Use of an xpo1 inhibitor in modulating the level of lactacidation of tumor cells by inhibiting the nuclear export of aars1

CN122828129APending Publication Date: 2026-09-29南昌大学第一附属医院
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611328835.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-31
Publication Date
2026-09-29

AI Technical Summary

Technical Problem

目前XPO1抑制剂塞利尼索已在2019年由国家药品监督管理局批准上市,但尚无报道发现XPO1对AARS1蛋白核质定位的调控

Benefits of technology

1)本发明首次发现,XPO1抑制剂不仅能够抑制肿瘤细胞生长,还能够显著调节肿瘤细胞整体乳酸化水平;

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122828129A_ABST
    Figure CN122828129A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedical technology, specifically relating to the application of XPO1 inhibitors in regulating the lactation level of tumor cells by inhibiting AARS1 nucleocytoplasmic transport. This invention discovers that XPO1 inhibitors not only inhibit tumor cell growth but also significantly regulate the overall lactation level of tumor cells, particularly inhibiting AARS1-mediated histone lactation, especially the lactation modification of H3K18la, thereby significantly improving anti-tumor effects. The XPO1 inhibitors of this invention provide a new strategy and method for tumor treatment and possess potential clinical translational value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of XPO1 inhibitors in regulating the lactation level of tumor cells by inhibiting nucleocytoplasmic transport of AARS1. Background Technology

[0002] AARS1 (alanyl-tRNA synthetase 1), a classic class II aminoacyl-tRNA synthetase, has the core function of catalyzing the reaction of alanine with homologous tRNA during protein translation. Ala AARS1 undergoes specific aminoacylation reactions and corrects incorrectly coupled amino acids by editing its domains, ensuring the accuracy and efficiency of protein synthesis. In addition to maintaining intracellular translational homeostasis, recent studies have revealed its important non-classical "part-time function": AARS1 acts as an intracellular lactate receptor and lactate transferase, directly utilizing lactate and ATP to catalyze the lactation of lysine residues in histones and non-histone proteins, regulating gene transcription and signaling pathways under metabolic stress conditions such as hypoxia and the tumor microenvironment. Existing research shows that AARS1 regulates key molecules such as YAP, p53, and cGAS through lactation modification, participating in pathological processes such as tumor proliferation and metastasis, and tumor immunity. Current research on AARS1 is shifting from its classical translational function to the field of metabolic-epigenetic cross-regulation. Its mechanism of action as a key lactation enzyme in tumors and immune diseases is being continuously elucidated, making it a highly promising disease diagnostic biomarker and drug target. However, there are currently no AARS1 inhibitors on the market for clinical application.

[0003] XPO1 (Exportin 1, also known as CRM1) is a core nucleoplasmic transport protein responsible for recognizing proteins / RNAs containing leucine nuclear export signals (NES) and mediating their transport from the nucleus to the cytoplasm. In tumors, high expression / overactivation of XPO1 creates a dual pro-cancer effect: ① excessive export of tumor suppressor proteins such as p53, p21, RB, FOXO3a, and NPM1 to the cytoplasm, causing them to lose their nuclear transcriptional regulation, DNA repair, and apoptosis-inducing functions; ② promotion of the export of oncogenic proteins such as c-Myc, cyclin D, BCL-2, and NF-κB mRNA / proteins from the nucleus, driving proliferation, anti-apoptosis, drug resistance, and immune escape. Currently, the XPO1 inhibitor celinisoxol was approved for marketing by the National Medical Products Administration in 2019, but there are no reports of XPO1 regulating the nucleoplasmic localization of the AARS1 protein.

[0004] How to prove through nuclear proteomics, molecular docking, and Western blotting experiments that XPO1 inhibitors will block AARS1 in the cell nucleus and thus affect the overall protein lactation level of tumor cells is a problem that this invention urgently needs to solve. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides the application of XPO1 inhibitors in regulating lactation levels in tumor cells by inhibiting nucleocytoplasmic transport of AARS1. The XPO1 inhibitors of this invention offer novel strategies and methods for tumor treatment and have broad clinical application prospects.

[0006] To achieve the above objectives, the first aspect of the present invention provides the use of an XPO1 inhibitor in the preparation of a medicament for inhibiting or reducing the lactation level of tumor cells by inhibiting nucleoplasmic transport of AARS1.

[0007] Furthermore, the XPO1 inhibitor works through at least one of the following mechanisms: (1) Inhibit AARS1-mediated histone lactation, the histone lactation including lactation modification of lysine at position 18 of histone H3 (H3K18la). (2) Downregulates the expression of lactate dehydrogenase (LDHA) in tumor cells; (3) Reduce the transcription level of galactosyllectrin-12 (LGALS12), promote lipophagy of tumor cells and inhibit the growth of tumor cells, especially acute myeloid leukemia (AML) cells.

[0008] Furthermore, the XPO1 inhibitor is selected from at least one of selinexor, eltanexor, leptomycin B, and verdinexor.

[0009] Furthermore, the inhibition of AARS1-mediated histone lactation specifically involves the XPO1 inhibitor altering the nucleocytoplasmic localization of AARS1 protein, inducing nuclear retention of AARS1, increasing the level of AARS1 protein in the nucleus, and decreasing the content of AARS1 protein in the cytoplasm. AARS1-induced protein lactation requires the binding of lactyl groups in the cytoplasm; therefore, altering the nucleocytoplasmic localization of AARS1 can further reduce the level of AARS1-catalyzed lactation at the histone H3K18 site.

[0010] Furthermore, the drug includes a pharmaceutically acceptable carrier selected from one or more of physiological saline, phosphate buffer, biodegradable polymers, and liposomes.

[0011] Furthermore, the drug comprises at least one additional antitumor agent selected from at least one of chemotherapy drugs, immune checkpoint inhibitors, and targeted therapy drugs.

[0012] Furthermore, the additional antitumor agent is quezartinib.

[0013] Furthermore, the tumor is a hematologic malignancy.

[0014] A second aspect of the present invention provides a pharmaceutical composition for inhibiting AARS1-mediated histone lactation, comprising a therapeutically effective amount of an XPO1 inhibitor and a pharmaceutically acceptable carrier.

[0015] Furthermore, the pharmaceutical composition includes quezartinib.

[0016] Furthermore, the pharmaceutical composition can specifically reduce the lactation level at histone H3K18 sites.

[0017] Compared with the prior art, the present invention has at least the following beneficial effects: 1) This invention is the first to discover that XPO1 inhibitors can not only inhibit tumor cell growth, but also significantly regulate the overall lactation level of tumor cells; 2) This invention utilizes XPO1 inhibitors to induce nuclear retention of AARS1, inhibiting the lactation level of drug-resistant tumor cells, especially inhibiting AARS1-mediated histone lactation, particularly the lactation modification of H3K18la, thereby significantly improving the anti-tumor effect. 3) The technical solution provided by this invention has wide applicability and can be combined with various existing drug delivery systems and intervention methods, and has good clinical translation potential and application prospects. Attached Figure Description

[0018] Figure 1 A schematic diagram illustrating the mechanism by which the XPO1 inhibitor Eltanexor (ELT) regulates the nucleocytoplasmic localization of AARS1.

[0019] Figure 2 This is a schematic diagram of an in vitro experiment showing that the XPO1 inhibitor Eltanexor (ELT) reduces the level of lactic acidified protein in AML-resistant cells by regulating the nucleocytoplasmic localization of AARS1.

[0020] Figure 3 To suppress the XPO1-mediated AARS1 nuclear output process by Eltanexor (ELT).

[0021] Figure 4 Eltanexor (ELT) works in synergy with quizartinib (Qui) to downregulate histone lactation modification, remodeling chromatin open state and inhibiting transcription of LGALS12, a lipid metabolism-related target gene.

[0022] Figure 5 Eltanexor (ELT) in synergistic with quizartinib (Qui) induced lipophage in Vinecella-resistant FLT3 mutant AML cells Molm-13R and inhibited the FLT3 and XPO1 signaling pathways.

[0023] Figure 6 This is a schematic diagram of a pharmacodynamic study evaluating the efficacy and safety of the XPO1 inhibitor Eltanexor (ELT) in combination with quizartinib (Qui) in an in vivo animal model.

[0024] Figure 7 This is the chemical structural diagram of Eltanexor (ELT), an XPO1 inhibitor.

[0025] Figure 8 This is the chemical structural diagram of Selinexor, an XPO1 inhibitor. Detailed Implementation

[0026] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0027] Unless otherwise specified, the raw materials used in the following embodiments are all disclosed in the prior art, such as those that can be directly purchased or prepared according to the preparation methods disclosed in the prior art. Among them, RNAiso Plus (Takara, Japan); PrimeScript™ FAST RT reagent Kit with gDNA Eraser (Takara, Japan); TB Green® Premix Ex Taq™ II FAST qPCR (Takara, Japan); RPMI 1640 medium (31800, Solarbio, Beijing); fetal bovine serum (FSP500, ExCell Bio, Shanghai); quinzatinib (HY-13001, MCE, USA); Eltanexor (HY-100423, MCE, USA); Gln-AMS TFA (HY-112861A, MCE, USA); autophagy pathway detection kit (A562, Dojindo Laboratories, Kumamoto, Japan); nuclear and cytoplasmic protein extraction kit (P0028, Beyotime, Shanghai); BCA protein concentration assay kit (PC0020, Solarbio, Beijing); one-step PAGE gel rapid preparation kit (PG212, Yageo, Shanghai); ECL High-sensitivity chemiluminescence assay kit (GK10008, GlpBio, USA); Protein marker (26616, Thermo Fisher Scientific, USA); Pan-Kla antibody (SHBP0618, Baipu Biotechnology, Shanghai); FLT3 antibody (ER2001-25, Huaan Biotechnology, Wuhan); p-FLT3 antibody (YP0304, Immunoway, USA); p62 antibody (A19700, ABclonal, Wuhan); LC3B antibody (A19665, ABclonal, Wuhan); XPO1 antibody (ET7107-27, Huaan Biotechnology, Wuhan); c-Myc antibody (A19032, ABclonal, Wuhan); H3K18la antibody (PTM-1427RM, Jingjie Biotechnology, Hangzhou); Histone H3 antibody (PTM-1002RM, Jingjie Biotechnology, Hangzhou); H3K14la Antibodies (PTM-1429RM, Jingjie Biotechnology, Hangzhou); Pan-H4 antibody (PTM-1003RM, Jingjie Biotechnology, Hangzhou); H4K8la antibody (PTM-1415RM, Jingjie Biotechnology, Hangzhou); H4K12la antibody (PTM-1417RM, Jingjie Biotechnology, Hangzhou); H4K5la antibody (PTM-1413RM, Jingjie Biotechnology, Hangzhou); GAPDH antibody (60004-1-Ig, Wuhan Sanying, Wuhan);LDHA antibody (21799-1-AP, Wuhan Sanying, Wuhan); AARS1 antibody (17394-1-AP, Wuhan Sanying, Wuhan); Lamin B1 antibody (12987-1-AP, Wuhan Sanying, Wuhan); β-Tubulin antibody (66240-1-Ig, Wuhan Sanying, Wuhan); β-Actin antibody (66009-1-Ig, Wuhan Sanying, Wuhan); CoraLite488 goat anti-rabbit fluorescent secondary antibody (SA00013-2, Wuhan Sanying, Wuhan); CoraLite594 goat anti-mouse fluorescent secondary antibody (SA00012-4, Wuhan Sanying, Wuhan); LGALS12 primers (upstream (SEQ ID NO.1): GCCTGGGCAGGTCATCATAG, downstream (SEQ ID NO.2): GAGTTCTGTCTGCGAAGGAGG).

[0028] Example 1: Validation of the mechanism by which XPO1 inhibitors regulate the nucleocytoplasmic localization of AARS1 protein Nuclear proteomics analysis was performed using Eltanexor (ELT), a selective inhibitor of XPO1, to treat AML-resistant cells (Molm-13R), with an untreated control group. After treatment, nuclear proteins were isolated and purified using a nuclear protein extraction kit, and then quantified for labeled quantitative proteomics analysis. Differentially expressed nuclear proteins between the treated and control groups were plotted as a volcano plot; significantly upregulated differentially expressed proteins were enriched using KEGG-GSEA to assess the enrichment of the aminoacyl-tRNA biosynthesis pathway; and cluster heatmap analysis of core genes in this pathway was performed to visually demonstrate the changes in nuclear expression of each gene in the ELT monotherapy group and the ELT combined with the FLT3 inhibitor quezartinib (Qui) group.

[0029] AARS1 nuclear output signal (NES) sequence prediction utilizes the well-known online nuclear output signal prediction tool LocNES (http: / / prodata.swmed.edu / LocNES / LocNES.php) to scan and analyze the full-length amino acid sequence of human AARS1, screen and identify potential leucine-rich nuclear output signal (NES) candidate sequences, and record their positions, amino acid sequences and prediction scores.

[0030] Molecular docking simulation analysis was performed using the three-dimensional structures of AARS1, XPO1, and RanGTP obtained from protein databases to construct a model of the AARS1-XPO1-RanGTP complex. Interaction simulations were conducted using a protein-protein docking module. Energy optimization was used to select the preferred conformation with the lowest binding energy, and the binding of AARS1 to XPO1-RanGTP was presented in 3D structural form. The interactions between key amino acid residues (including hydrogen bonds, π-π stacking, and salt bridges) were analyzed.

[0031] 1.1 Nuclear proteomics reveals that XPO1 inhibition leads to nuclear enrichment of the aminoacyl-tRNA synthetase family. This invention, through systematic experimental design, from proteomics and bioinformatics predictions to molecular docking simulations, has demonstrated at multiple levels that XPO1 has a direct regulatory effect on the nuclear export of AARS1. Figure 1 As shown in Figure A, after treating tumor cells (such as Molm-13R cells) with the XPO1 selective inhibitor Eltanexor (ELT), nuclear proteins were extracted for differential proteomics analysis. Volcano plot results showed a large number of significantly upregulated nuclear proteins in the ELT-treated group compared to the control group (Con). Further KEGG-GSEA enrichment analysis (…) Figure 1 The left side of B in the diagram shows that the upregulated differentially expressed proteins exhibited significant enrichment signals in the "Aminoacyl-tRNA biosynthesis" pathway (NES=2.26, P<0.05). Cluster heatmap analysis of the core members of this pathway (…) Figure 1 The image (right side of B) clearly shows that in the Eltanexor (ELT) monotherapy group and the Eltanexor (ELT) combined with quinzatinib (Qui) group, the abundance of multiple family members, including alanyl-tRNA synthetase (AARS1) and AARS2, in the cell nucleus was significantly higher than in the control group. This finding is the first indication that inhibiting XPO1 function can specifically alter the nuclear distribution of aminoacyl-tRNA synthetases (especially AARS1).

[0032] 1.2 The AARS1 protein possesses a potential nuclear export signal sequence, and molecular docking simulations confirmed the stable binding of AARS1 to the XPO1-RanGTP complex. like Figure 1 As shown in C, this invention utilizes the widely accepted online nuclear output signal prediction tool LocNES to scan and analyze the full-length amino acid sequence of AARS1. The results successfully identified seven high-scoring potential leucine-rich nuclear output signal (NES) candidate sequences (scores ranging from 0.1 to 0.46), their specific locations and sequences are shown in the table (see [reference]). Figure 1As shown in C), the arrangement of these hydrophobic leucine residues conforms to the characteristics of the classic XPO1 recognition motif, constituting the potential structural basis for the direct binding and transport of AARS1 from the nucleus by the XPO1 protein. To verify the above prediction, this invention uses protein-protein docking technology to simulate the spatial interaction mode of the AARS1-XPO1-RanGTP complex. Figure 1 As shown in Figure D, in the lowest binding energy docking conformation, the AARS1 protein (blue region) can stably embed itself in the groove formed by XPO1 (yellow region) and RanGTP (purple region). Specific interatomic interaction analysis reveals multiple key binding sites between AARS1 and the XPO1-RanGTP complex: the Arg962 residue of AARS1 forms a hydrogen bond with the Asn167 residue of XPO1; the Phe958 residue of AARS1 forms a π-π stacking interaction with the Trp146 residue of XPO1; and the Lys943 residue of AARS1 forms both a hydrogen bond and a salt bridge with the Glu1037 residue of XPO1. These specific interactions located at the C-terminus (amino acids 943-962) of the AARS1 protein provide direct structural biological evidence for XPO1-mediated nuclear export of AARS1.

[0033] Example 2: Functional verification of XPO1 inhibitor regulating AARS1 nuclear retention and inhibiting downstream lactation modification As shown in Figure 2, this embodiment uses Western blotting to verify the molecular mechanism by which XPO1 inhibitors regulate the nucleoplasmic localization of AARS1 and inhibit lactation modification in tumor cells. Figure 2 As shown in Figure A, control, Eltanexor (ELT) monotherapy group, Quizatinib (Qui) monotherapy group, and Eltanexor (ELT) and Quizatinib (Qui) combination therapy group were set up for Molm-13 parental cells and Molm-13R resistant cells, respectively. Western blot results showed that, compared with the control group, Eltanexor (ELT) monotherapy downregulated the protein expression of lactate dehydrogenase LDHA and the global pan-lactation modification Pan-Kla level; the combination therapy of Eltanexor (ELT) and Quizatinib (Qui) had a more significant inhibitory effect on LDHA protein expression and Pan-Kla modification, with β-Actin used as an internal control. Figure 2As shown in Figure B, in Molm-13R resistant cells, compared with the control group, the combination therapy of Eltanexor (ELT) and quinzatinib (Qui) significantly downregulated histone lactation modification levels in H3K18la, demonstrating a synergistic effect of Eltanexor (ELT) and quinzatinib (Qui) in inhibiting histone lactation modification; Pan-H3 and Pan-H4 were used as histone loading internal controls, respectively. Figure 2 As shown in Figure C, a nuclear-cytoplasmic protein immunoblotting experiment was performed on Molm-13R resistant cells: Molm-13R cells were treated with Eltanexor (ELT) at concentrations of 0 nM, 30 nM, and 45 nM for 24 h, and nuclear and cytoplasmic protein components were extracted respectively. The results showed that with increasing Eltanexor (ELT) concentration, the expression level of AARS1 protein in the nuclear protein component gradually increased, resulting in AARS1 nuclear retention; the expression of AARS1 protein in the cytoplasmic protein component decreased accordingly. LaminB1 was used as an internal control for nuclear proteins, and β-Tubulin was used as an internal control for cytoplasmic proteins. These results confirm that the XPO1 inhibitor Eltanexor (ELT) can inhibit the nuclear export of AARS1, promoting the accumulation of AARS1 in the cell nucleus. Figure 2 As shown in Figure D, Molm-13R resistant cells were treated with 0 μM, 0.5 μM, and 1 μM Gln-AMS TFA for 24 h, and whole-cell protein samples were prepared for Western blotting analysis. The results showed that with increasing Gln-AMS TFA concentration, LDHA protein expression and H3K18la histone lactation modification levels decreased in a dose-dependent manner. Using Pan-H3 and β-Actin as internal controls, pharmacological analysis confirmed that AARS1 participates in regulating the lactation modification process of tumor cells. Figure 2 As shown in Figure E, three control groups were set up for Molm-13R resistant cells: a blank control group (CON), a negative control virus group (NC), and an AARS1 knockdown group (sh-AARS1). Western blot results showed that knockdown of the AARS1 gene significantly downregulated intracellular LDHA protein expression levels and H3K18la histone lactation modification levels. Pan-H3 and β-Actin were used as internal controls for sample loading to verify the regulatory role of AARS1 in cellular lactation modification at the gene intervention level.

[0034] like Figure 2As shown in F, the changes in protein expression of LDHA, H3K18la, and Pan-Kla pan-lactation modification were detected in Molm-13 parental cells and Molm-13R resistant cells after intervention with quezartinib (Qui). The results indicate that AARS1 knockdown enhances the inhibitory effect of quezartinib (Qui) on cellular lactation modification, further demonstrating that AARS1 is a key molecule regulating lactation modification in acute myeloid leukemia cells. Furthermore, Western blot analysis of the AARS1 knockdown strain constructed based on Molm-13R also showed that inhibiting AARS1 levels significantly reduced H3K18la lactation levels.

[0035] In summary, our experimental results indicate that the XPO1 inhibitor Eltanexor (ELT) can inhibit the nuclear export of AARS1 and induce its accumulation in the nucleus. The nuclear-accumulated AARS1 participates in regulating LDHA protein expression and the lactation modification levels of histones and global proteins. The combined use of the XPO1 inhibitor Eltanexor (ELT) and the FLT3 inhibitor quizartinib (Qui) can synergistically inhibit lactation modification in leukemia cells, thereby exerting an anti-leukemic effect.

[0036] Example 3: Eltanexor (ELT) Suppression of XPO1-Mediated AARS1 Nuclear Output Process To further verify the regulatory mechanism by which XPO1 inhibitors block AARS1 nuclear export and induce its nuclear retention, this invention combines immunofluorescence staining and immunoprecipitation experiments to systematically elucidate the molecular basis of ELT regulation of AARS1 subcellular localization.

[0037] like Figure 3 As shown in Figures A and B, AARS1 immunofluorescence staining was performed in two drug-resistant cell lines, Molm-13R and MV-411R. The results showed that in the control group, AARS1 fluorescence signal was mainly distributed in the cytoplasm. With increasing ELT concentration gradient, green fluorescently labeled AARS1 gradually accumulated in the DAPI-labeled nuclear region, and the relative fluorescence intensity of cytoplasmic AARS1 decreased in a dose-dependent manner. Quantitative analysis confirmed a statistically significant difference between the treated group and the control group. The panoramic image scale bar is 50 μm, and the local magnified field scale bar is 10 μm. These results indicate that ELT can induce AARS1 translocation from the cytoplasm to the nucleus and cause nuclear retention in a concentration-dependent manner.

[0038] To clarify the transporter on which AARS1 nuclear export depends, this invention investigated the endogenous binding of AARS1 to the nuclear export receptor XPO1 using a Co-IP experiment. Figure 3 As shown in C and D, in Molm-13R cells, immunoprecipitation with AARS1 antibody co-precipitated XPO1 protein, and conversely, reverse immunoprecipitation with XPO1 antibody also effectively captured AARS1 protein, while no specific binding signal was detected in the IgG negative control group. After knocking down AARS1 or XPO1 with shRNA, the co-precipitation signal was significantly weakened, confirming the existence of a stable endogenous protein complex of AARS1 and XPO1 in cells, and that XPO1 is a key transporter protein mediating AARS1 nuclear export. Based on this, to further confirm whether ELT directly interferes with the formation of this protein complex, this invention treated Molm-13R and MV-411R cells with gradient concentrations of ELT, then used IP-XPO1 to capture the complex and detected the binding content of AARS1. Figure 3 As shown in Figures E and F, the level of AARS1 protein co-precipitated with XPO1 antibody showed a significant decreasing trend with increasing ELT concentration, exhibiting a concentration-dependent weakening effect. Simultaneously, no significant changes were observed in the expression levels of AARS1 and XPO1 in the total protein input group, ruling out interference from differences in protein expression. These results confirm that ELT can directly interfere with the protein-protein interaction between XPO1 and AARS1, thereby inhibiting the formation of their complex in a concentration-dependent manner.

[0039] In summary, this invention demonstrates from a cell biology perspective that XPO1 is a key transport protein mediating AARS1 nuclear export. ELT directly disrupts the formation of the XPO1-AARS1 protein complex, blocking the AARS1 nuclear export pathway and thereby inducing a large accumulation of AARS1 in the cell nucleus. This discovery provides a crucial molecular mechanism basis for XPO1 inhibitors to inhibit downstream lactation modifications by regulating AARS1 nuclear retention.

[0040] Example 4: Eltanexor (ELT) in synergy with quizartinib (Qui) inhibits the transcription of LGALS12, a lipid metabolism-related target gene, by downregulating histone lactation modification to remodel chromatin open state. To investigate the global regulatory effect of the aforementioned histone lactation downregulation on chromatin state, this invention employed CUT&Tag sequencing technology to compare and analyze genome-wide chromatin binding signals between the control group (Molm13R_con) and the ELT-treated group (Molm13R_elt). Figure 4 As shown in Figures A and B, the CUT&Tag sequencing heatmap results indicate that the ELT-treated group showed a general decrease in chromatin binding signal across the entire genome compared to the control group, suggesting a widespread reduction in chromatin accessibility. Further analysis of the genome-wide average enrichment curve revealed a significant decrease in the enrichment intensity of the CUT&Tag signal within a 5 kb range upstream and downstream of the gene transcription start site after ELT treatment. The pie chart of genomic functional regions shows that the CUT&Tag enrichment peaks were mainly located in promoter regions, intron regions, and distal intergenic regions, indicating that the downregulation of lactation modifications induced by ELT primarily affects the chromatin accessibility of these regulatory regions.

[0041] To identify direct downstream target genes of ELT-regulated lactation modification, this invention performs Venn diagram cross-analysis on downregulated genes after ELT treatment in transcriptome sequencing and genes with weakened chromatin binding signals after ELT treatment in CUT&Tag sequencing. For example... Figure 4 As shown in C, the intersection of the two methods yielded several candidate target genes, including LGALS12, KISS1R, and TTC39B, among which LGALS12 was annotated as a key functional gene involved in lipid metabolism regulation. To verify the above screening results, this invention further used qPCR to quantitatively detect the mRNA expression level of LGALS12 in Molm-13R cells of each treatment group. Figure 4 As shown in D, the relative expression level of LGALS12 mRNA in the Eltanexor (ELT) monotherapy group was significantly lower than that in the control group; the downregulation of LGALS12 mRNA in the Eltanexor (ELT) combined with quizartinib (Qui) group was more pronounced than that in the monotherapy group. Figure 4 As shown in Figure E, the cut & run results further confirm that ELT monotherapy can reduce the binding signal in the promoter region of the LGALS12 gene, and this inhibitory effect is further enhanced after combination therapy. These results confirm that XPO1 inhibitors can inhibit the transcriptional activation of LGALS12, a key target gene in lipid metabolism, by downregulating histone lactation modification levels and inducing chromatin compression.

[0042] Example 5: Eltanexor (ELT) synergistically with quizartinib (Qui) induces lipophage in veneclade-resistant FLT3 mutant AML cells Molm-13R and inhibits the FLT3 and XPO1 signaling pathways. To further elucidate the regulatory effects of Eltanexor (ELT) combined with quizartinib (Qui) on lipid homeostasis and autophagy pathways in Venecella-resistant FLT3 mutant AML cells, this study systematically validated the effects using a combination of transmission electron microscopy, lipid droplet fluorescence staining, and Western blotting.

[0043] Transmission electron microscopy revealed that, compared with the control group and the single-drug treatment group, Molm-13R cells treated with Eltanexor (ELT) in combination with quinzatinib (Qui) exhibited a large number of autolysosomes formed by lipid droplets encapsulated in a double-membrane structure, suggesting that the combined treatment significantly activated the lipophagy process. Figure 5 A in the text). Further results from BODIPY lipid droplet fluorescence staining indicated that single-drug treatment only mildly reduced intracellular lipid droplet accumulation, while combination therapy significantly reduced the number and volume of lipid droplets, effectively reversing the abnormal lipid accumulation phenotype in drug-resistant cells. Figure 5 Image scale bar set to 50 μm (B in the image). Co-localization immunofluorescence analysis of LC3B and lipid droplets showed significant co-localization between LC3B-positive autophagy structures and lipid droplet signals in the combined treatment group, providing direct evidence for the combined regimen inducing lipophage in drug-resistant cells. Figure 5 C in the image; panoramic view scale bar 50 μm, local magnified area scale bar 10 μm). Western blot analysis results showed that Eltanexor (ELT) synergistically with quizartinib (Qui) upregulated the protein expression of the autophagy activation marker LC3B-II and promoted the degradation of the autophagy substrate p62, confirming that autophagy flux was fully activated under the combined treatment conditions. Figure 5 (D in the middle).

[0044] Furthermore, this study examined the expression changes of related signaling pathway proteins in the sensitive cell line Molm-13 and the drug-resistant cell line Molm-13R, respectively. The results showed that Eltanexor (ELT) synergistically with quinzatinib (Qui) simultaneously downregulated the protein levels of total FLT3, phosphorylated FLT3 (p-FLT3), and the nuclear transporter XPO1. These results indicate that the combined treatment, while inhibiting abnormal FLT3 kinase activation, can effectively block the XPO1-mediated nucleocytoplasmic transport process, exerting a multi-dimensional anti-drug-resistant leukemia effect. Figure 5 (E and F in the text). In summary, the combination of ELT and Qui can effectively kill vinecrate-resistant AML cells by inducing lipophage to clear abnormally accumulated intracellular lipids and synergistically inhibiting the FLT3 signaling pathway and XPO1 nucleocytoplasmic transport function.

[0045] Example 6: In vivo animal studies confirm the efficacy and safety of the XPO1 inhibitor combination regimen. The experimental protocol has been reviewed and approved by the Animal Ethics Research Committee of the Institute of Radiology, Chinese Academy of Medical Sciences (ethics number: IRM / 2-IACUC-2607-008).

[0046] A subcutaneous xenograft model of AML resistant cells was established to evaluate the in vivo antitumor effects of Eltanexor (ELT) alone and in combination with quinzatinib (Qui). Six- to eight-week-old female NOD / SCID mice (weighing 18-22 g) were purchased and housed in a specific pathogen-free (SPF) environment at a temperature of 22-26°C, relative humidity of 40-60%, and a 12-hour light-dark cycle. Sterile feed and water were provided freely. The animal experimental protocol was reviewed and approved by the animal ethics committee, and all procedures strictly followed the "Guidelines for the Care and Use of Laboratory Animals." Before cell injection, the hair in the right axillary region of each mouse was shaved, and the area was disinfected with 75% ethanol to ensure sterility. A 1 mL sterile syringe with a 27-gauge needle was used to inject 1×10⁻⁶ cells into the xenograft. 6 0.2 mL of Molm-13R cell suspension was subcutaneously injected into the prepared right axillary region to construct a subcutaneous xenograft model of AML drug-resistant cells.

[0047] Grouping of drugs and evaluation of efficacy: when the tumor volume grows to approximately 100 mm 3 Mice were randomly divided into four groups (n=8 per group): a model control group, an ELT monotherapy group (30 mg / kg, qd), a Qui monotherapy group (10 mg / kg, qd), and an ELT+Qui combination therapy group. Intraperitoneal injection was administered according to the protocol. Mouse weight and tumor volume were monitored and recorded every 2-3 days during treatment, and growth curves were plotted. Mice were sacrificed after treatment, tumor tissue was dissected and weighed, and the tumor growth inhibition effect of each group was evaluated. Histopathological and immunohistochemical analysis: After treatment, the spleen, liver, and tumor tissue of mice were fixed, embedded, and sectioned. HE staining was used to assess the pathological morphological changes of liver and spleen tissues to evaluate drug toxicity; CD45 and Ki67 immunohistochemical staining was performed on tumor tissue sections to observe changes in leukemia cell infiltration and proliferation activity in the tumor tissue.

[0048] This invention evaluated the in vivo efficacy and safety of an XPO1 inhibitor-based treatment strategy in a subcutaneous xenograft model of immunodeficient mice. Figure 6 As shown in Experiment A, this invention constructs a subcutaneous xenograft model of Molm-13R-resistant cells. Figure 6The B-scores showed that, compared with the control group, both Eltanexor (ELT) monotherapy (30 mg / kg qd) and quinzatinib (Qui) monotherapy (10 mg / kg qd) could delay tumor growth to some extent. The ELT combined with Qui group showed the most significant inhibition of tumor volume, characterized by a flattened tumor growth curve and the lowest tumor weight at the endpoint. Regarding safety, no significant decrease in body weight was observed in any group of mice during treatment (see [link to safety data]). Figure 6 The B-weight curve was observed, and after treatment, HE staining of the spleen and liver tissues revealed no significant histopathological damage (see [reference]). Figure 6 The results showed that the combination therapy regimen had good in vivo tolerability and safety. Immunohistochemical staining analysis was performed on the excised tumor tissue. The results showed that the proportion of Ki67-positive cells, a proliferation marker, in the tumor tissue was significantly reduced in the combination therapy group, indicating that the tumor cell proliferation activity was inhibited. At the same time, the infiltration of human CD45-positive immune cells also showed a decreasing trend, which may be related to the improvement of the immunosuppressive state caused by the reduction of tumor burden and the decrease in the level of lactation modification of the tumor microenvironment.

[0049] like Figure 7 As shown, the present invention provides the chemical structural formula of the XPO1 inhibitor Eltanexor (ELT).

[0050] like Figure 8 As shown, the present invention provides the chemical structural formula of the XPO1 inhibitor Selinexor.

[0051] The above description is merely a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and variations that are directly derived or conceived by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included within the protection scope of the present invention.

Claims

1. Application of XPO1 inhibitors in the preparation of drugs for inhibiting or reducing the lactation level of tumor cells by inhibiting nucleoplasmic transport of AARS1.

2. The application according to claim 1, characterized in that, The XPO1 inhibitor works through at least one of the following mechanisms: (1) Inhibit AARS1-mediated histone lactation, wherein the histone lactation includes lactation modification of lysine residue 18 of histone H3; (2) Downregulates the expression of lactate dehydrogenase in tumor cells; (3) Reduce the transcription level of galactoglobulin-12, promote lipophagy of tumor cells and inhibit tumor cell growth.

3. The application according to claim 2, characterized in that, The XPO1 inhibitor is selected from at least one of celiniso, atetaniso, leprosycin B, and verdinexor.

4. The application according to claim 2, characterized in that, The inhibition of AARS1-mediated histone lactation specifically involves: XPO1 inhibitors altering the nucleocytoplasmic localization of AARS1 protein, inducing nuclear retention of AARS1, increasing the level of AARS1 protein in the cell nucleus, and decreasing the content of AARS1 protein in the cytoplasm.

5. The application according to claim 2, characterized in that, The drug includes a pharmaceutically acceptable carrier selected from one or more of physiological saline, phosphate buffer, biodegradable polymer, and liposomes.

6. The application according to claim 2, characterized in that, The drug contains at least one additional antitumor agent, which is selected from at least one of chemotherapy drugs, immune checkpoint inhibitors, and targeted therapy drugs.

7. The application according to claim 6, characterized in that, The additional antitumor agent is quezartinib.

8. The application according to claim 1, characterized in that, The tumor in question is a hematologic malignancy.

9. A pharmaceutical composition for inhibiting AARS1-mediated histone lactation, characterized in that, It contains an XPO1 inhibitor and a pharmaceutically acceptable carrier.

10. The pharmaceutical composition according to claim 9, characterized in that, The pharmaceutical composition includes quezartinib.