A liver cancer synergistic therapeutic drug composition jointly targeting myc and bysl and application thereof

CN122828131APending Publication Date: 2026-09-29GANNAN MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611232933.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-14
Publication Date
2026-09-29

AI Technical Summary

Technical Problem

目前尚无研究揭示MYC与BYSL在HCC中存在直接转录调控关系

Benefits of technology

[0021]本发明首次证实MYC直接转录激活BYSL,构建全新MYC-BYSL肝癌促癌通路;且同步抑制MYC与BYSL的体外抑瘤效果显著优于单靶点,双重阻断通路实现增效;完整阐明BYSL缺失通过核仁应激RPL5/RPL11-MDM2-p53通路,同步阻滞周期、促凋亡、抑制肿瘤转移,多重抑癌机制协同起效;抑癌作用严格依赖野生型p53,可精准筛选适用肝癌患者,避免无效治疗;BYSL可作为肝癌诊断与预后标志物。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122828131A_ABST
    Figure CN122828131A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biological medicine targeted therapy, and discloses a liver cancer synergistic treatment drug composition for MYC and BYSL combined targeting and application thereof, wherein the active ingredients of the drug composition comprise a therapeutically effective amount of a MYC inhibitor and a therapeutically effective amount of a BYSL inhibitor. The present application comprehensively clarifies the direct regulation relationship between MYC and BYSL, the core carcinogenic function of BYSL in HCC, proposes the great potential of combined targeting of MYC and downstream gene BYSL, fills the technical blank of MYC-BYSL combined targeting of liver cancer, and provides a new strategy for precise treatment of hepatocellular carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of targeted therapy technology in biomedicine, and more specifically, to a synergistic therapeutic composition for liver cancer targeting MYC and BYSL, and its application. Background Technology

[0002] Liver cancer ranks sixth in global incidence and third in mortality among cancers, with hepatocellular carcinoma (HCC) accounting for approximately 75%-85% of all liver cancers. Its high mortality rate is closely related to difficulties in early diagnosis, high metastasis rates, high postoperative recurrence rates, and limited treatment options. Although surgical resection, liver transplantation, local ablation, and targeted drugs (such as sorafenib and lenvatinib) have been used clinically, most patients are diagnosed at an advanced stage and are prone to developing drug resistance, resulting in unsatisfactory overall treatment outcomes. Therefore, finding new molecular targets to combat the development and progression of HCC is crucial.

[0003] Ribosome biosynthesis (Ribi) and protein synthesis are fundamental to cell growth and proliferation, playing a crucial role in maintaining the growth and proliferation of tumor cells. Aberrant activation of ribosome biosynthesis plays a significant role in cancer initiation and progression, and has become an emerging anti-cancer target. The proto-oncogene MYC promotes cell growth and proliferation by enhancing ribosome biosynthesis (Ribi) and protein translation, primarily due to its key role in stimulating the transcription of genes encoding multiple essential Ribi proteins. BYSL, encoding the human Bystin protein, is located between TRFP and CCND3 on chromosome 6. Cytoplasm-localized BYSL forms a complex with trophoblastic hormones and tastin, regulating blastocyst adhesion to the endometrial epithelium and accompanying rapid cell proliferation and invasion. Given the similarities between embryo implantation and cancer cell invasion, BYSL may play a potential role in cancer metastasis. BYSL, located in the nucleolus, is a key factor in the Ribi process, participating in 18S rRNA processing and the maturation of the 40S ribosomal small subunit. Currently, no studies have revealed a direct transcriptional regulatory relationship between MYC and BYSL in HCC. The main objective of this invention is to explore the regulatory relationship between MYC and BYSL and the specific mechanism of action of BYSL, a downstream target gene of MYC, in HCC, aiming to provide new insights for clinical combined targeted therapy. Summary of the Invention

[0004] To address the problems in related technologies, this invention proposes a synergistic therapeutic composition for liver cancer targeting MYC and BYSL, and its application, in order to overcome the aforementioned technical problems existing in the prior art.

[0005] This invention is the first to experimentally verify the transcriptional activation relationship of MYC on BYSL. Furthermore, by integrating multi-omics data from TCGA, CPTAC, and other sources, as well as clinical samples, it was confirmed that BYSL is universally upregulated at both the transcriptional and protein levels in HCC cells and tissues, and its high expression is significantly associated with poor patient prognosis.

[0006] This invention further demonstrates in an in vitro model using gene editing technology (CRISPR / Cas9) that knocking out the BYSL gene can significantly inhibit the growth, proliferation, migration, and invasion of HCC cells, while inducing cell cycle G1 / S phase arrest and promoting apoptosis.

[0007] This invention further explores a novel downstream molecular mechanism by which BYSL functions in HCC: BYSL deficiency can induce nucleolar stress, inhibit the synthesis of intracellular proteins, and further activate the RPL5 / RPL11-MDM2-p53 tumor suppressor axis. This inhibits the binding of MDM2 to p53, promotes p53 accumulation, and initiates downstream effector programs of p53. These include upregulating the cell cycle inhibitor p21, the pro-apoptotic factor Bax, and the epithelial marker E-cadherin, and downregulating the anti-apoptotic factor Bcl-2 and the mesenchymal marker N-cadherin, thereby synergistically exerting tumor suppressive effects by inhibiting the cell cycle, promoting apoptosis, and inhibiting epithelial-mesenchymal transition (EMT).

[0008] Based on the novel mechanism of action described above, which has not been revealed by existing technologies, this invention proposes a new use for treating hepatocellular carcinoma, especially p53 wild-type hepatocellular carcinoma, by combining MYC and its downstream key effector BYSL.

[0009] Therefore, the specific technical solution adopted by the present invention is as follows:

[0010] According to a first aspect of the present invention, a synergistic therapeutic composition for liver cancer targeting MYC and BYSL is provided, wherein the active ingredient of the pharmaceutical composition comprises:

[0011] Therapeutic effective doses of MYC inhibitors, and

[0012] Therapeutic doses of BYSL inhibitors.

[0013] Furthermore, the pharmaceutical composition also contains a pharmaceutically acceptable carrier or excipient.

[0014] Furthermore, the MYC inhibitor is any one of small molecule inhibitors, MYC-targeting siRNA, shRNA, antisense oligonucleotides, and MYC protein degraders.

[0015] Furthermore, the BYSL inhibitor is any one of the following: siRNA, shRNA, CRISPR / Cas9 editing system, antisense oligonucleotide, BYSL neutralizing antibody, BYSL small molecule inhibitor, and BYSL protein degrader.

[0016] Furthermore, the combination of the MYC inhibitor and the BYSL inhibitor can synergistically inhibit the proliferation, colony formation, migration and invasion of p53 wild-type hepatocellular carcinoma cells, and induce cell cycle G1 / S arrest and apoptosis.

[0017] According to a second aspect of the present invention, there is provided the use of a synergistic therapeutic composition for liver cancer targeting MYC and BYSL in the preparation of a drug for the prevention or treatment of p53 wild-type hepatocellular carcinoma.

[0018] According to a third aspect of the invention, a kit for treating p53 wild-type hepatocellular carcinoma is provided, comprising a therapeutically effective amount of a MYC inhibitor and a therapeutically effective amount of a BYSL inhibitor, the kit may further include instructions for using the MYC inhibitor and the BYSL inhibitor.

[0019] According to a fourth aspect of the present invention, a method for treating p53 wild-type hepatocellular carcinoma is provided, the method comprising administering, in combination, a therapeutically effective amount of a MYC inhibitor and a BYSL inhibitor to a patient with p53 wild-type hepatocellular carcinoma in need.

[0020] Compared with the prior art, the present invention provides a synergistic therapeutic composition for liver cancer targeting MYC and BYSL and its application, which has the following beneficial effects:

[0021] This invention is the first to demonstrate that MYC directly transcribes and activates BYSL, constructing a novel MYC-BYSL hepatocellular carcinoma (HCC) pro-tumor pathway. Furthermore, the in vitro tumor-suppressive effect of simultaneously inhibiting MYC and BYSL is significantly better than that of a single target, with the dual-blocking pathway achieving synergistic effects. It fully elucidates that BYSL deficiency, through nucleolar stress RPL5 / RPL11-MDM2-p53 pathway, simultaneously blocks cell cycle, promotes apoptosis, and inhibits tumor metastasis, with multiple tumor-suppressive mechanisms working synergistically. The tumor-suppressive effect is strictly dependent on wild-type p53, allowing for precise screening of suitable HCC patients and avoiding ineffective treatment. BYSL can serve as a diagnostic and prognostic biomarker for HCC. Attached Figure Description

[0022] The accompanying drawings, which are included to provide a further understanding of this application and form part of this application, illustrate exemplary embodiments and are used to explain this application, but do not constitute an undue limitation of this application. In the drawings:

[0023] Figure 1MYC is an upstream transcription factor of BYSL. A. Visualization analysis using the UCSC genome browser with Cistrome DB ChIP-seq data showed that MYC can bind to the BYSL gene promoter. B. Dual-luciferase reporter assays showed that MYC enhances the transcriptional activity of BYSL;

[0024] Figure 2 MYC can promote the transcriptional activity of BYSL. AC. After overexpression of the MYC plasmid in 293T(A) and MHCC97H(B) / HepG2(C) cells, changes in intracellular BYSL mRNA expression levels could be detected 48 hours after transfection. D. After overexpression of the MYC plasmid in 293T, MHCC97H, and HepG2 cells, changes in BYSL expression levels could be detected 72 hours after transfection.

[0025] Figure 3 MYC can promote the transcriptional activity of BYSL. A. After transfecting HepG2 and MHCC97H cells with specific siRNAs targeting MYC and BYSL, respectively, the protein expression levels of MYC and BYSL could be detected 72 hours after transfection. B. After treating HepG2 and MHCC97H cells with MYC small molecule inhibitors at concentrations of 50 μM and 100 μM, respectively, the expression levels of MYC and BYSL could be detected 24 hours after treatment.

[0026] Figure 4 The proliferation rate of HepG2 / MHCC97H cells was examined after co-transfection with siMYC and siBYSL. A. CCK-8 assay showed that co-transfection with specific siMYC and siBYSL significantly inhibited the proliferation rate of HepG2 and MHCC97H cells; B. Colony formation assay showed that co-transfection with specific siMYC and siBYSL significantly weakened the proliferation ability of HepG2 and MHCC97H cells.

[0027] Figure 5. Expression analysis of BYSL in hepatocellular carcinoma. A. TCGA data showed the difference in BYSL mRNA expression between hepatocellular carcinoma and normal tissues. B. GSE microarray data of BYSL in the NCBI database showed the difference in BYSL mRNA expression between hepatocellular carcinoma and normal tissues. C. BYSL expression was detected in TMA of 48 randomly selected HCC tissues (T) and their matched adjacent normal tissues (P) using IHC detection. Quantitative analysis of BYSL expression in adjacent normal tissues (P) and HCC tissues (T) was performed based on the IHC score of HCC TMA. Data are the mean ± standard deviation of three independent experiments. *p<0.05; **p<0.01; ***p<0.001. D. Western blotting analysis was performed on the expression levels of BYSL in five pairs of clinical HCC tumor tissues (T) and their adjacent non-tumor tissues (P).

[0028] Figure 6 Analysis of the prognostic and diagnostic value of BYSL in hepatocellular carcinoma. A. Kaplan-Meier survival curves of patients in high and low BYSL expression groups. B. BYSL has high diagnostic value in HCC (AUC=0.8749).

[0029] Figure 7 Knockout of BYSL inhibited the proliferation of HCC cells. AB. The success rate of BYSL gene knockout in HepG2 (A) and MHCC97H (B) cells was detected by Western blot. The right side shows the quantitative results of BYSL protein levels. CD. MTT assay showed that the proliferation rate of HepG2 (C) and MHCC97H (D) cells decreased after BYSL knockout. E. Plate colony assay showed that the proliferation capacity of BYSL-knockout HepG2 (top) and MHCC97H (bottom) cells was weakened. Data are expressed as mean ± standard deviation of three independent experiments. *P<0.05; **P<0.01; ***P<0.001;

[0030] Figure 8 Knockout of BYSL induced cell cycle arrest and promoted apoptosis in HCC cells. AB. FACS analysis showed an increase in G1 / G0 phase cells and a decrease in S and G2 / M phase cells in BYSL-knockout HepG2 (A) and MHCC97H (B) cells. CD. FACS analysis showed an increased apoptosis index in BYSL-knockout HepG2 (C) and MHCC97H (D) cells compared to the control group. Data are expressed as mean ± standard deviation of three independent experiments. *P<0.05; **P<0.01; ***P<0.001;

[0031] Figure 9Knockout of BYSL inhibited the migration and invasion of HCC cells. AB. Scratch assays showed that the migration ability of BYSL-knockout HepG2(A) and MHCC97H(B) cells was inhibited at 0 and 48 hours. Scale bar: 250 μm. CD. Transwell invasion assays showed that the migration / invasion ability of BYSL-knockout HepG2(L) / MHCC97H(M) cells and their control group was impaired at 24 hours. Scale bar: 100 μm. Data are expressed as mean ± standard deviation of three independent experiments. *P<0.05; **P<0.01; ***P<0.001;

[0032] Figure 10 BYSL knockout induces nucleolar stress in HCC cells and inhibits the synthesis of nascent proteins. A. Immunofluorescence staining of NPM1 (red) in HepG2 and MHCC97H cells. DAPI (blue) staining marks the cell nuclei. B. Analysis of overall protein synthesis in BYSL knockout HepG2 and MHCC97H cells by O-propargyl-purinemycin labeling. The right side shows the statistical analysis results of relative nascent protein levels;

[0033] Figure 11 . BYSL knockout modulates the RPL5 / RPL11-MDM2-p53 pathway. AB. Co-IP in HepG2(A) and MHCC97H(B) confirmed enhanced binding of RPL5 / RPL11 to MDM2 and weakened binding of p53 to MDM2. C. Cells were transfected with a plasmid encoding ub-HA and incubated with 10 mM MG132 for 3 h. p53 was immunoprecipitated from cell lysates with an anti-p53 antibody, and p53 ubiquitination levels were analyzed by Western blot with an anti-HA antibody. DE. BYSL knockout slowed p53 protein degradation in HepG2(D) and MHCC97H(E) cells. Cells were treated with cyclohexylimide (CHX, 10 mg / mL) at specified time intervals. Western blot analysis was performed to analyze changes in p53 half-life.

[0034] Figure 12 Knocking out BYSL stabilizes p53 and activates downstream p53-expressing genes. BYSL gene knockout regulates p53 expression and the expression of p53-responsive genes (including P21, Bax, BCL2, CDH1, and CDH2).

[0035] Figure 13Verification of the dependence of BYSL action on p53 state. A. The success rate of BYSL gene knockout in Hep3b cells was detected by Western blot, and the quantitative results of BYSL protein level are shown on the right. B. BYSL gene knockout did not affect the proliferation rate (B) and colony formation ability (C) of Hep3b cells, as determined by MTT assay and colony formation assay, respectively. D. The proportion of BYSL gene knockout Hep3b cells in the G0 / G1, G2 / M, and S phases of cell division was analyzed by flow cytometry. E. The apoptosis rate of BYSL gene knockout Hep3b cells was determined by flow cytometry. F. The motility (F) and migration / invasion ability (G) of BYSL gene knockout Hep3b cells were detected by scratch assay and Transwell invasion assay, respectively. Detailed Implementation

[0036] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0037] Example 1: Transcriptional Regulation Analysis of MYC and BYSL

[0038] First, the binding site of MYC to BYSL was predicted using the JASPAR website, and further verified by a dual-luciferase assay. A luciferase reporter gene plasmid was constructed by constructing a 2000 bp sequence upstream of the BYSL transcription start site into the PGL4.10 vector. pRL-TK was used as an internal control reporter gene, and pCDNA3.1 was used as a control plasmid for MYC expression (both plasmids were purchased from Shanghai Quanyang Biotechnology Co., Ltd.). 293T cells in logarithmic growth phase were seeded at 3 × 10⁴ cells per well in opaque white 96-well plates, divided into three groups with three replicates per group. Transfection was performed transiently after 24 hours. The control group was not transfected, while the control and experimental groups were co-transfected with 0.2 μg of plasmid. After 8 hours, the medium was replaced with DMEM complete medium. After culturing for another 36 hours, 80 μL of culture medium and firefly luciferase assay reagent were added according to the requirements of the glow-type dual-luciferase reporter gene assay kit (YESEN, 11405ES60). The chemiluminescence values ​​were measured using a multi-functional microplate reader and recorded as F1, F2, and F3, respectively. Then, 80 μL of Renilla luciferase assay reagent was added to the test wells, and the luminescence values ​​were recorded as R1, R2, and R3. The experimental group ratio was calculated as (F3-F1) / (R3-R1), and the control group ratio was calculated as (F2-F1) / (R2-R1). The fold change in expression was calculated as the experimental group ratio / the control group ratio. The results showed that the fold change in expression in the experimental group was increased, indicating that MYC can bind to the promoter of BYSL.

[0039] Experimental results are as follows Figure 1 As shown in Figure A, visualization analysis using the UCSC (University of California, Santa Cruz) Genome Explorer, based on ChIP-seq (chromatin immunoprecipitation sequencing) data from the Cistrome DB (cis-regulatory group database), indicates that MYC can bind to the BYSL gene promoter. Figure 1 Dual-luciferase reporter assays of B showed that MYC enhances the transcriptional activity of BYSL. These results indicate that MYC is an upstream transcription factor of BYSL.

[0040] Figure 1In the table, 8107-treat.bw represents the treated sample, used for subsequent visualization of signal peaks in the genome browser; GENCODE V48 (9 items filtered out) indicates that the latest version of GENCODE gene annotation was used, and 9 transcripts that did not meet the analysis criteria were manually filtered out; RefSeq genes from NCBI indicates that the NCBI RefSeq database was used as a reference for gene definition; MANE Select Plus Clinics: Representative transcript from RefSeq & GENCODE indicates the clinically relevant major transcripts jointly identified by RefSeq and GENCODE; BYSLpromoter indicates the BYSL gene promoter; MYC plasmids indicate MYC expression plasmids; and Relative luciferase activity indicates relative luciferase activity.

[0041] Furthermore, to further explore the regulatory relationship between MYC and BYSL, MYC was overexpressed in 293T / HepG2 / MHCC-97H cells, and the changes in the mRNA and protein levels of MYC and BYSL were analyzed. The specific steps are as follows: Digested 293T / HepG2MHCC-97H cells were seeded in six-well plates and cultured until the cell density reached approximately 60%, then transfected. 5 μg of MYC plasmid solution (purchased from Miaoling Plasmid Platform, P48530) was added to a 1.5 mL EP tube and mixed with 300 μL of DMEM basal medium. In another tube, 15 μL of PEI transfection reagent was added to 300 μL of DMEM basal medium, and the mixture was incubated at room temperature for 15 min. The mixture was then added to the six-well plates, and 2 mL of basal medium was added. After 10 h of transfection, the medium was replaced with complete DMEM. RNA was extracted for qPCR analysis 48 h later. Total RNA (Invitrogen) was purified using TRIzol reagent and used as a template for cDNA synthesis, followed by reverse transcription using the Full Gold assay kit (catalog number: AE311). Quantitative RT-PCR was performed using the corresponding Full Gold qPCR kit (catalog number: AQ601) on a real-time PCR instrument (Shanghai Hongshi, SLAN-96). The PCR primer sequences described in the examples of this specification are merely experimental tools used in implementing this invention and do not constitute the technical solutions claimed in this invention. The primer sequences are as follows:

[0042] MYC positive 5'-GTCAAGAGGCGAACACACAAC-3';

[0043] Reverse 5'-TTGGACGGACAGGATGTATGC-3';

[0044] BYSL positive 5'-CTGGTTCAAAGGGATCCTGA-3';

[0045] Reverse 5'-AGTCGCAGGAAGATGCTGTT-3';

[0046] β-actin positive 5'-CCAACCGCGAGAAGATGA-3';

[0047] Reverse 5'-CCAGAGGCGTACAGGGATAG-3'.

[0048] Use 2 -ΔΔCT The method was used, with β-actin as an internal control, and relative gene expression was evaluated using CT values. Proteins were extracted after 72 hours for Western blot analysis. Total protein was obtained by lysing cells with RIPA solution containing 1 mM protease inhibitor. Total protein concentration was determined using a BCA protein quantification kit (Yamei, ZJ102). Proteins of different molecular weights were separated in SDS-PAGE gels and then transferred to PVDF membranes. After blocking the PVDF membranes in rapid blocking buffer, they were incubated overnight at 4°C with primary antibody, followed by incubation with secondary antibody at room temperature. Finally, protein bands were visualized using an ECL luminescence kit (Xinsemei, NO. P10200). Protein expression levels were quantified using ImageJ. The experimental results showed that MYC promotes BYSL expression. Specific experimental results are as follows... Figure 2 As shown, after overexpression of the MYC plasmid in 293T(A) and MHCC97H(B) / HepG2(C) cells, increased levels of MYC and BYSL messenger ribonucleic acid (mRNA) expression were detectable 48 hours after transfection. Furthermore, after overexpression of the MYC plasmid in 293T, MHCC97H, and HepG2(D) cells, increased levels of MYC and BYSL protein expression were detectable 72 hours after transfection.

[0049] Next, specific siRNA was transfected into HepG2 / MHCC-97H cells, and proteins were extracted after 72 hours for Western blot analysis. Figure 3 As shown in Figure A, HepG2 and MHCC97H cells were transfected with specific small interfering RNA (siRNA) targeting MYC and BYSL. The protein expression levels of MYC and BYSL were detected 72 hours after transfection. The results showed that MYC unidirectionally regulates BYSL, playing a role in transcriptional activation. Subsequently, HepG2 and MHCC97H cells were treated with 50 μM and 100 μM MYC small molecule inhibitors, respectively, for 24 hours, and the protein expression levels were then detected. The results are as follows. Figure 3As shown in Figure B, decreased MYC expression leads to a decrease in BYSL expression levels. These results indicate that MYC binds to the BYSL promoter and directly activates BYSL transcription. Inhibiting MYC expression simultaneously inhibits BYSL expression.

[0050] To assess the effects of simultaneous targeting of MYC and BYSL on cell function, this study performed Cell Counting Kit-8 (CCK-8) assays and colony formation assays in HepG2 and MHCC97H cells transfected with MYC-targeting small interfering RNA (siMYC), BYSL-targeting small interfering RNA (siBYSL), or a co-transfection of both. Results are as follows: Figure 4 As shown, CCK-8 and colony formation assays demonstrated that co-transfection with specific siMYC and siBYSL significantly inhibited the proliferation rate of HepG2 and MHCC97H cells. In conclusion, compared with knocking down either gene alone, the combined silencing of MYC and BYSL had a more significant inhibitory effect on cell viability and colony formation ability.

[0051] Figure 2 In this context, mRNA level refers to the expression level of messenger RNA, i.e., the gene transcription level; OE is an abbreviation for OverExpression; Vector indicates an empty vector; c-myc represents the protein name encoded by the MYC gene; bystin represents the protein name encoded by the BYSL gene; and kDa represents kilodaltons, a unit of protein molecular weight. Figure 3 In this context, siNC stands for siRNA Negative Control, a small interfering RNA for negative control, and 10058-F4 represents a small molecule inhibitor of MYC. Figure 4 In this context, Cell proliferation (OD450) represents the optical density value read at a wavelength of 450 nm, and Day represents the number of days.

[0052] Example 2: Validation of high expression of BYSL in HCC and its clinical prognostic value

[0053] First, the expression level of BYSL in pan-cancer was analyzed using the GEPIA database. It was found that the expression level of BYSL mRNA in HCC tissue was significantly higher than that in adjacent normal tissue. Figure 5 A). BYSL's GSE data in the NCBI (National Center for Biotechnology Information) database also support this conclusion. Figure 5 B). Next, this embodiment used an expanded TMA (tissue microarray) cohort and employed IHC (immunohistochemistry) to verify the expression pattern of BYSL in HCC. The results are as follows: Figure 5As shown in Figure C, BYSL expression was detected in TMAs of 48 randomly selected HCC tissues (T) and their matched adjacent normal tissues (P). Analysis of BYSL expression in adjacent normal tissues (P) and HCC tissues (T) based on the IHC score of the HCC-TMA revealed that the IHC score of tumor tissues was significantly higher than that of adjacent non-tumor tissues. Furthermore, this embodiment evaluated the expression level of BYSL in clinical HCC samples. Figure 5 As shown in Figure D, Western blot analysis was performed on the expression levels of BYSL in five pairs of HCC clinical tumor tissues (T) and adjacent non-tumor tissues (P). The results showed that the expression level of BYSL in HCC patients was significantly elevated compared to adjacent normal tissues. In summary, these results indicate that elevated BYSL expression levels are closely related to the occurrence and progression of HCC tumors.

[0054] Furthermore, we explored the impact of BYSL expression levels on the prognosis of hepatocellular carcinoma, and the results were as follows: Figure 6 As shown in Figure A, patients in the high BYSL expression group had shorter survival times compared to the low expression group. Furthermore, the value of BYSL as a diagnostic biomarker was also analyzed. Figure 6 As shown in Figure B, the receiver operating characteristic (ROC) curve of BYSL in HCC indicates that it has high diagnostic value (area under the curve (AUC) = 0.8749).

[0055] Figure 5 In this context, mRNA expression of BYSL indicates the transcript expression level of the BYSL gene; LIHC represents hepatocellular carcinoma; Normal represents adjacent normal liver tissue; Tumor represents hepatocellular carcinoma tissue; BYSL protein level indicates the expression level of the BYSL gene; GAPDH represents glyceraldehyde-3-phosphate dehydrogenase, an internal reference protein; Patient represents the specific liver cancer patient number (e.g., Patient#1, #2...); T represents Tumor (tumor tissue of the same patient); and N represents Normal (adjacent tissue of the same patient). Figure 6In this context, Percent survival represents survival rate, sensitivity represents sensitivity—the true positive rate (the proportion of cancer patients correctly detected), Overall Survival represents overall survival rate, Low BYSL Group represents the group of patients with low BYSL expression, High BYSL Group represents the group of patients with high BYSL expression, Logrank represents the Log-rank test, a statistical method for comparing the difference between two survival curves, HR(high) represents the hazard ratio—the multiple of death / recurrence risk for the high-expression group relative to the low-expression group, p(HR) represents the statistical significance of the HR value (p-value), n(high) represents the number of patients in the high-expression group, n(low) represents the number of patients in the low-expression group, Month represents months, Disease-Free Survival represents disease-free survival, LIHC represents hepatocellular carcinoma, Sensitivity represents sensitivity, the true positive rate (the proportion of cancer patients correctly detected), Specificity represents specificity, the true negative rate (the proportion of healthy individuals correctly excluded), and AUC represents the area under the curve (AUC), the core indicator of the ROC curve.

[0056] Example 3: In vitro functional experiment of BYSL knockout inhibiting the malignant phenotype of HCC cells

[0057] 1. Constructing stable knockout cell lines:

[0058] A specific sgRNA (sequence: CAACGTCATCTCGTACTCGA) targeting the human BYSL gene was designed and synthesized by Sangon Biotech (Shanghai, China). The constructed knockout vector was sequenced by Sangon Biotech and then transfected into HepG2, MHCC-97H, and Hep3B cells using Lipofectamine 3000 (Invitrogen, USA). Stable knockout cells were sorted by flow cytometry using a GFP-activated cell sorting method. Cells transfected with the empty PX458 vector served as control cells. Figure 7 The knockout efficiency was verified by Western blot analysis of the AB plot.

[0059] 2. Proliferation capacity test:

[0060] MTT assay: Target cells were seeded at a concentration of 2000 cells / well in 96-well plates, with 5 replicates under the same conditions. Monitoring was performed at the same time every day for 5 consecutive days. For measurement, 100 μL of MTT working solution was added to each well, and after incubation in the dark for 4 hours, 100 μL of dimethyl sulfoxide (DMSO) solution was added to dissolve the formazan crystals. The absorbance at 570 nm was then measured using a microplate reader (ThemoFisher, VARIOSKANLUX, USA). Figure 7 The results of experiments C and 7D showed that knocking out BYSL could inhibit the proliferation rate of HepG2 / MHCC-97H cells.

[0061] Colony formation assay: Target cells were seeded at a concentration of 2000 cells / well in six-well plates. Culture was stopped when single-cell colonies were visible to the naked eye. Cells were then fixed with 4% paraformaldehyde for 15 min and stained with crystal violet for 20 min. ImageJ was used to analyze colony formation. Results are shown below. Figure 7 E showed that the clonogenic ability of HepG2 / MHCC-97H cells decreased after BYSL knockout.

[0062] In conclusion, knocking out BYSL can inhibit the proliferation of HCC cells.

[0063] 3. Cell cycle and apoptosis analysis:

[0064] During the assay cycle, the digested cells were fixed overnight in pre-cooled 75% ethanol at 4°C. The cells were then resuspended in a fluorescent staining solution containing 1% (v / v) Triton X-100, 10% propidium iodide (PI), and 0.5% RNAse, and incubated at 4°C in the dark for 30 min. Analytical analysis was then performed using a flow cytometer (BD, FACS Canto II). Results are as follows: Figure 8 As shown in A and B, the G1 / G0 phase cell population increased in BYSL knockout HepG2(A) and MHCC97H(B) cells, while the S and G2 / M phase cell populations decreased.

[0065] For apoptosis detection, cells were obtained by trypsin digestion without EDTA. Then, following the manufacturer's instructions, an apoptosis detection kit (Elabscience, E-CK-A322) was used. 5 μl of Annexin V and 5 μl of PI staining solution were added to 500 μl of binding buffer, and the mixture was incubated in the dark for 15 min. Apoptosis was then detected using a microarray. Figure 8 The results of C and 8D showed that the apoptosis index of BYSL knockout HepG2 (C) and MHCC97H (D) cells was higher than that of the control group.

[0066] These results indicate that knocking out BYSL blocks the G1 / S phase of HepG2 / MHCC-97H cells and promotes apoptosis.

[0067] 4. Migration and Invasion Capability Detection:

[0068] Scratch healing assay: Cells from both the experimental and control groups were seeded into six-well plates. After the monolayer cell confluence reached 90%-100%, a 200 μL pipette tip was used to make a straight scratch within the wells. Changes in the scratch area were monitored at 0 h, 24 h, and 48 h using an inverted microscope under a fixed field of view. Image J was used to analyze changes in the scratch area. Figure 9 The results of A and 9B indicate that the migration ability of BYSL knockout HepG2 (A) and MHCC97H (B) cells was inhibited.

[0069] Transwell assay: 5 × 10⁵ cells in 200 μL serum-free medium 4 Target cells were added to the upper chamber (for invasion assays, 50 μL of matrix gel mixture was added to the upper chamber beforehand, and unbound matrix gel was aspirated after 4 hours). Then, 800 μL of DMEM high-glucose medium containing 10% fetal bovine serum (FBS) was added to the lower chamber. After 48 hours of culture, the cells were removed, and the upper chamber cells were removed with cotton swabs. Cells were fixed with 4% paraformaldehyde for 15 minutes and stained with crystal violet for 20 minutes, and then photographed using an inverted microscope. Cell counting analysis was performed using ImageJ. Results are shown below. Figure 9 As shown in C and 9D, the migration and invasion abilities of BYSL knockout HepG2(C) / MHCC97H(D) cells and their control group were impaired after 24 hours.

[0070] In summary, the results indicate that knocking out BYSL inhibits the migration and invasion capabilities of HepG2 / MHCC97H cells.

[0071] Figure 7 In this text, Ctrl represents Control, sgBYSL represents the sgRNA specifically targeting the BYSL gene (i.e., the BYSL knockout experimental group), BYSL expression level represents the expression level of the BYSL gene, OD570 represents the optical density value at a wavelength of 570 nm, and Number of cell colony represents the number of cell colonies formed. Figure 8In this text, "cell number" represents the cell count, "Channels (PE-A)" represents the fluorescence intensity of the PE channels, "7AAD" represents 7-aminoactinomycin D fluorescent dye, "APC" represents allophycocyanin fluorescent dye, "Q1" represents the cell population with 7AAD positive and APC negative signals, "Q2" represents the cell population with both 7AAD and APC positive signals, "Q3" represents the cell population with both 7AAD negative and APC positive signals, and "Q4" represents the cell population with both 7AAD and APC negative signals. Figure 9 In this context, Migrated area represents cell migration area, invasion represents cell invasion, migration represents cell migration, invasion represents cell invasion, and NC represents Negative Control.

[0072] Example 4: Validation of the mechanism by which BYSL deletion functions through the RPL5 / RPL11-MDM2-p53 pathway

[0073] 1. Induction of nucleolar stress and inhibition of protein synthesis:

[0074] Immunofluorescence: Target cells were fixed with 4% paraformaldehyde solution for 15 min after removing the culture medium, followed by permeabilization with ice-cold methanol for 10 min. They were then blocked with 5% goat serum at 37°C for 30 min and incubated with primary antibody overnight at 4°C. Secondary fluorescent antibody was then added, and the cells were incubated at 37°C for one hour. Finally, nuclear staining was performed by covering the cells with 4',6-diamidinyl-2-phenylindole (DAPI) working solution and incubating at room temperature for 30 min. The results were observed using a Leica confocal microscope (Leica, STELLARIS 5). Figure 10 As shown in result A, knocking out BYSL induces nucleolar stress in HepG2 / MHCC-97H cells, specifically manifested as the redistribution of nucleophosphorus protein 1 (NPM1) to form a ring-like structure surrounding the nucleolar sphere.

[0075] O-Propynylpurine Labeling: Digested target cells were seeded into 96-well plates and cultured until the cell density reached approximately 70%-80%. Staining was performed according to the reagent supplier's instructions, adding Click reaction solution and incubating in the dark for 30 minutes. Finally, nuclear staining was performed by covering the cells with DAPI working solution and incubating at room temperature for 15 minutes. Observation was performed using an inverted microscope. Figure 10 As shown in Figure B, overall protein synthesis was reduced in BYSL knockout HepG2 and MHCC97H cells. The right side shows the statistical analysis results of the relative levels of newly synthesized proteins.

[0076] The results in summary indicate that knocking out BYSL induces nucleolar stress and inhibits the synthesis of new intracellular proteins.

[0077] 2. Activate the RPL5 / RPL11-MDM2-p53 axis:

[0078] CO-IP: Target cells were lysed in 500 μL of lysis buffer to obtain total protein. The total protein was quantified and diluted to 1 μg / μL. If appropriate, antibody (2 μg) was added to 500 μL of the lysate and incubated at 4 °C for 12 h. Then, 60 μL of protein A beads were added to the lysate and incubated at room temperature for 2 h. The bead antigen-antibody complex was washed with PBS. Finally, the target antigen was removed with loading buffer, and the sample was prepared for Western blot analysis. Results are shown below. Figure 11 A and 11B, in HepG2 (A) and MHCC97H (B), co-immunoprecipitation (Co-IP) experiments verified that RPL5 / RPL11 binds more strongly to MDM2, while p53 binds less strongly to MDM2.

[0079] p53 ubiquitination and stability assay: pCDNA3.1-3×HA-UB expression vector (MiaoLinBio) was introduced into target cells. After 24 hours, cells were lysed after treatment with 10 mM MG132 (a proteasome inhibitor) for 3 hours. Ubiquitinated p53 was co-precipitated with anti-p53 antibody, and Western blot analysis was performed using anti-HA antibody. Figure 11 As shown in Figure C, the p53 ubiquitination level in HepG2 / MHCC97H cells was decreased after BYSL knockout. Additionally, incubation with 10 mg / mL CHX (cyclohexylimide) inhibited the synthesis of nascent proteins. Cells were collected at 0 min, 15 min, 30 min, 60 min, and 90 min of culture, and the p53 degradation rate was detected by Western blot. The results are as follows... Figure 11 As shown in D and 11E, BYSL knockout slowed down the degradation of p53 protein in HepG2 (D) and MHCC97H (E) cells.

[0080] In summary, the results indicate that knocking out BYSL can regulate the RPL5 / RPL11-MDM2-p53 pathway, reduce p53 ubiquitination in HepG2 / MHCC-97H cells, prolong the half-life of p53, and promote p53 stability.

[0081] 3. Changes in the expression of downstream effector molecules: Specific results are as follows Figure 12As shown, Western blot analysis confirmed that after BYSL knockout, the total amount of p53 protein increased; the expression of its downstream target proteins, cyclin-dependent kinase inhibitor 1 (p21) and Bcl-2-related X protein (Bax), was upregulated; and the expression of B lymphoma-2 protein (Bcl-2) was downregulated. Simultaneously, the expression of the epithelial marker E-cadherin was upregulated, while the expression of the mesenchymal marker N-cadherin was downregulated.

[0082] Figure 10 In the image, Merge indicates overlay / fusion, Protein label indicates protein marker, and Relative nascent protein indicates the relative level of nascent protein. Figure 11 In this table, 10% input represents 10% of the total lysis buffer loading; Ctrl igG indicates immunoprecipitation using normal mouse / rabbit IgG; IP p53 Ctrl sgBYSL indicates immunoprecipitation of p53 protein and its interacting proteins using anti-p53 antibody; IP MDM2 Ctrl sgBYSL indicates immunoprecipitation of MDM2 protein and its interacting proteins using anti-MDM2 antibody; HepG2 Ctrl sgBYSL represents the IP product from the control group; MHCC97H Ctrl sgBYSL represents the IP product after BYSL knockdown; IP p53 IB HA-UB indicates ubiquitination detection using anti-HA tag antibody; CHX represents cycloheximide, a protein synthesis inhibitor; Realtive p53 protein level indicates the proportion of remaining p53 protein relative to time point 0; and Time indicates the time point. Figure 12 In this context, "protein expression level" refers to the level of protein expression.

[0083] Example 5: Verification of the pro-cancer effect of BYSL dependent on p53 status

[0084] To clarify the mechanism specificity, this embodiment used MTT assay, plate colony assay, flow cytometry, scratch assay, and Transwell assay to detect changes in cell growth, proliferation, migration, invasion, and cell cycle apoptosis levels after knocking out BYSL in the p53 gene-deficient HCC cell line Hep3B. The results are as follows: Figure 13 As shown, unlike wild-type p53 HepG2 / MHCC-97H cells, BYSL knockout inhibits the proliferation of Hep3B cells ( Figure 13 B) Cloning ( Figure 13 C) Cell cycle ( Figure 13 D), Apoptosis ( Figure 13 E) and migration and invasion capabilities ( Figure 13Neither F nor 13G had a significant effect. These results indicate that knocking out BYSL in Hep3B cells does not affect their proliferation, cell cycle, apoptosis, migration, or invasion abilities.

[0085] This further clarifies that the pro-cancer effect of BYSL in HCC primarily depends on p53. By promoting the binding of p53 to MDM2, it reduces p53 protein stability and inhibits the tumor-suppressive function of p53, thereby promoting the malignant progression of HCC. This finding further clarifies the target population of this invention (HCC patients with wild-type p53) and enhances the specificity of the treatment strategy.

[0086] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A synergistic therapeutic composition for liver cancer targeting MYC and BYSL, characterized in that, The active ingredients of this pharmaceutical composition include: Therapeutic effective doses of MYC inhibitors, and Therapeutic doses of BYSL inhibitors.

2. The synergistic therapeutic composition for liver cancer targeting MYC and BYSL according to claim 1, characterized in that, The pharmaceutical composition also contains a pharmaceutically acceptable carrier or excipient.

3. The synergistic therapeutic composition for liver cancer targeting MYC and BYSL according to claim 1, characterized in that, The MYC inhibitor is any one of the following: small molecule inhibitor, MYC-targeting siRNA, shRNA, antisense oligonucleotide, or MYC protein degrader.

4. The synergistic therapeutic composition for liver cancer targeting MYC and BYSL according to claim 1, characterized in that, The BYSL inhibitor is any one of the following: siRNA, shRNA, CRISPR / Cas9 editing system, antisense oligonucleotide, BYSL neutralizing antibody, BYSL small molecule inhibitor, or BYSL protein degrader.

5. The synergistic therapeutic composition for liver cancer targeting MYC and BYSL according to claim 1, characterized in that, The combination of the MYC inhibitor and the BYSL inhibitor can synergistically inhibit the proliferation, colony formation, migration and invasion of p53 wild-type hepatocellular carcinoma cells, and induce cell cycle G1 / S arrest and apoptosis.

6. The use of the MYC and BYSL combined targeted hepatocellular carcinoma synergistic drug composition as described in any one of claims 1-5 in the preparation of a drug for the prevention or treatment of p53 wild-type hepatocellular carcinoma.

7. A medicine box for treating p53 wild-type hepatocellular carcinoma, characterized in that, include: Therapeutic doses of MYC inhibitors; Therapeutic doses of BYSL inhibitors, and Instructions for use.

8. A medicine box for treating p53 wild-type hepatocellular carcinoma according to claim 7, characterized in that, The MYC inhibitor is any one of the following: small molecule inhibitor, MYC-targeting siRNA, shRNA, antisense oligonucleotide, or MYC protein degrader.

9. A kit for treating p53 wild-type hepatocellular carcinoma according to claim 7, characterized in that, The BYSL inhibitor is any one of the following: siRNA, shRNA, CRISPR / Cas9 editing system, antisense oligonucleotide, BYSL neutralizing antibody, BYSL small molecule inhibitor, or BYSL protein degrader.

10. A medicine box for treating p53 wild-type hepatocellular carcinoma according to claim 7, characterized in that, The combination of the MYC inhibitor and the BYSL inhibitor can synergistically inhibit the proliferation, colony formation, migration and invasion of p53 wild-type hepatocellular carcinoma cells, and induce cell cycle G1 / S arrest and apoptosis.