A biphenyldiol compound, a preparation method and application thereof

Abstract

The application discloses a biphenyldiol compound and a preparation method and application thereof, and relates to the application of C1AC002 in treating neuroinflammation and various substance addictions such as opioid drugs, methamphetamine and cocaine.

Description

Technical Field

[0001] This invention belongs to the field of medicinal chemistry technology, specifically relating to a biphenyl compound, its preparation method, and its application. Background Technology

[0002] While opioids are an important tool for pain management, their clinical application is accompanied by significant and dangerous drawbacks, constituting a global public health crisis. Addiction and abuse risks are the most critical and deadly flaws of opioids. They produce intense euphoria by acting on the brain's reward circuitry, easily leading to physiological and psychological dependence. Even short-term use according to prescription can induce addiction. Opioid addiction is a chronic, relapsing brain disorder requiring comprehensive, long-term treatment, currently including pharmacological therapy, medically managed withdrawal, behavioral interventions, and psychosocial support.

[0003] Adjunctive pharmacological therapy is a core pillar of current evidence-based treatment, proven to significantly reduce mortality and crime rates, improve social functioning, and promote overall recovery. Common medications include: μ-opioid receptor agonists, such as methadone, which have strong blocking effects but carry the risk of overdose and long-term use can lead to dependence and withdrawal symptoms; and μ-opioid receptor (MOR) antagonists, such as naltrexone, which can block the effects of all opioids, but have low bioavailability, side effects such as nausea and constipation, poor patient compliance, and high relapse rates.

[0004] Methamphetamine, commonly known as crystal meth, powerfully promotes the release of dopamine (DA), norepinephrine (NE), and serotonin (5-HT) from the presynaptic membrane, inhibits neurotransmitter reuptake, and damages vesicle storage function. It also causes a more than tenfold increase in dopamine concentration in the nucleus accumbens (NAc), triggering intense euphoria and excitement that lasts 4-12 hours, leading to addiction. Furthermore, it damages dopaminergic neuronal terminals, resulting in permanent striatal DA depletion. Current drug treatments for methamphetamine addiction include replacement therapy and symptomatic treatment. For example, bupropion can partially stimulate the dopamine system and relieve cravings; modafinil can improve cognitive function during withdrawal; and quetiapine can control hallucinations and delusions. However, the efficacy of replacement drugs is limited; the relapse rate remains as high as 70-80% after 6 months of drug treatment, accompanied by strong side effects, such as dose-dependent seizures induced by bupropion. There are currently no drugs available to treat methamphetamine addiction.

[0005] Cocaine addiction remains a global public health challenge, and the core contradiction in its current treatment lies in the fact that the addiction mechanism is profound and complex in the brain, and the core of cocaine addiction is its powerful interference with the brain's "reward system".

[0006] Currently, there are no drugs specifically for cocaine addiction in clinical practice; clinical practice mainly relies on behavioral therapy and some "off-label medications." Summary of the Invention

[0007] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0008] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0009] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide a biphenyl compound, its preparation method, and its application in the treatment of multiple substance abuse.

[0010] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a biphenyl compound, characterized in that: the general structural formula of the biphenyl compound is shown in formula (I): (I) R1, R2, R3, R4, and R5 are selected from one or more of -H, -OH, alkanes, and alkenes; R6, R7, R8, R9, and R 10 Selected from -H, one or more of alkanes and alkenes.

[0011] Another object of the present invention is to overcome the shortcomings of the prior art and provide a method for preparing biphenyl compounds, comprising, (a) Phenolic compounds 1 containing different substituents react with trifluoromethanesulfonic anhydride under alkaline conditions to give phenyl trifluoromethanesulfonate compounds 2. The preferred reaction solvents are dichloromethane, diethyl ether, tetrahydrofuran, and 1,4-dioxane. The preferred bases are triethylamine, pyridine, and DIPEA. The reaction temperature is from -78°C to reflux. (b) Compound 2 is reacted with a boron reagent under alkaline conditions via a Miyaura borylation reaction to yield arylboronic acid ester compound 3, wherein the preferred palladium catalysts are PdCl2(dppf), Pd(PPh3)4, XPhos Pd G3 / G4 and SPhos / RuPhos Pd G4, the preferred boron reagents are pinacol ester (B2pin2), tetrahydroxydiboron (BBA), pinacol borane (HBpin), the preferred bases are KOAc, K3PO4, K2CO3, triethylamine, and DIPEA, the preferred reaction solvents are dichloromethane, 1,4-dioxane, toluene, tetrahydrofuran, dimethylacetamide, MeOH, and EtOH, and the reaction temperature is from room temperature to reflux; (c) Compound 3 undergoes a Suzuki-Miyaura coupling reaction with dimethyl ether bromobenzaldehyde compounds 4 substituted at different sites under alkaline conditions in the presence of a palladium catalyst to give biphenyl compound 5. The palladium catalyst is preferably Pd(PPh3)4, PdCl2(dppf), Pd(OAc)2+ ligands (such as SPhos, XPhos, RuPhos), or Pd2(dba)3. The base is preferably Na2CO3, K2CO3, Cs2CO3, K3PO4, or CsF. The reaction solvent is toluene, 1,4-dioxane, DMF, ethanol / water, or THF. The reaction temperature is from room temperature to reflux. (d) Compound 5 is reacted with Grignard reagents with different substituents to give compound 6, wherein the preferred reaction solvent is THF or Et2O, and the preferred reaction temperature is -20°C to room temperature; (e) Compound 6 is reduced to compound 7 by reducing the hydroxyl group under the action of a reducing agent, wherein the preferred reduction conditions are palladium on carbon catalytic hydrogenation, TFA / Et3SiH, PPh3 / I2 / imidazole; (f) Compound 7 was demethylated to obtain the target biphenyl compound 8. The preferred demethylation reaction conditions were BBr3 / DCM, Me3SiI, NaI / TMSCl, and HBr / AcOH, and the reaction temperature was -78°C to reflux.

[0012] Another object of the present invention is to overcome the shortcomings of the prior art and provide a biphenyl compound drug comprising the biphenyl compound shown in formula (I).

[0013] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of biphenyl compounds in the treatment of neuroinflammation.

[0014] Another objective of this invention is to overcome the shortcomings of the prior art and provide an application of biphenyl compounds in the treatment or prevention of addiction caused by opioids, methamphetamine, and cocaine.

[0015] As a preferred embodiment of the application described in this invention, the opioid drugs include, but are not limited to, fentanyl, ibuprofen, codeine, diazepam, dihydrocodeine, enkephalin, heroin, oxycodone, oxymectin, meperidine, methadone, morphine, nicoridine, opium, Oscontin, and their derivatives, precursors, or pharmacologically acceptable salts or solvents of these drugs.

[0016] As a preferred embodiment of the application described in this invention, formula (I) can be used in conjunction with a pharmacologically acceptable excipient.

[0017] The beneficial effects of this invention are: This invention relates to the application of biphenyl compounds in the treatment of neuroinflammation, and the biphenyl compounds of this invention have significant anti-neuroinflammation activity; this invention also relates to the application of biphenyl compound C1AC002 in the treatment of neuroinflammation and the abuse of multiple substances such as morphine, methamphetamine, and cocaine. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein: Figure 1 This is the general synthetic route for biphenyl compounds in Example 1 of the present invention.

[0019] Figure 2 This is the synthetic route for the representative compound 8a in Example 2 of the present invention.

[0020] Figure 3 The synthetic route for compound 13 in Comparative Example 1 of this invention is shown.

[0021] Figure 4 The synthetic route for compound 14 in Comparative Example 2 of this invention is shown.

[0022] Figure 5 The above are the hydrogen and carbon NMR spectra of compound C1AC002 in Example 3 of this invention.

[0023] Figure 6 This study evaluates the anti-inflammatory activity of compound C1AC002 in Example 18 of this invention. Figure 6 A represents the dose-dependent inhibitory effect of C1AC002 on the inflammatory factor NO; Figure 6 B represents the mRNA inhibition level of the inflammatory factor TNF-α after treatment with C1AC002; Figure 6C represents the mRNA inhibition level of the inflammatory cytokine IL-1β after treatment with C1AC002; Figure 6 D represents the mRNA inhibition level of the inflammatory cytokine IL-6 after treatment with C1AC002.

[0024] Figure 7 Compound C1AC002 in Example 19 of this invention inhibits behavioral sensitization. Figure 7 A is a schematic diagram of the behavioral sensitization experiment process; Figure 7 B and Figure 7 C represents the inhibitory effect of C1AC002 on morphine behavioral sensitization in the experiment; Figure 7 D and Figure 7 E represents the inhibitory effect of C1AC002 on the sensitization response of methamphetamine in the experiment; Figure 7 F and Figure 7 G represents the inhibitory effect of C1AC002 on cocaine behavioral sensitization in the experiment.

[0025] Figure 8 This refers to the inhibition of conditional position preference by compound C1AC002 in Example 20 of the present invention. Figure 8 A is a schematic diagram of the conditional position preference experiment procedure; Figure 8 The inhibitory effect of C1AC002 on morphine reward behavior in experiment B; Figure 8 C represents the inhibitory effect of C1AC002 on the reward behavior of methamphetamine in the experiment; Figure 8 D represents the inhibitory effect of C1AC002 on cocaine reward behavior in the experiment.

[0026] Figure 9 This is a structural diagram of the compound involved in this invention. Detailed Implementation

[0027] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0028] Many specific details are set forth in the following description to provide a thorough understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Furthermore, the term "an embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that excludes other embodiments.

[0029] Unless otherwise specified, all raw materials and reagents used in this invention were purchased from Shanghai BIDE Pharmaceutical Technology Co., Ltd.

[0030] Thin-layer chromatography (TLC) and silica gel used in the analysis were sourced from Qingdao Shuoyuan Silica Gel Technology Co., Ltd. The medium-pressure separation chromatography system was provided by Biotage. The silica gel column was purchased from Changzhou Sante Technology Co., Ltd. Nuclear magnetic resonance (NMR) spectra were obtained on a Bruker gAV-300 spectrometer, with frequencies of [missing information]. 1 H's 300 MHz and 13 The 75 MHz of C was used with either CDCl3 or CD3OD as the solvent. Chemical shift (δ) is expressed in ppm, with the peak value of the residual solvent serving as an internal reference (CDCl3: 1 H was 7.26 ppm. 13 C 77.16 ppm; CD3OD: 1 H was 3.31 ppm. 13 (49.03 ppm for C). Signal splitting patterns were described by chemical shift, multiplicity (s for singlet, d for doublet, t for triplet, m for multipeak, br for broad peak), coupling constant (in Hertz, Hz), and integral. Low-resolution electrospray ionization (ES) mass spectra were recorded on a Waters QDa mass spectrometer operated in both positive and negative ion modes. All compounds were purified to a purity exceeding 95%.

[0031] Cell culture: BV-2 cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. The incubator was maintained at 37°C, 95% humidity, and 5% CO2.

[0032] Quantitative real-time polymerase chain reaction (qRT-PCR): Total RNA was extracted from cells or mouse brain using the RNeasy Mini kit. Following the manufacturer's instructions, the isolated RNA was reverse transcribed into cDNA using the RT2 Easy First Strand cDNA synthesis kit. Subsequent PCR amplification employed synthetic primers, SYBR Green assay, and the TOptical real-time qPCR thermal cycler from Analytick Jena in Jena, Thuringia, Germany. Data analysis was performed using the ΔΔCt method, with Rpl7l1 as an internal control gene. The primer sequences for qRT-PCR are as follows: Rpl7l1 (forward: ACGGTGGAGCCTTATGTGAC; reverse: TCCGTCAGAGGACTGTCTT), IL-1β (forward: CCACCTTTTGACAGTGATGA; reverse: GAGATTTTGAAGCTGGATGCT).

[0033] Nitric oxide (NO) detection: BV-2 cells were stored at 5 × 10⁻⁶ cells per well. 4 Cells were seeded at a density of [number] cells per well in 96-well plates. After 24 hours, the medium was removed and replaced with DMEM medium free of FBS and penicillin-streptomycin. LPS (200 ng / mL) and a series of compound concentrations were added. After 24 hours of treatment, 100 µL of medium was transferred to flat-bottomed black 96-well microplates. 10 µL of 0.05 mg / mL 2,3-diaminonaphthalene was introduced, followed by incubation in the dark for 15 minutes. The reaction was terminated by adding 5 µL of 3 M NaOH to each well. NO inhibition rate was measured using a SYNERGY H1 microplate reader (BioTek Instruments) at excitation and emission wavelengths of 360 nm and 430 nm, respectively. The fluorescence values ​​of the group treated with LPS only were used as a 100% reference.

[0034] Animal housing: Male BALB / c mice aged 6-8 weeks and weighing 20-28 g were housed in a temperature-controlled environment (21-24°C) following a 12-hour day-night cycle, with lights turned on at 08:00 AM. Mice had free access to standard rodent food and water and were allowed at least one week to acclimatize to the environment before any experimental procedures were performed.

[0035] Behavioral sensitization experiment: On days 1-3, mice were allowed to explore freely in an open field for 1 hour. Then, the mice were divided into three groups: a control group, a group receiving 10 mg / kg morphine, 2 mg / kg methamphetamine, or 10 mg / kg cocaine hydrochloride, and a group receiving 5 mg / kg morphine, 2 mg / kg methamphetamine, or 10 mg / kg cocaine hydrochloride plus 0.02 mg / kg, 0.2 mg / kg, or 2 mg / kg C1AC002. On days 4-10, mice were administered the drug once daily according to their grouping, and then allowed to explore freely in an open field for 1 hour. The movement trajectories of the mice were recorded and the distances traveled were analyzed. On days 11-17, the mice received no treatment. On day 18, mice were injected with 5 mg / kg morphine, 1 mg / kg methamphetamine, or 5 mg / kg cocaine hydrochloride, and then allowed to explore freely in an open field for 1 hour. The movement trajectories of the mice were recorded and the distances traveled were analyzed.

[0036] Conditioned position preference (CPP) experiment: The CPP experiment was conducted according to the classic 10-day procedure. On days 1 and 2, each mouse was placed in the CPP device for 15 minutes to acclimatize. On day 3 (pretreatment), the time spent in each compartment was recorded to determine preference for two compartments. Mice were divided into three groups: control group, 5 mg / kg morphine or 2 mg / kg methamphetamine or 10 mg / kg cocaine hydrochloride group, and 5 mg / kg morphine or 2 mg / kg methamphetamine or 10 mg / kg cocaine hydrochloride group + 0.02 mg / kg, 0.2 mg / kg or 2 mg / kg C1AC002 group. During the conditioned phase, mice were isolated in compartments for 30 minutes each for 6 consecutive days. On days 4, 6 and 8, mice were given morphine or methamphetamine or cocaine hydrochloride, while on days 5, 7 and 9, they were given the control (5 mL / kg). Post-treatment was performed 24 hours after the conditioned period ended. Each mouse was placed in the device and allowed to explore freely, and the time spent in each compartment was recorded for 15 minutes. The CPP score was calculated by subtracting the time spent in the control compartment from the time spent in the drug-paired compartment. Example

[0037] Figure 1 This is a general synthetic route for biphenyl compounds in Example 1 of the present invention. This embodiment provides a method for synthesizing the biphenyl compound 2'-isopropyl-4,5'-dimethyl-[1,1'-biphenyl]-2,6-diol (6'), specifically as follows: (1) Dissolve 10 mmol of 2-isopropyl-5-methylphenol in 30 mL of dichloromethane, add 25 mmol of triethylamine dropwise, and under nitrogen protection, slowly add 20 mmol of trifluoromethanesulfonic anhydride at -78 °C, then start stirring. After the reaction is complete, add 15 mL of saturated NH4Cl solution to quench the reaction. Extract the aqueous phase with dichloromethane, wash the organic phase with saturated NaCl solution, dry with anhydrous sodium sulfate, and filter. After concentrating the organic phase, the crude product is obtained, which is purified by column chromatography to obtain 2-isopropyl-5-methylphenyltrifluoromethanesulfonate: yield 94%.

[0038] (2) 2-Isopropyl-5-methylphenyl trifluoromethanesulfonate (10 mmol) was dissolved in 20 mL of 1,4-dioxane, and 4 mL of triethylamine and 0.5 mmol of Pd(dppf)Cl2 were added. HBpin (20 mmol) was slowly added dropwise under ice bath, and the reaction was carried out at 120 °C under argon protection. After the reaction was complete, 15 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with dichloromethane, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, and filtered. The crude product was obtained after concentration of the organic phase and purified by column chromatography to obtain 2-(2-isopropyl-5-methylphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxoborane: yield 34%.

[0039] (3) Dissolve 2-(2-isopropyl-5-methylphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxoborane (1.1 mmol) and 2-bromo-1,3-dimethoxy-5-methylbenzene (1 mmol) in 5 mL of 1,4-dioxane, add triethylamine (3 mmol) and Pd(pph3)4 (0.05 mmol) was heated to 120 °C for 24 h under argon protection. After the reaction was complete, 3 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with saturated NaCl solution, dried over anhydrous sodium sulfate, and filtered. The organic phase was concentrated to give the crude product, which was purified by column chromatography to give 2'-isopropyl-2,6-dimethoxy-4,5'-dimethyl-1,1'-biphenyl: yield 60%.

[0040] (4) 2'-Isopropyl-2,6-dimethoxy-4,5'-dimethyl-1,1'-biphenyl (0.1 mmol) was dissolved in 2 mL of dichloromethane, and BBr3 (1 mmol) was slowly added dropwise at -20 °C. After stirring, the mixture was transferred to room temperature for reaction. After the reaction was complete, 2 mL of water was added to quench the reaction. The aqueous phase was extracted with dichloromethane, and the organic phase was washed with saturated NaHCO3 solution, dried with anhydrous sodium sulfate, and filtered. The organic phase was concentrated to obtain the crude product, which was purified by column chromatography to obtain the biphenyl diphenol compound 2'-isopropyl-4,5'-dimethyl-[1,1'-biphenyl]-2,6-diphenol (6'): yield 72%.

[0041] The chemical structural formula is shown in formula (a): Equation (a); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 7.38 – 7.31 (m, 1H), 7.24 (s,1H), 6.95 (d, J= 4.1 Hz, 1H), 6.38 (q, J = 2.2 Hz, 1H), 5.15 (d, J = 10.8Hz, 1H), 4.67 (d, J = 2.8 Hz, 1H), 2.65 (s, 2H), 2.39 – 2.26 (m, 1H), 2.03 –1.89 (m, 1H), 1.14 – 1.06 (m, 1H). 13 C NMR (75 MHz, CDCl3) δ 155.53, 153.89,146.19, 138.54, 136.19, 132.35, 131.71, 129.88, 126.26, 120.12, 108.90,99.58, 29.64, 24.51, 23.15, 20.91, 20.36. Example

[0042] This embodiment provides a method for synthesizing the biphenyl compound 2'-isopropyl-4,5'-dimethyl-[1,1'-biphenyl]-2,6-diol (8a), specifically as follows: (1) 2-Isopropyl-5-methylphenol (1a, 20 mmol) was dissolved in 30 mL of dichloromethane, and triethylamine (50 mmol) was added dropwise. Under nitrogen protection, trifluoromethanesulfonic anhydride (40 mmol) was slowly added dropwise, and the reaction was stirred. After the reaction was complete, 15 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with dichloromethane, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, and filtered. The crude product was obtained after concentration of the organic phase and purified by column chromatography to obtain 2-isopropyl-5-methylphenyltrifluoromethanesulfonate (2a): yield 82%.

[0043] (2) 2-Isopropyl-5-methylphenyl trifluoromethanesulfonate (2a, 10 mmol) was dissolved in 20 mL of 1,4-dioxane, and 4 mL of triethylamine and a catalyst amount of Pd(dppf)Cl2 were added. HBpin (20 mmol) was slowly added dropwise under ice bath, and the reaction was carried out at 120 °C under argon protection. After the reaction was complete, 15 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with dichloromethane, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, filtered, and filtered again. The organic phase was concentrated to obtain the crude product, which was purified by column chromatography to obtain 2-(2-isopropyl-5-methylphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxoborane (3a): yield 40%.

[0044] (3) 2-(2-isopropyl-5-methylphenyl)-4,4,5,5-tetramethyl-1,3,2-dioxoborane (3a, 1.1 mmol) and 4-bromo-3,5-dimethoxybenzaldehyde (4a, 1 mmol) were dissolved in 5 mL of 1,4-dioxane, and triethylamine (3 mmol) and catalyst Pd(pph3)4 were added. The mixture was heated to 120 °C for 24 h under argon protection. After the reaction was complete, 3 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, and filtered. The crude product was obtained after concentration of the organic phase and purified by column chromatography to obtain 2'-isopropyl-2,6-dimethoxy-5'-methyl-[1,1'-biphenyl]-4-carboxaldehyde (5a): yield 66%.

[0045] (4) 2'-Isopropyl-2,6-dimethoxy-5'-methyl-[1,1'-biphenyl]-4-carboxaldehyde (5a, 0.3 mmol) was dissolved in 1 mL of anhydrous tetrahydrofuran. Methyllithium (0.6 mmol) was slowly added dropwise at -40 °C. After reacting for 30 min, 1 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, and filtered. The crude product was obtained after concentrating the organic phase and purified by column chromatography to obtain 1-(2'-isopropyl-2,6-dimethoxy-5'-methyl-[1,1'-biphenyl]-4-yl)ethanol-1-ol (6a): yield 67%.

[0046] (5) 1-(2'-isopropyl-2,6-dimethoxy-5'-methyl-[1,1'-biphenyl]-4-yl)ethanol-1-ol (6a, 0.2 mmol) was dissolved in 1 mL of methanol, and the amount of catalyst Pd / C was added. H2 was introduced and the reaction was carried out overnight at room temperature. Pd / C was removed by filtration, the methanol was evaporated, and the product was dissolved in dichloromethane. The aqueous phase was extracted with dichloromethane, the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, filtered, and the organic phase was concentrated to obtain the crude product. The crude product was purified by column chromatography to obtain 4-ethyl-2'-isopropyl-2,6-dimethoxy-5'-methyl-1,1'-biphenyl (7a): yield 84%.

[0047] (6) 4-Ethyl-2'-isopropyl-2,6-dimethoxy-5'-methyl-1,1'-biphenyl (7a, 0.2 mmol) was dissolved in 3 mL of dichloromethane, and BBr3 (2 mmol) was slowly added dropwise at -20 °C. After stirring, the mixture was transferred to room temperature for reaction. After the reaction was complete, 2 mL of water was added, the aqueous phase was extracted with dichloromethane, the organic phase was washed with saturated NaHCO3 solution, dried with anhydrous sodium sulfate, and filtered. The organic phase was concentrated to obtain the crude product, which was purified by column chromatography to obtain the biphenyl diphenol compound 4-ethyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diphenol (8a): yield 88%.

[0048] The chemical structural formula is shown in formula (b): Equation (b); Characteristic number according to as follows: 1 H NMR (300 MHz, CDCl3) δ 7.40 (d, J = 8.0 Hz, 1H), 7.27 (d, J = 7.4 Hz, 1H), 7.04 (s, 1H), 6.45 (s, 2H), 4.62 (s, 2H), 2.76 (dt, J =13.7, 6.9 Hz, 1H), 2.62 (q, J = 7.6 Hz, 2H), 2.35 (s, 3H), 1.26 (t, J = 7.6Hz, 3H), 1.12 (d, J = 6.9 Hz, 6H). 13 C NMR (75 MHz, CDCl3) δ 153.30, 147.48,146.21, 136.94, 132.38, 131.00, 127.79, 126.88, 111.88, 106.74, 29.87, 28.80,24.15, 20.88, 15.11. Figure 2 This is the synthetic route for the representative compound 8a in Example 2 of the present invention. Example

[0049] The difference from Example 2 is that in step (4), methyllithium is replaced with ethyl magnesium bromide to obtain 4-propyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8b, C1AC002): yield 20%.

[0050] The chemical structural formula is shown in formula (c): Equation (c); The characterization data are as follows:1 H NMR (300 MHz, CDCl3) δ 7.46 – 7.39 (m, 1H), 7.33 –7.28 (m, 1H), 7.07 (d, J = 4.0 Hz, 1H), 6.45 (d, J = 1.6 Hz, 1H), 4.58 (d, J = 1.6 Hz, 1H), 2.84 – 2.71 (m, 1H), 2.56 (dt, J = 6.4, 1.8 Hz, 1H), 2.37 (d, J = 2.1 Hz, 1H), 1.74 – 1.64 (m, 1H), 1.18 – 1.08 (m, 1H), 1.00 (dt, J = 7.4,1.2 Hz, 1H). 13 C NMR (75 MHz, CDCl3) δ 153.19, 147.47, 144.70, 136.96, 132.76,131.42, 127.76, 126.90, 111.89, 107.32, 38.02, 29.86, 24.14, 20.87, 13.97. Figure 5 The above are the hydrogen and carbon NMR spectra of compound C1AC002 in Example 3 of this invention. Example

[0051] The difference from Example 2 is that in step (4), methyllithium is replaced with propylmagnesium bromide to obtain 4-butyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8c): yield 22%.

[0052] The chemical structural formula is shown in formula (d): Equation (d); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 7.35 (s, 1H), 7.23 (d, J = 3.9Hz, 1H), 6.94 (d, J = 4.1 Hz, 1H), 6.47 – 6.27 (m, 1H), 4.93 (d, J = 9.5 Hz, 1H), 4.61 (d, J= 2.0 Hz, 1H), 2.64 (s, 2H), 2.39 – 2.27 (m, 1H), 2.26 – 2.10(m, 1H), 1.42 (s, 2H), 1.20 (s, 3H), 1.12 (s, 1H), 0.84 – 0.69 (m, 1H). 13 C NMR(75 MHz, CDCl3) δ 155.67, 153.86, 146.28, 143.29, 135.93, 132.05, 129.86,126.20, 119.75, 107.99, 99.54, 32.84, 32.57, 29.60, 24.70, 23.48, 22.49,20.91, 13.88. Example

[0053] The difference from Example 2 is that the methyllithium in step (4) is replaced with butyl magnesium bromide, yielding 4-pentyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8d): yield 18%.

[0054] The chemical structural formula is shown in formula (e): Equation (e); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 7.41 (s, 1H), 7.29 (s, 1H),7.07 (d, J = 5.2 Hz, 1H), 6.45 (d, J = 3.3 Hz, 1H), 4.61 (d, J = 4.9 Hz, 1H),2.82 – 2.69 (m, 1H), 2.57 (d, J = 7.6 Hz, 1H), 2.37 (d, J = 3.6 Hz, 1H), 1.66(d, J = 5.3 Hz, 1H), 1.36 (d, J = 3.2 Hz, 1H), 1.14 (dd, J = 6.9, 3.1 Hz,1H), 0.92 (d, J = 5.1 Hz, 1H). 13C NMR (75 MHz, CDCl3) δ 153.20, 147.49,144.97, 136.95, 132.39, 131.00, 127.68, 126.89, 111.86, 107.26, 35.92, 31.60,30.71, 29.86, 24.12, 22.59, 20.86, 14.08. Example

[0055] The difference from Example 2 is that in step (4), methyllithium is replaced with pentyl magnesium bromide to obtain 4-hexyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8e): yield 19%.

[0056] The chemical structural formula is shown in formula (f): Equation (f); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 7.40 (d, J = 8.0 Hz, 1H), 7.27 (d, J = 7.6 Hz, 1H), 7.05 (s, 1H), 6.43 (s, 2H), 4.58 (s, 2H), 2.76 (hept, J= 6.9 Hz, 1H), 2.60 – 2.48 (m, 2H), 2.35 (s, 3H), 1.64 (dt, J = 15.4, 7.8 Hz,2H), 1.46 – 1.24 (m, 7H), 1.12 (d, J = 6.9 Hz, 6H), 0.91 (t, J = 6.5 Hz, 4H). 13 C NMR (75 MHz, CDCl3) δ 153.18, 147.48, 144.99, 136.96, 132.40, 131.01,127.75, 126.90, 111.83, 107.27, 35.98, 31.79, 31.02, 29.87, 29.11, 24.15,22.66, 20.89, 14.17. Example

[0057] The difference from Example 2 is that in step (4), methyllithium is replaced with hexyl magnesium bromide to obtain 4-heptyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8f): yield 20%.

[0058] The chemical structural formula is shown in formula (g): Formula (g); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 7.40 (d, J = 8.0 Hz, 1H), 7.27 (d, J = 7.4 Hz, 1H), 7.05 (s, 1H), 6.43 (s, 2H), 4.58 (s, 2H), 2.76 (dt, J =13.7, 6.9 Hz, 1H), 2.66 – 2.46 (m, 2H), 2.35 (s, 3H), 1.63 (dd, J = 13.9, 6.3Hz, 2H), 1.31 (dd, J = 15.5, 6.7 Hz, 10H), 1.12 (d, J = 6.9 Hz, 6H), 0.90 (t,J = 6.6 Hz, 4H). 13 C NMR (75 MHz, CDCl3) δ 153.18, 147.48, 144.99, 136.95,132.40, 131.01, 127.76, 126.89, 111.83, 107.27, 35.98, 31.86, 31.06, 29.87,29.39, 29.25, 24.15, 22.73, 20.88, 14.19. Example

[0059] The difference from Example 2 is that in step (4), methyllithium is replaced with cyclobutylmagnesium bromide to obtain 4-(cyclobutylmethyl)-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8g): yield 21%.

[0060] The chemical structural formula is shown in formula (h): Formula (h); The characterization data are as follows: 1H NMR (500 MHz, CDCl3) δ 7.40 (d, J = 8.0 Hz, 1H), 7.27 (d, J = 9.6 Hz, 1H), 7.05 (s, 1H), 6.38 (s, 2H), 4.55 (s, 2H), 2.75 (dt, J =13.7, 6.8 Hz, 1H), 2.66 (d, J = 7.3 Hz, 2H), 2.60 (dt, J = 15.1, 7.5 Hz, 1H), 2.35 (s, 3H), 2.16 – 2.03 (m, 2H), 1.94 – 1.81 (m, 2H), 1.76 (dd, J = 18.4,9.3 Hz, 3H), 1.12 (d, J = 6.9 Hz, 7H). 13 C NMR (126 MHz, CDCl3) δ 153.15,147.48, 143.36, 136.95, 132.39, 131.00, 127.80, 126.90, 111.94, 107.38,43.00, 36.89, 29.86, 28.45, 24.12, 20.85, 18.43. Example

[0061] The difference from Example 2 is that in step (4), lithium methyl is replaced with magnesium cyclopentyl bromide to obtain 4-(cyclopentylmethyl)-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8h): yield 17%.

[0062] The chemical structural formula is shown in formula (i): Formula (i); The characterization data are as follows: 1H NMR (500 MHz, CDCl3) δ 7.40 (d, J = 8.0 Hz, 1H), 7.26 (d, J = 4.9 Hz, 1H), 7.06 (s, 1H), 6.42 (s, 2H), 4.54 (s, 2H), 2.76 (dt, J =13.7, 6.9 Hz, 1H), 2.56 (d, J = 7.5 Hz, 2H), 2.35 (s, 3H), 2.13 (dt, J =15.5, 7.9 Hz, 1H), 1.77 (dt, J = 11.6, 5.6 Hz, 2H), 1.65 (dd, J = 13.9, 7.6Hz, 2H), 1.59 – 1.48 (m, 2H), 1.31 – 1.17 (m, 4H), 1.12 (d, J = 6.9 Hz, 6H). 13 C NMR (126 MHz, CDCl3) δ 153.11, 147.49, 144.42, 136.97, 132.40, 131.01,127.79, 126.92, 111.86, 107.66, 42.11, 41.58, 32.59, 29.87, 24.96, 24.12,20.85. Example

[0063] The difference from Example 2 is that in step (4), methyllithium is replaced with benzyl magnesium bromide to obtain 4-(phenylethyl)-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8i): yield 21%.

[0064] The chemical structural formula is shown in formula (j): Equation (j); The characterization data are as follows: 1 H NMR (500 MHz, CDCl3) δ 7.22 (d, J = 8.0 Hz, 1H), 7.10 (d, J = 8.3 Hz, 3H), 7.04 (dd, J = 14.8, 7.3 Hz, 3H), 6.87 (s, 1H), 6.28 (s,2H), 4.39 (s, 2H), 2.77 (s, 2H), 2.73 – 2.63 (m, 2H), 2.63 – 2.53 (m, 1H), 2.17 (s, 3H), 0.95 (d, J = 6.9 Hz, 6H). 13C NMR (126 MHz, CDCl3) δ 153.36,147.47, 143.82, 141.85, 137.02, 132.35, 131.09, 128.46, 128.40, 127.68,125.98, 112.25, 107.33, 37.93, 37.48, 29.91, 24.13, 20.89. Example

[0065] The difference from Example 2 is that in step (4), methyllithium is replaced with isopropyl magnesium bromide to obtain 4-(isobutyl)-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8j): yield 16%.

[0066] The chemical structural formula is shown in formula (k): Formula (k); The characterization data are as follows: 1 H NMR (400 MHz, CDCl3) δ 7.40 (d, J = 8.0 Hz, 1H), 7.28 (d, J = 6.7 Hz, 1H), 7.06 (s, 1H), 6.40 (s, 2H), 4.55 (s, 2H), 2.76 (s, 1H),2.43 (d, J = 7.2 Hz, 2H), 2.35 (s, 3H), 1.91 (s, 2H), 1.12 (d, J = 6.9 Hz, 6H), 0.95 (d, J = 6.6 Hz, 6H). 13 C NMR (101 MHz, CDCl3) δ 153.08, 147.48,143.75, 136.95, 132.40, 131.00, 127.83, 126.90, 111.95, 107.98, 45.47, 29.92,29.87, 24.09, 22.53, 20.84. Example

[0067] The difference from Example 2 is that in step (4), methyllithium is replaced with 2-methylpropylmagnesium bromide to obtain 4-(isopentyl)-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,6-diol (8k): yield 23%.

[0068] The chemical structural formula is shown in formula (l): Formula (l); The characterization data are as follows:1 H NMR (500 MHz, CDCl3) δ 7.39 (d, J = 8.0 Hz, 1H), 7.27 (d, J = 11.8 Hz, 1H), 7.04 (s, 1H), 6.43 (s, 2H), 4.56 (s, 2H), 2.75 (dt, J =13.7, 6.9 Hz, 1H), 2.56 (s, 2H), 2.34 (s, 3H), 1.63 (dt, J = 13.2, 6.6 Hz,1H), 1.54 (dd, J = 15.5, 7.4 Hz, 2H), 1.12 (d, J = 6.9 Hz, 6H), 0.95 (d, J =6.6 Hz, 7H). 13 C NMR (126 MHz, CDCl3) δ 153.24, 147.50, 145.13, 136.96, 132.39,131.01, 127.79, 126.90, 111.85, 107.24, 40.31, 33.75, 29.87, 27.71, 24.13,22.59, 20.86. Example

[0069] The difference from Example 2 is that 4-bromo-3,5-dimethoxybenzaldehyde in step (3) is replaced with 4-bromo-2,6-dimethoxybenzaldehyde; and methyllithium in step (4) is replaced with ethyl magnesium bromide, to obtain 4-propyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-3,5-diphenol (8l): yield 17%.

[0070] The chemical structural formula is shown in formula (m): Formula (m); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 7.31 (d, J = 7.9 Hz, 1H), 7.23 (d, J = 7.9 Hz, 1H), 7.14 (s, 1H), 6.44 (s, 2H), 4.63 (s, 2H), 2.91 (dt, J =13.8, 6.9 Hz, 1H), 2.64 – 2.46 (m, 2H), 2.13 (s, 3H), 1.79 – 1.56 (m, 2H), 1.25 (d, J = 6.9 Hz, 7H), 0.98 (t, J = 7.3 Hz, 3H). 13C NMR (75 MHz, CDCl3) δ152.96, 148.14, 144.82, 136.78, 131.42, 129.69, 129.21, 127.90, 112.20,107.42, 38.02, 33.64, 24.17, 24.03, 19.02, 13.97. Example

[0071] The difference from Example 2 is that 4-bromo-3,5-dimethoxybenzaldehyde in step (3) is replaced with 4-bromo-2,5-dimethoxybenzaldehyde; and methyllithium in step (4) is replaced with ethyl magnesium bromide, to obtain 4-propyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,5-diphenol (8m): yield 19%.

[0072] The chemical structural formula is shown in formula (n): Equation (n); The characterization data are as follows: 1 H NMR (500 MHz, CDCl3) δ 7.27 (d, J = 7.9 Hz, 1H), 7.16 (d, J = 9.4 Hz, 1H), 6.99 (s, 1H), 6.32 (s, 2H), 5.08 (s, 2H), 3.22 – 3.02(m, 1H), 2.75 – 2.62 (m, 2H), 2.33 (s, 3H), 1.66 (dd, J = 15.2, 7.5 Hz, 2H), 1.16 (d, J = 6.9 Hz, 6H), 1.04 (t, J = 7.4 Hz, 3H). 13 C NMR (101 MHz, CDCl3) δ154.15, 143.38, 141.12, 140.34, 134.65, 130.38, 128.42, 125.45, 113.63,109.12, 28.94, 25.15, 24.50, 22.41, 20.89, 14.29. Example

[0073] The difference from Example 2 is that 4-bromo-3,5-dimethoxybenzaldehyde in step (3) is replaced with 5-bromo-2,3-dimethoxybenzaldehyde; and methyllithium in step (4) is replaced with ethyl magnesium bromide, to obtain 5-propyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-3,4-diphenol (8n): yield 18%.

[0074] The chemical structural formula is shown in formula (o): Formula (o); The characterization data are as follows: 1 H NMR (500 MHz, CDCl3) δ 7.32 (d, J = 8.0 Hz, 1H), 7.21 (d, J = 8.0 Hz, 1H), 6.99 (s, 1H), 6.76 (s, 1H), 6.54 (s, 1H), 2.86 (dt, J =13.7, 6.9 Hz, 1H), 2.68 – 2.49 (m, 2H), 2.33 (s, 3H), 1.76 – 1.60 (m, 2H), 1.15 (d, J = 6.9 Hz, 3H), 1.08 (s, 2H), 1.01 (d, J = 7.4 Hz, 2H). 13 C NMR (101MHz, CDCl3) δ 146.72, 146.44, 145.30, 135.76, 134.03, 131.20, 129.71, 129.26,126.05, 125.65, 116.63, 116.30, 31.98, 29.50, 24.70, 23.67, 22.82, 20.86,14.11. Example

[0075] The difference from Example 2 is that 4-bromo-3,5-dimethoxybenzaldehyde in step (3) is replaced with 5-bromo-2,4-dimethoxybenzaldehyde; and methyllithium in step (4) is replaced with ethyl magnesium bromide, to obtain 5-propyl-2'-isopropyl-5'-methyl-[1,1'-biphenyl]-2,4-diphenol (8o): yield 21%.

[0076] The chemical structural formula is shown in formula (p): Formula (p); The characterization data are as follows: 1H NMR (500 MHz, CDCl3) δ 7.27 (d, J = 8.0 Hz, 1H), 7.15 (d, J = 7.9 Hz, 1H), 7.00 (s, 1H), 6.66 (d, J = 8.8 Hz, 2H), 5.29 (d, J =50.3 Hz, 2H), 3.09 (dt, J = 13.7, 6.9 Hz, 1H), 2.70 – 2.60 (m, 2H), 2.35 (s,3H), 1.70 (dd, J = 15.0, 7.5 Hz, 2H), 1.16 (d, J = 6.9 Hz, 6H), 1.00 (t, J =7.3 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 143.59, 142.45, 140.73, 134.62, 134.27,130.72, 128.44, 128.21, 125.45, 123.25, 113.96, 31.85, 28.99, 24.43, 22.81,20.92, 13.99. Example

[0077] The difference from Example 2 is that 2-isopropyl-5-methylphenol in step (1) is replaced with 5-isopropyl-2-methylphenol; and methyllithium in step (4) is replaced with ethyl magnesium bromide, to obtain 4-propyl-5'-isopropyl-2'-methyl-[1,1'-biphenyl]-2,6-diol (8p): yield 15%.

[0078] The chemical structural formula is shown in formula (q): Formula (q); The characterization data are as follows: 1H NMR (400 MHz, CDCl3) δ 7.32 (d, J = 8.0 Hz, 1H), 7.26 (s, 1H), 7.20 (d, J = 6.6 Hz, 1H), 7.00 (s, 1H), 6.82 (s, 1H), 6.45 (s, 1H), 4.79 (d, J = 91.1 Hz, 2H), 2.83 (dt, J = 13.7, 6.9 Hz, 1H), 2.69 – 2.44 (m,2H), 2.34 (s, 3H), 1.79 – 1.53 (m, 3H), 1.11 (dd, J = 24.4, 6.9 Hz, 6H), 0.96(t, J = 7.3 Hz, 3H). 13 C NMR (101 MHz, CDCl3) δ 153.80, 151.52, 145.74, 135.73,134.15, 131.61, 131.47, 129.57, 126.07, 120.08, 119.96, 102.12, 31.24, 29.48,24.63, 23.60, 23.00, 20.85, 13.86.

[0079] (1) 3,5-Dimethoxybenzaldehyde (10 mmol) was dissolved in 10 mL of tetrahydrofuran, and 0.3 mL of methyllithium (12 mmol) was slowly added dropwise at -20 °C and the reaction was allowed to proceed for 1 h. After the reaction was complete, 15 mL of saturated NH4Cl solution was added to quench the reaction. The aqueous phase was extracted with ethyl acetate, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, filtered, and the organic phase was concentrated to obtain the crude product. The crude product was purified by column chromatography to obtain 1-(3,5-dimethoxyphenyl)ethanol: yield 79%.

[0080] (2) 1-(3,5-dimethoxyphenyl)ethanol (2.7 mmol) and p-toluenesulfonic acid (5.4 mmol) were dissolved in 5 mL of methanol, and the catalyst amount Pd / C was added. H2 was introduced, and the reaction was carried out at 40 °C for 6 h. After the reaction was complete, Pd / C was removed by filtration, and 5 mL of saturated NaHCO3 solution was added to quench the reaction. The aqueous phase was extracted with dichloromethane, and the organic phase was washed with saturated NaCl solution, dried with anhydrous sodium sulfate, filtered, and the organic phase was concentrated to obtain the crude product. The crude product was purified by column chromatography to obtain 1-ethyl-3,5-dimethoxyphenyl: yield 22%.

[0081] (3) 1-Ethyl-3,5-dimethoxybenzene (1.3 mmol) was dissolved in 5 mL of dichloromethane, and BBr3 (3.9 mmol) was slowly added dropwise at -20 °C. After stirring, the mixture was transferred to room temperature for reaction. After the reaction was complete, 5 mL of water was added, the aqueous phase was extracted with dichloromethane, the organic phase was washed with saturated NaHCO3 solution, dried over anhydrous sodium sulfate, and filtered. The organic phase was concentrated to obtain the crude product, which was purified by column chromatography to obtain 5-ethylphenyl-1,3-diol: yield 52%.

[0082] (4) Dissolve 0.7 mmol of 5-ethylphenyl-1,3-diol in 2 mL of dichloromethane, add 1.4 mmol of (1S,4R)-1-methyl-4-(prop-1-en-2-yl)cyclohex-2-en-1-ol, and slowly add 0.05 mL (1.4 mmol) of formic acid. React overnight at room temperature. After the reaction is complete, add 2 mL of saturated NaHCO3 solution to quench the reaction. Extract the aqueous phase with ethyl acetate, wash the organic phase with saturated NaCl solution, dry with anhydrous sodium sulfate, filter, concentrate the organic phase to obtain the crude product, and purify by column chromatography to obtain (1'R,2'R)-4-ethyl-5'-methyl-2'-(prop-1-en-2-yl)-1',2',3',4'-tetrahydro-[1,1'-biphenyl]-2,6-diol: yield 33%.

[0083] (5) Dissolve (1'R,2'R)-4-ethyl-5'-methyl-2'-(prop-1-en-2-yl)-1',2',3',4'-tetrahydro-[1,1'-biphenyl]-2,6-diol (1 mmol) in 3 mL of toluene, add I2 (3 mmol), and reflux at 120 °C under N2 protection. After the reaction is complete, add 3 mL of saturated Na2S2O3 solution to quench the reaction. Extract the aqueous phase with ethyl acetate, wash the organic phase with saturated NaCl solution, dry with anhydrous sodium sulfate, filter, concentrate the organic phase to obtain crude product, and purify by column chromatography to obtain 3-ethyl-6,9-dimethyl-6H-benzo[c]chromen-1-ol (13): yield 9%.

[0084] The chemical structural formula is shown in formula (13): Equation (13); The characterization data are as follows: 1H NMR (300 MHz, CDCl3) δ 7.46 (s, 1H), 7.23 – 7.14 (m,1H), 7.08 (d, J = 7.7 Hz, 1H), 6.48 (s, 1H), 6.38 (s, 1H), 5.59 (s, 1H), 2.99(q, J = 7.4 Hz, 2H), 2.40 (s, 3H), 1.59 (s, 6H), 1.35 (t, J = 7.4 Hz, 3H). 13 CNMR (75 MHz, CDCl3) δ 156.85, 155.29, 142.81, 137.93, 136.46, 129.27, 126.98,126.70, 122.62, 116.29, 111.12, 102.96, 77.41, 27.25, 26.52, 21.57, 15.52.MS(ESI-) calcd for C 18 H 19 O2 - : 267.15 [M - H]; found: 267.19. Figure 3 This is the synthetic route for compound 13 in this invention.

[0085] The synthesis of compound 14 is the same as that of compound 13, except that the methyllithium in step (1) is replaced with ethyl magnesium bromide.

[0086] Figure 4 This is the synthetic route for compound 14 in this invention.

[0087] Equation (14); The characterization data are as follows: 1 H NMR (300 MHz, CDCl3) δ 8.20 (s, 1H), 7.16 (d, J = 7.8Hz, 1H), 7.08 (d, J = 7.6 Hz, 1H), 6.45 (s, 1H), 6.28 (s, 1H), 5.45 (s, 1H), 2.48 (t, J = 7.6 Hz, 2H), 2.40 (s, 3H), 1.76 – 1.48 (m, 9H), 0.94 (t, J = 7.3Hz, 4H). 13C NMR (75 MHz, CDCl3) δ 156.56, 152.32, 143.69, 136.92, 136.85,129.39, 127.17, 126.48, 123.78, 110.79, 109.98, 106.86, 77.41, 36.38, 29.43,25.01, 22.27, 16.30. MS (ESI-) calcd for C 19 H 21 O2 - : 281.16 [M - H]; found:281.24.

[0088] Anti-inflammatory activity was evaluated using a NO inhibition model. LPS treatment induces an inflammatory response, and increased nitric oxide is one manifestation of this response. The following compounds were analyzed for nitric oxide (NO). Anti-inflammatory activity was determined using IC50. 50 It indicates that IC 50 The lower the value, the higher the anti-inflammatory activity of the compound. 50 A value >200 indicates that the compound has almost no anti-inflammatory activity.

[0089] Table 1 Evaluation of the anti-inflammatory activity of biphenyl compounds 9 >200 10 >200 11 >200 12 >100 13 14.0 ± 1.5 14 10.3 ± 1.6 6' 20.4 ± 23.2 8a 4.5 ± 1.9 8b (C1AC002) 0.2 ± 0.03 8c 7.6 ± 5.6 8d 0.5 ± 0.5 8e 5.3 ± 3.4 8f 13.3 ± 4.2 8g 0.6 ± 0.4 8h 0.8 ± 2.2 8i 1.0 ± 1.0 8j 0.8 ± 4.2 8k 1.7 ± 1.0 8l 2.3 ± 0.8 8m 3.6 ± 3.1 8n 12.3 ± 5.0 8o 11.5 ± 5.0 8p 24.3 ± 5.1 The results are shown in Table 1. Conventional hydroquinone or biphenyl compounds 9-11, purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd., showed almost no anti-inflammatory activity, while compound 12 exhibited extremely weak anti-inflammatory activity.

[0090] Figure 9 This is a structural diagram of the compounds involved in this invention. The series of biphenyl compounds 6' and 8 of this invention exhibit good anti-inflammatory activity, among which compounds 8b, 8d, 8g, 8h, 8i, and 8j show excellent anti-inflammatory activity. Figure 6 As shown in Figure A, the representative compound 8b, C1AC002, exhibits significant anti-neuroinflammatory activity at 0.2 ± 0.03 µM. To further verify that the two hydroxyl groups in the biphenyl compounds of this invention are essential functional groups, comparative ring-closed compounds 13 and 14 were designed and synthesized. Compared to their structurally similar open-ring dihydroxy compounds 8a and 8b, their anti-inflammatory activity was significantly reduced, indicating that the biphenyl functional group is essential for the activity.

[0091] To further verify the anti-inflammatory activity of C1AC002, its mRNA was extracted after microglia were treated with the drug. The results showed that, at the transcriptional level, C1AC002 could inhibit the overproduction of LPS-induced inflammatory cytokines TNF-α, IL-1β, and IL-6 in a dose-dependent manner. Figure 6 B-6D).

[0092] In behavioral sensitization experiments ( Figure 7 A) After 7 consecutive days of morphine injections, the movement distance of mice was significantly increased compared to the control group, while the movement distance of mice treated with C1AC002 did not increase. Figure 7 B), after a 7-day withdrawal period, a smaller dose of morphine induced sensitization in the morphine-treated mice, but not in the C1AC002-treated mice. Figure 7 C); After 7 consecutive days of methamphetamine injection, the movement distance of mice increased significantly compared with the control group, while the movement distance of mice treated with C1AC002 did not increase. Figure 7 D), after a 7-day withdrawal period, a small dose of methamphetamine induced sensitization in the morphine group mice, but did not induce sensitization in the C1AC002 treatment group. Figure 7 E); After 7 consecutive days of cocaine hydrochloride injection, the movement distance of mice was significantly increased compared with the control group, while the movement distance of mice treated with C1AC002 did not increase. Figure 7 F), after a 7-day withdrawal period, a small dose of cocaine induced sensitization in the morphine group mice, but not in the C1AC002 treatment group. Figure 7 G).

[0093] In the Conditional Place Preference (CPP) experiment ( Figure 8 A) Mice were trained for 6 days by associating morphine with a black and white room. After morphine training, the mice developed a significant preference for morphine. Treatment with C1AC002 eliminated the preference for morphine in the trained mice. Figure 8 B); After methamphetamine training, mice developed a significant preference for methamphetamine. Treatment with C1AC002 eliminated the preference for methamphetamine in trained mice. Figure 8 C); After cocaine training, mice developed a significant preference for cocaine. Treatment with C1AC002 eliminated the preference for cocaine in trained mice. Figure 8 D).

[0094] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A biphenyl compound, characterized in that: The general structural formula of the biphenyl compounds is shown in formula (I): （I）； R1, R2, R3, R4, and R5 are selected from one or more of -H, -OH, alkanes, and alkenes; R6, R7, R8, R9, and R 10 Selected from -H, one or more of alkanes and alkenes.

2. The method for preparing biphenyl compounds as described in claim 1, characterized in that: include, Phenolic compound 1 reacts with trifluoromethanesulfonic anhydride under alkaline conditions of -78℃ to 25℃ to obtain phenyltrifluoromethanesulfonate compound 2. The reaction solvent includes one of dichloromethane, diethyl ether, tetrahydrofuran, and 1,4-dioxane, and the base includes one of triethylamine, pyridine, and N,N-diisopropylethylamine. Compound 2 reacts with a boron reagent under alkaline conditions at room temperature in the presence of a palladium catalyst to yield arylboronic acid ester compound 3. The palladium catalyst includes one of PdCl2(dppf), Pd(PPh3)4, XPhos Pd G3 / G4, and SPhos / RuPhos Pd G4; the boron reagent includes one of pinacol diboronate, tetrahydroxydiboron, and pinacolborane; the base includes one of KOAc, K3PO4, K2CO3, triethylamine, and DIPEA; and the reaction solvent includes one of dichloromethane, 1,4-dioxane, toluene, tetrahydrofuran, dimethylacetamide, MeOH, and EtOH. Compound 3 reacts with dimethyl ether bromobenzaldehyde compound 4 under alkaline conditions and room temperature in the presence of a palladium catalyst to yield biphenyl compound 5. The palladium catalyst includes one of Pd(PPh3)4, PdCl2(dppf), Pd(OAc)2+ ligand, and Pd2(dba)3. The base includes one of Na2CO3, K2CO3, Cs2CO3, K3PO4, and CsF. The reaction solvent includes one of toluene, 1,4-dioxane, DMF, ethanol / water, and THF. Compound 5 reacts with Grignard reagents at -20 to 25 °C to give compound 6. The Grignard reagents include lithium methyl, ethyl magnesium bromide, propyl magnesium bromide, butyl magnesium bromide, pentyl magnesium bromide, hexyl magnesium bromide, cyclobutyl magnesium bromide, cyclopentyl magnesium bromide, benzyl magnesium bromide, isopropyl magnesium bromide, and 2-methylpropyl magnesium bromide. The reaction solvent includes one of THF and Et2O. Compound 6 was reduced by a hydroxyl group under the action of a reducing agent to obtain compound 7, and compound 7 was then demethylated from anisole to obtain the final product.

3. The method for preparing biphenyl compounds as described in claim 2, characterized in that: The reduction system includes one of palladium on carbon-hydrogen, TFA / Et3SiH, or PPh3 / I2 / imidazolium; the conditions for demethylation of anisole are BBr3 / DCM, Me3SiI, NaI / TMSCl, or HBr / AcOH.

4. The method for preparing biphenyl compounds as described in claim 2, characterized in that: The substituents in the benzene ring of the phenolic compound 1 are selected from one or more of -H, alkanes, and alkenes.

5. The method for preparing biphenyl compounds as described in claim 2, characterized in that: The substituents in the benzene ring of the dimethyl ether brominated benzaldehyde compound 4 are selected from one or more of -H, -OH, -OMe, and alkanes.

6. A biphenyl derivative drug, characterized in that: Including biphenyl compounds represented by formula (I).

7. The use of the biphenyl compounds as described in claim 1 in the preparation of drugs for treating neuroinflammatory diseases.

8. The use of the biphenyl compounds as described in claim 1 in the preparation of drugs for the treatment or prevention of addiction to opioids and / or methamphetamine and / or cocaine.

9. The application as described in claim 8, characterized in that: The opioids include, but are not limited to, fentanyl, ibuprofen, codeine, diazepam, dihydrocodeine, enkephalin, heroin, oxycodone, oxymectin, meperidine, methadone, morphine, nicoridine, opium, Oscontin, and their derivatives and precursors.

10. The application as described in claim 7, characterized in that: The biphenyl compounds represented by formula (I) can be used in conjunction with pharmacologically acceptable excipients.

Images