photographed under a light microscope. The nuclear area was measured and statistically analyzed using HALO software to assess the degree of cell differentiation.

[0071] Figure 2A This is a microscopic image of a cell. Figure 2B The results of statistical analysis of cell nuclear area using HALO software showed that ATRA treatment significantly reduced the cell nuclear area, accompanied by an increase in the number of nucleoli and microvilli.

[0072] H520 cells were treated with ATRA (10 μM) or bexarotin (BXRT, 10 μM) for 15 days, respectively. Cells were collected, fixed with 2.5% glutaraldehyde, then post-fixed with 1% osmium tetroxide, dehydrated with a gradient of acetone, embedded in Epon 812 resin, and ultrathinly sectioned (70 nm). After uranyl acetate-lead citrate double staining, the ultrastructural changes of the cells were observed under a transmission electron microscope (TEM), focusing on nuclear morphology, nucleocytoplasmic ratio, and the formation of cell junction structures (such as desmosomes). Simultaneously, the nuclear area was quantitatively analyzed to verify the differentiation-inducing effect. Figure 2C , Figure 2D ).

[0073] The results of this embodiment show that both ATRA and bexarotine can induce lung cancer cells to differentiate into normal cells.

[0074] Example 3

[0075] This study investigated the effects of all-trans retinoic acid (ATRA) and bexarotine on the expression of MARCH4 and differentiation-related markers in lung cancer cells.

[0076] Cell culture: Human lung cancer cell lines H520 and H226 were purchased from the American Type Culture Collection (ATCC). H520 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum, and H226 cells were cultured in DMEM medium containing 10% fetal bovine serum. Both were cultured routinely in an incubator at 37°C and 5% CO2.

[0077] Drug treatment: All-trans retinoic acid (ATRA) and bexarotene were purchased from Selleck. H520 and H226 cells in logarithmic growth phase were seeded in 6-well plates and cultured for 24 hours. Then, ATRA or bexarotene were added to a final concentration of 2.5-10 μM, respectively. The control group was treated with an equal volume of solvent (DMSO). After culturing for another 48 hours, cells were collected for Western blotting (WB). The antibodies for WB were purchased from CST, Abcam, and Protein Tech.

[0078] Figure 3A and Figure 3B This study investigated the effects of retinoic acid compounds on the expression of differentiation markers in lung cancer cells. The results showed that the expression of squamous cell carcinoma markers keratin (Keratin14, Keratin10), TP63, and TGM1, which are highly expressed in tumor cells, was significantly reduced after ATRA treatment; simultaneously, the expression levels of normal lung goblet cell differentiation markers (SCGB1A1, MUC5AC, SPDEF, ZG16B) were significantly increased.

[0079] The results of this embodiment show that all-trans retinoic acid (ATRA) and bexarotine can inhibit the expression of MARCH4 in lung cancer cells and induce lung cancer cells to differentiate into normal lung cells.

[0080] Example 4

[0081] This embodiment uses patient-derived organoids (PDO) and immunodeficient mouse xenograft models to verify the effect of retinoic acid compounds in inducing lung cancer cell differentiation.

[0082] Patient-Derived Organoid (PDO) Culture and Drug Treatment: Tumor tissue surgically removed from a 48-year-old female patient with poorly differentiated lung cancer was mechanically sheared into 1-2 mm³ pieces. After collagenase digestion, the cell pellet was collected by centrifugation, mixed with Matrigel, and seeded into 24-well plates. Lung cancer organoid culture medium containing growth factors such as EGF, Noggin, and R-spondin was added, and the plates were incubated at 37°C in a 5% CO2 incubator. After organoid formation, the cells were divided into a control group (0.1% DMSO), an ATRA group (10 μM), and a BXRT group (10 μM). Treatment continued for 15 days, with fresh culture medium containing the corresponding drugs replaced every 3 days. After treatment, morphological changes in some organoids were directly observed and photographed under an inverted microscope. Figure 4A Some organoids were fixed in 4% paraformaldehyde, embedded in paraffin, and 4 μm sections were prepared for multiplex immunohistochemical (mIHC) staining to detect the expression levels of cell differentiation markers (such as KRT10, SPDEF, MUC5AC, etc.). Figure 4B ).

[0083] Establishment of mouse xenograft model and drug intervention: 2×10 5 H520 cells were injected via tail vein into 6-8 week old immunodeficient NCG mice (Jicui Pharmaceutical Biotechnology Co., Ltd.) to construct a lung metastasis model. After tumor formation, mice were randomly divided into a control group (solvent), a low-dose ATRA group (50 mg / kg / day), and a high-dose ATRA group (100 mg / kg / day), with 6 mice in each group. Mice in each group were administered the drug via gavage daily for 14 consecutive days. Mice were sacrificed 24 hours after the last administration, and lung tissue was harvested, fixed in 4% paraformaldehyde, embedded in paraffin, and prepared into 5 μm sections. H&E staining was performed, and the morphology of tumor nodules was observed and photographed under an optical microscope. The area of ​​tumor cell nuclei was measured using ImageJ software. Figure 4C , Figure 4D ).

[0084] Another portion of tumor tissue sections were taken for mIHC staining to detect the expression of cell differentiation markers, and the differences in differentiation marker expression between the ATRA treatment group and the control group were compared. Figure 4E ).

[0085] The results of this embodiment show that ATRA can induce lung cancer cells to differentiate into normal cells at the level of organoid (PDO) models and mice, thereby inhibiting lung cancer progression.

[0086] Example 5

[0087] Knockdown experiment: The shMARCH4 plasmid was constructed using the PLKO.1 lentiviral vector, and the shMARCH4 and shNC stably transfected H520 cell lines were constructed using a lentiviral packaging system. Two shRNAs were designed: shMARCH4-1 (#1), CCAGTATTTCTTGGCTCATCTAGATGAGCCAAGAAATACTGG (SEQ ID NO: 1); shMARCH4-2 (#2), CGTCATCGCCATAAGCACAAATTTGTGCTTATGGCGATGACG (SEQ ID NO: 2). The stably knocked-down MARCH4 cell line (H520-shMARCH4) and the control cell line (H520-shNC) were subjected to cell slide treatment. After 7 days, cells on coverslips were collected for H&E staining to observe cell morphology and measure nuclear area. Figure 5A , Figure 5B Cell lysates were collected 48 hours after transfection, and Western blot was used to detect the expression levels of MARCH4 and differentiation markers. Figure 5C ).

[0088] Overexpression complementation assay: A stable MARCH4 overexpressing H520 cell line was constructed using a PCDH lentiviral vector. The stable MARCH4 overexpressing cell line (H520-PCDH-MARCH4) and the control cell line (H520-PCDH-NC) were subjected to cell slide treatment. After 24 hours, 10 μM ATRA or BXRT was added for 15 days. H&E staining was used to observe cell morphology and nuclear area was measured. Figure 5D , Figure 5E Cell lysates were collected 48 hours after treatment, and Western blot was used to verify the inhibitory effect of MARCH4 overexpression on differentiation. Figure 5F ).

[0089] The experimental results of this embodiment demonstrate that MARCH4 can be used as a target for screening drugs that induce lung cancer cells to differentiate into normal cells.

[0090] Example 6

[0091] This prospective clinical study validated the efficacy of all-trans retinoic acid (ATRA) combined with PD-1 blockade and chemotherapy as neoadjuvant therapy in inducing tumor cell differentiation in patients with resectable lung cancer (LUSC). Patients with histopathologically confirmed resectable stage IB-IVA lung cancer who had not previously received antitumor therapy, had an ECOG performance status score of 0-1, and normal major organ function were included. Patients received 2-4 cycles of neoadjuvant therapy, specifically: ATRA 20 mg orally three times daily (tid) on days 1-14; anti-PD-1 antibody (αPD-1) 200 mg intravenously on days 1, 8, and 15; cisplatin 75 mg / m² intravenously on day 1; and paclitaxel 200 mg / m² intravenously on day 1; each cycle lasted 21 days. Efficacy was assessed after 2-4 cycles, and surgical resection was performed. Tumor tissue samples were collected before treatment (baseline) and after treatment (at surgery). The tissue samples were fixed in 4% paraformaldehyde, embedded in paraffin, and 5 μm sections were prepared. H&E staining was performed, and morphological changes of tumor cells were observed under a light microscope. Figure 6A ).

[0092] The nuclear area of ​​tumor cells was measured using HALO software. Three slides were randomly selected from each patient, and 100 cancer cells were counted on each slide. The average nuclear area was calculated, and the differences before and after treatment were compared. Figure 6B ).

[0093] Tumor tissue sections were collected before and after treatment and subjected to multiplex immunohistochemical (mIHC) staining to detect the expression of cell differentiation-related markers, including MHC-I (antigen presentation), SPDEF (secreting cell differentiation marker), MUC5AC (mucus differentiation marker), SCGB1A1 (Clara cell marker), and ZG16B (granule protein marker). Immunofluorescence staining combined with a multispectral imaging system was used to scan and quantitatively analyze the changes in fluorescence intensity of each marker to evaluate the molecular characteristics of tumor cell differentiation induced by ATRA combination therapy. Figure 6C ).

[0094] The pathological response rate was assessed based on changes in tumor histopathology before and after treatment, and the clinical efficacy of ATRA combined with PD-1 blockade and chemotherapy to induce lung cancer cell differentiation was analyzed. Figure 6D ).

[0095] The technical solutions of the present invention have been described in detail above with reference to specific embodiments. However, the above embodiments are only used to illustrate the technical concept of the present invention and are not intended to limit the scope of protection of the present invention. Those skilled in the art should understand that various modifications or substitutions can be made to the technical solutions involved in the present invention without departing from the overall technical concept of the present invention. Therefore, all equivalent substitutions, modifications, or improvements made to the present invention by those skilled in the art based on their understanding of the technical solutions of the present invention, as long as they do not depart from the technical concept and essence of the present invention, should fall within the scope of protection defined by the present invention.

Claims

1. The application of E3 ubiquitin ligase MARCH4 as a target in screening and / or preparing drugs for tumor differentiation therapy or preparations for inducing tumor cell differentiation.

2. Application of E3 ubiquitin ligase MARCH4 antagonists in the preparation of drugs and / or formulations for inducing tumor cell differentiation.

3. The application according to claim 2, wherein, E3 ubiquitin ligase MARCH4 antagonists include: Reagents that downregulate the expression level of the E3 ubiquitin ligase MARCH4; and / or A reagent to inhibit the activity of the E3 ubiquitin ligase MARCH4.

4. Application of reagents for detecting the expression level of E3 ubiquitin ligase MARCH4 in the preparation of assays for assessing prognosis and survival in cancer patients after immunotherapy / chemotherapy.

5. The application according to any one of claims 1-4, wherein, The tumor is a solid tumor; Optionally, the tumors include, but are not limited to, squamous cell carcinoma of the lung, adenocarcinoma of the lung, small cell lung cancer; one or more of the following: gastrointestinal tumors (e.g., squamous cell carcinoma of the esophagus, adenocarcinoma of the esophagus, gastric cancer, colorectal cancer), squamous cell carcinoma of the head and neck, cervical cancer, bladder cancer, and squamous cell carcinoma of the skin; Optionally, the tumor is squamous cell carcinoma.

6. An E3 ubiquitin ligase MARCH4 antagonist, comprising: (1) Knock down the expression level of E3 ubiquitin ligase MARCH4 using sgRNA, shRNA, or antibodies against E3 ubiquitin ligase MARCH4. and / or (2) Compounds that can activate retinoic acid receptors (RAR) and / or retinoic acid X receptors (RXR); Optionally, the compound capable of activating retinoic acid receptor (RAR) and / or retinoic acid X receptor (RXR) includes one or more of the following compounds: (2-1) Natural retinoic acid or a pharmaceutically acceptable salt, ester or amide derivative thereof; optionally, the natural retinoic acid is selected from all-trans retinoic acid, 9-cis retinoic acid, 13-cis retinoic acid or a combination thereof; (2-2) Synthesize a selective retinoic acid receptor agonist, wherein the synthesized selective retinoic acid receptor agonist is a RAR selective agonist or an RXR selective agonist; Optionally, the RAR selective agonist is selected from tazarotene, adapalene, amovitine, TTNPB (4-[(E)-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid or a pharmaceutically acceptable salt thereof; Optionally, the RXR selective agonist is selected from bexarotine, LG100268, or a pharmaceutically acceptable salt thereof; (2-3) Aryl retinoic acid compounds; Optionally, the aryl retinoic acid compound has an Ar¹-CH=CH-C(R¹)=C(R²)-COOH structure; wherein Ar¹ is a substituted or unsubstituted phenyl, naphthyl, or tetrahydronaphthyl; and R¹ and R² are independently selected from hydrogen, C1-C4 alkyl, or halogen.

7. A pharmaceutical composition comprising: (1) E3 ubiquitin ligase MARCH4 antagonist; as well as (2) One or more of the following: chemotherapy drugs, targeted drugs, immune checkpoint inhibitors or traditional Chinese medicine.

8. The pharmaceutical composition according to claim 7, wherein: The E3 ubiquitin ligase MARCH4 antagonist comprises one or more of the E3 ubiquitin ligase MARCH4 antagonists according to claim 6; The chemotherapy drugs include one or more of platinum-based drugs, taxane-based drugs, or gemcitabine; The targeted drug includes one or more of EGFR inhibitors, ALK inhibitors, or VEGF inhibitors; The immune checkpoint inhibitors include one or more of anti-PD-1 antibodies or anti-PD-L1 antibodies; The traditional Chinese medicine includes one or more of the following: Centipeda minima or its extract, Tripterygium wilfordii or its extract.

9. Use of the pharmaceutical composition of claim 7 or 8 in the preparation of a pharmaceutical formulation for the treatment of tumor differentiation.

10. The application according to claim 9, wherein, The drug is used to induce terminal differentiation of tumor cells, inhibit tumor growth, prevent tumor metastasis, reduce tumor recurrence rate, or prolong patient survival. Optionally, the differentiation is manifested as changes in cell morphology, cell cycle arrest, upregulation or downregulation of differentiation markers, or downregulation of stem cell markers. Optionally, the drug may be used alone or in combination with radiotherapy, chemotherapy, immunotherapy or targeted therapy; Optionally, the drug is used for preoperative neoadjuvant therapy, postoperative adjuvant therapy, or as first-line or second-line treatment for patients with advanced lung cancer; Optionally, the pharmaceutical preparation is an oral preparation, an injectable preparation, an inhaled preparation, or a topical preparation; Optionally, the tumor is a solid tumor; Optionally, the tumors include, but are not limited to, squamous cell carcinoma of the lung, adenocarcinoma of the lung, small cell lung cancer; one or more of the following: gastrointestinal tumors (e.g., squamous cell carcinoma of the esophagus, adenocarcinoma of the esophagus, gastric cancer, colorectal cancer), squamous cell carcinoma of the head and neck, cervical cancer, bladder cancer, and squamous cell carcinoma of the skin; Optionally, the tumor is squamous cell carcinoma.

Images