Imidazolyl binary asymmetric biomimetic lipid compound and preparation method and application thereof

Abstract

This invention relates to an imidazole-based binary asymmetric biomimetic lipid compound, its preparation method, and its applications. The imidazole-based binary asymmetric biomimetic lipid structure is designed to mimic natural phospholipids and cholesterol. Its hydrophobic tail is composed of a diacylglycerol ester of natural phospholipid and a steroidal ring of cholesterol. Furthermore, a dimethylamino group of varying alkyl chain lengths is modified at the 2-position of the imidazole ring, forming an imidazole-based biomimetic lipid with an asymmetric hydrophobic tail. The imidazole-based binary asymmetric biomimetic lipid exhibits good biocompatibility and can replace lipid excipients (phospholipids and cholesterol) in mixing with therapeutic drugs. This allows for the preparation of drug-loaded lipid nanoparticles containing therapeutic drugs, which can be used as a drug delivery system for the preparation of brain-targeted drugs. The resulting drug delivery system can effectively cross the blood-brain barrier, achieving good brain-targeted delivery of the loaded therapeutic drugs.

Description

Technical Field

[0001] This invention belongs to the field of drug delivery technology, and in particular relates to an imidazole-based binary asymmetric biomimetic lipid compound, its preparation method, and its application. Background Technology

[0002] Brain diseases are a major category of diseases that seriously threaten human health. Among them, malignant gliomas (GBM), as the most common malignant intracranial tumors, are characterized by high invasiveness, high recurrence rate, and extremely poor prognosis, with a very low 5-year survival rate for patients. Neurodegenerative diseases such as Alzheimer's disease (AD) and Parkinson's disease (PD) are experiencing a continuous increase in incidence due to the aging population, gradually becoming the main cause of cognitive decline and functional loss in the elderly, placing a heavy burden on patients' families and society. Currently, the clinical cure of brain diseases faces a core bottleneck—the blood-brain barrier (BBB). The BBB is a selectively permeable dynamic interface mainly composed of brain capillary endothelial cells and their tight junctions, astrocytes, pericytes, and the basement membrane. While it can prevent harmful substances from entering brain tissue to maintain homeostasis, it also blocks the delivery of almost 98% of small molecule drugs and nearly 100% of large molecule drugs, preventing most potentially effective therapeutic drugs from reaching the lesion site and exerting their effects, thus becoming a key obstacle to the cure of brain diseases.

[0003] Lipid nanoparticles (LNPs) are currently the most promising nanocarrier systems in the field of drug delivery technology. Compared with traditional delivery systems such as polymer nanoparticles and viral vectors, LNPs exhibit excellent biocompatibility and biodegradability. After being metabolized in vivo, they can be converted into naturally occurring lipid components in the body, resulting in higher safety and significantly reducing carrier-related toxicity and immunogenicity risks. Their core advantage lies in their diverse drug loading strategies. They can load different types of therapeutic molecules, such as small molecule chemical drugs, nucleic acid drugs (mRNA, siRNA, etc.), and proteins, through hydrophobic interactions and electrostatic adsorption, effectively protecting drugs from enzymatic and oxidative degradation in vivo and prolonging the drug's circulating half-life. Furthermore, functional molecules such as targeting ligands and penetration enhancers can be customized and modified on the surface of LNPs to achieve precise targeted delivery to diseased tissues, while reducing off-target effects and increasing drug concentration at the target site. These characteristics make them ideal drug carriers for overcoming physiological barriers and optimizing drug delivery efficiency.

[0004] However, most LNPs currently used in clinical practice struggle to effectively cross the brain border (BBB), presenting a technological bottleneck in brain drug delivery. Therefore, there is an urgent need to develop LNP drug delivery systems capable of effectively crossing the BBB and achieving precise drug delivery within the brain, thereby effectively treating brain diseases such as brain tumors, Alzheimer's disease, and Parkinson's disease. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides an imidazole-based binary asymmetric biomimetic lipid compound, its preparation method, and its applications. Drug-loaded lipid nanoparticles composed of this imidazole-based binary asymmetric biomimetic lipid compound can effectively cross the blood-brain barrier, enabling the efficient delivery of small molecule chemical drugs, peptide drugs, or small nucleic acid drugs to brain tissue.

[0006] The technical solution adopted in this invention is: an imidazole-based binary asymmetric biomimetic lipid compound, the structure of which is shown in Formula 12;

[0007] Equation 12;

[0008] Where R' is C9~C 18 A straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R" is C9~C9. 18 The straight-chain saturated hydrocarbon group or the straight-chain unsaturated hydrocarbon group, where R' and R" are the same group or different groups;

[0009] m is an integer from 2 to 5, and n is an integer from 3 to 9;

[0010] X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - .

[0011] Preferably, R' and R" are C 13 ~C 17 Straight-chain alkyl, monoalkenyl, or diene-chain compounds.

[0012] Preferably, R' and R" are one or both of the following structures:

[0013]

[0014] Preferably, m is 2, 3 or 4, and n is 3, 4 or 5.

[0015] Preferably, X - For I - or Cl - .

[0016] A method for preparing imidazole-based binary asymmetric biomimetic lipid compounds includes the following steps:

[0017] Step S01: The compound shown in Formula 1 is reacted with a protecting agent containing the protecting group PG-I to obtain the intermediate shown in Formula 2;

[0018] ;

[0019] Step S02: The intermediate shown in Formula 2 is reacted with a protecting agent containing the protecting group PG-II to obtain the intermediate shown in Formula 3;

[0020] ;

[0021] Step S03: The intermediate shown in Formula 3 and the compound shown in Formula 4 are reacted together under anaerobic and strongly alkaline conditions to obtain the intermediate shown in Formula 5.

[0022] ;

[0023] Step S04: Under certain conditions, the protecting group PG-I of the intermediate shown in Formula 5 is removed to obtain the intermediate shown in Formula 6.

[0024] ;

[0025] Step S05: The intermediate shown in Formula 6 and the compound shown in Formula 7 are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 8.

[0026] ;

[0027] Step S06: Under certain conditions, the protecting group PG-II of the intermediate shown in Formula 8 is removed to obtain the diacylimidazolium-based biomimetic lipid compound shown in Formula 9.

[0028] ;

[0029] Step S07: The diacylimidazolium biomimetic lipid compound shown in Formula 9 is subjected to an esterification reaction with the compound shown in Formula 10 under certain conditions, and then formed a salt with the compound shown in Formula 11 to obtain the imidazolium binary asymmetric biomimetic lipid compound shown in Formula 12.

[0030] .

[0031] A diacylimidazolyl biomimetic lipid compound, the structure of which is shown in Formula 9; Equation 9; Where R' is C9~C 18 A straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R" is C9~C9. 18 The straight-chain saturated hydrocarbon group or the straight-chain unsaturated hydrocarbon group, where R' and R" are the same group or different groups; n is an integer from 3 to 9; Preferably, R' and R" are C 13 ~C 17 Straight-chain alkyl, monoalkenyl, or diene-chain compounds.

[0032] Preferably, R' and R" are one or both of the following structures:

[0033] Preferably, n is 3, 4 or 5.

[0034] A lipid nanoparticle comprising an imidazole-based binary asymmetric biomimetic lipid compound.

[0035] Preferably, the lipid nanoparticles include the imidazole-based binary asymmetric biomimetic lipid compound shown in Formula 12 and the diacylimidazole-based biomimetic lipid compound shown in Formula 9.

[0036] The method for preparing the above-mentioned lipid nanoparticles involves mixing an imidazole-based binary asymmetric biomimetic lipid compound with a diacylimidazole-based biomimetic lipid compound at a molar ratio of 1:(0.5~1), and then preparing the above-mentioned lipid nanoparticles by a thin-film hydration method or a microfluidic system.

[0037] A drug-loaded lipid nanoparticle comprising an imidazole-based binary asymmetric biomimetic lipid compound of Formula 12, phospholipids, cholesterol, and a therapeutic drug.

[0038] A drug-loaded lipid nanoparticle comprises an imidazole-based binary asymmetric biomimetic lipid compound as shown in Formula 12, a diacylimidazolium-based biomimetic lipid compound as shown in Formula 9, and a therapeutic drug; preferably, the molar ratio of the imidazole-based binary asymmetric biomimetic lipid compound to the diacylimidazolium-based biomimetic lipid compound is 1:(0.5~1).

[0039] Preferably, the diacylimidazolium-based biomimetic lipid compound shown in Formula 9 has the same R' and R" as the imidazolium-based binary asymmetric biomimetic lipid compound shown in Formula 12; more preferably, the diacylimidazolium-based biomimetic lipid compound shown in Formula 9 is an intermediate product for synthesizing the imidazolium-based binary asymmetric biomimetic lipid compound shown in Formula 12.

[0040] Preferably, the therapeutic drug is one or more of small molecule chemical drugs, polypeptide drugs, and small nucleic acid drugs.

[0041] Preferably, the small molecule chemical drug is one or more of synthetic small molecule chemical drugs and natural product drugs;

[0042] Preferably, the polypeptide drug is one or more of neuropeptides, neurokinins, and bradykinins;

[0043] Preferably, the small nucleic acid drug is one or more of ASO, siRNA, snRNA, shRNA, saRNA, and miRNA.

[0044] A method for preparing drug-loaded lipid nanoparticles involves mixing an imidazole-based binary asymmetric biomimetic lipid compound with a diacylimidazole-based biomimetic lipid compound and a therapeutic drug, and then preparing lipid nanoparticles in which the therapeutic drug is loaded using a thin-film hydration method or a microfluidic system.

[0045] Application of drug-loaded lipid nanoparticles in the preparation of brain-targeted drugs.

[0046] Preferably, drug-loaded lipid nanoparticles are used as a drug delivery system for the preparation of brain-targeted drugs;

[0047] Preferably, the drug-loaded lipid nanoparticle delivery system is capable of crossing the blood-brain barrier.

[0048] The advantages and positive effects of this invention are as follows: The hydrophobic tail of the imidazole-based binary asymmetric biomimetic lipid compound is composed of the diacylglycerol ester of natural phospholipids and the steroidal ring of cholesterol, which can highly mimic the membrane physiological behavior and function of natural phospholipids and cholesterol, and its high biomimeticity is reflected in its good biocompatibility. Furthermore, the high biomimeticity of the imidazole-based binary asymmetric biomimetic lipid compound allows it to replace two commonly used lipid excipients, natural phospholipids and cholesterol, in the preparation of drug-loaded lipid nanoparticles. Moreover, the imidazole-based binary asymmetric biomimetic lipid compound possesses a dimethylamino functional group, which can improve blood-brain barrier permeability, facilitating the crossing of the blood-brain barrier by drug-loaded lipid nanoparticles composed of the imidazole-based binary asymmetric biomimetic lipid compound, and achieving effective brain-targeted delivery of the loaded drug. Its brain-targeted delivery efficiency is significantly superior to the LNPs delivery system composed of the representative ionizable cationic lipids ALC-0315 and SM-102.

[0049] Imidazole-based binary asymmetric biomimetic lipid compounds are the first innovative biomimetic lipid materials that can simultaneously replace natural phospholipids and cholesterol and cross the blood-brain barrier. Nanoparticle drug carriers composed of these compounds belong to a new generation of biomimetic delivery systems, providing a new strategy for achieving brain-targeted delivery of different types of drugs. Attached Figure Description

[0050] Figure 1 This is a schematic diagram of a drug delivery system for lipid nanoparticles based on imidazole-based binary asymmetric biomimetic lipid compounds.

[0051] Figure 2 Transmission electron microscopy (TEM) images of the lipid nanoparticles prepared in Example 3 and Comparative Examples 1 (Comparative Examples 1-3); where A: LNPs-1 (dA5Z) 2 18C4-JI / dA5Z 2 18); B: Control Example 1 (ALC-0315 / DSPC); C: Control Example 2 (D-Lin-MC3-DMA / DSPC); D: Control Example 3 (SM-102 / DSPC);

[0052] Figure 3 dA5Z is an imidazole-based binary asymmetric biomimetic lipid compound. 2 Membrane physiological performance characterization of 18C4-JI; where A: composed of dA5Z 2 Surface pressure (π) - membrane area (S) isotherm of a monolayer lipid membrane model composed of 18C4-JI; B: composed of dA5Z 2 Differential scanning calorimetry curves of a lipid bilayer model composed of 18C4-JI;

[0053] Figure 4 The real-time dynamic change trend of transmembrane resistance (TEER) of the in vitro blood-brain barrier model mediated by lipid nanoparticles prepared in Example 3 and Comparative Example 1 is shown; where A: LNPs-1(dA5Z) 2 18C4-JI / dA5Z 2 18) LNPs-15(dA5Z ij 2 18C4-JI / dA5Z ij 2 18) and LNPs-17 (dA5Z15Z) ij 18C4-JCl / dA5Z15Z ij 18) and Comparative Example 2 (D-Lin-MC3-DMA / DSPC) and Comparative Example 3 (SM-102 / DSPC); B: LNPs-3 (dA4Z 2 15C3-JI / dA4Z 2 15) LNPs-8(dA4Z) ij 2 15C4-JI / dA4Z ij 2 15) and LNPs-12(dA4Z15Z ij 15C4-JI / dA4Z15Z ij 15) and Comparative Example 1 (ALC-0315 / DSPC);

[0054] Figure 5 The brain drug delivery effect of the drug-loaded lipid nanoparticles PTX@LNPs-1 prepared in Example 6 and the drug-loaded lipid nanoparticles prepared in Comparative Examples 2-3 (Control Examples 4-9) is compared; where A: brain tissue-plasma concentration ratio (B / P ratio); B: relative tumor proliferation rate (T / C ratio).

[0055] Figure 6The brain drug delivery effect of the drug-loaded lipid nanoparticles Cy7-ASO@LNPs-1 prepared in Example 9 and the drug-loaded lipid nanoparticles prepared in Comparative Examples 4-5 (Control Examples 10-15) is shown. Wherein, A: total fluorescence intensity in the mouse brain after in vivo delivery of ASO; B: target gene content in the mouse brain after in vivo delivery of ASO. Detailed Implementation

[0056] The embodiments of the present invention will now be described with reference to the accompanying drawings.

[0057] This invention relates to an imidazole-based binary asymmetric biomimetic lipid compound, its preparation method, and its applications. The imidazole-based binary asymmetric biomimetic lipid structure is designed to mimic natural phospholipids and cholesterol. Its hydrophobic tail is composed of a diacylglycerol ester of natural phospholipid and a steroid ring of cholesterol. Furthermore, a dimethylamino group of varying alkyl chain lengths is modified at the 2-position of the imidazole ring, forming an imidazole-based biomimetic lipid with an asymmetric hydrophobic tail. The imidazole-based binary asymmetric biomimetic lipid exhibits good biocompatibility and extremely low cytotoxicity. Drug delivery systems formed from imidazole-based binary asymmetric biomimetic lipids can effectively cross the blood-brain barrier, achieving good brain-targeted delivery of various drugs, including small molecule drugs, peptide drugs, and small nucleic acid drugs.

[0058] The structure of the imidazole-based binary asymmetric biomimetic lipid compound is shown in Formula 12.

[0059] Equation 12;

[0060] Among them, R' and R" are each independently selected from chains with lengths C9 to C1. 18 The linear saturated or linear unsaturated hydrocarbon group, where R' and R" are the same or different groups; m is an integer from 2 to 5, and n is an integer from 3 to 9; X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - In some embodiments of the present invention, R' and R" are each independently selected from chains of length C. 13 ~C 17 Straight-chain alkyl, monoalkenyl, or dieneyl; m is preferably 2, 3, or 4, and n is preferably 3, 4, or 5; X - Preferably I - or Cl - .

[0061] A diacylimidazolyl biomimetic lipid compound, the structure of which is shown in Formula 9;

[0062] Equation 9;

[0063] Where R' is C9~C 18 A straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R" is C9~C9. 18 The chain consists of a straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R' and R" are the same group or different groups; n is an integer from 3 to 9. In some embodiments of the present invention, R' and R" are each independently selected from chains with a chain length of C. 13 ~C 17 Straight-chain alkyl, monoalkenyl, or dieneyl; n is preferably 3, 4, or 5.

[0064] The preparation method of the imidazole-based binary asymmetric biomimetic lipid compound, as shown in Formula 12, is as follows:

[0065] Step S01: React the compound shown in Formula 1 with a protecting agent containing the protecting group PG-I to obtain the intermediate shown in Formula 2;

[0066]

[0067] Organic base B and organic catalyst C are added to an anhydrous organic solvent A containing the compound shown in Formula 1, followed by the addition of protective agent I. The mixture is stirred under nitrogen protection, and after the reaction is complete, the intermediate shown in Formula 2 is obtained by separation. The anhydrous organic solvent A can be dichloromethane (DCM), acetonitrile (ACN), or tetrahydrofuran (THF), etc.; the protective agent I can be benzyloxycarbonyl chloride (CbzCl) or ditert-butyl dicarbonate ((Boc)2O), etc.; the organic base B can be triethylamine (TEA) or N,N-diisopropylethylamine (DIPEA), etc.; and the organic catalyst C can be 4-dimethylaminopyridine (DMAP) or 4-pyrrolidinylpyridine (4-PPy), etc.

[0068] Step S02: The intermediate shown in Formula 2 is reacted with a protecting agent containing the protecting group PG-II to obtain the intermediate shown in Formula 3;

[0069]

[0070] The intermediate shown in Formula 2 is dissolved in anhydrous organic solvent B. Under nitrogen protection, organic base B is added first, followed by the slow addition of protecting group II and stirring at 0°C. After the reaction is completed, the intermediate shown in Formula 3 is obtained by separation. The anhydrous organic solvent B can be N,N-dimethylformamide (DMF) or dichloromethane (DCM), etc.; the protecting agent II can be tert-butyldiphenylchlorosilane (TBDPSCl), tert-butyldimethylchlorosilane (TBSCl), or triphenylchloromethane (TrtCl), etc.

[0071] Step S03: React the intermediate shown in Formula 3 with the compound shown in Formula 4 under anaerobic and strongly alkaline conditions to obtain the intermediate shown in Formula 5.

[0072]

[0073] Under nitrogen protection, a strong base A is slowly added to an anhydrous organic solvent C containing the intermediate shown in Formula 3, and the mixture is kept at this temperature while stirring. Subsequently, the compound shown in Formula 4 is slowly added under the same temperature and stirring, followed by a slow gradient increase in temperature to -20°C with continued stirring. After the reaction is complete, the intermediate shown in Formula 5 is obtained by separation. The anhydrous organic solvent C can be tetrahydrofuran (THF) or N,N-dimethylformamide (DMF); the strong base A can be NaH or potassium hexamethyldisilamide (KHMDS), etc.

[0074] Step S04: Under certain conditions, remove the protecting group PG-I of the intermediate shown in Formula 5 to obtain the intermediate shown in Formula 6;

[0075]

[0076] The intermediate shown in Formula 5 is dissolved in anhydrous organic solvent D. After complete dissolution, deprotecting agent A is added. After the reaction is completed at room temperature, the intermediate shown in Formula 6 is obtained by separation. The anhydrous organic solvent D can be dichloromethane (DCM), tetrahydrofuran (THF), or dioxane (Diox), etc.; the deprotecting agent A can be trifluoroacetic acid (TFA) or hydrochloric acid, etc.

[0077] Step S05: The intermediate shown in Formula 6 and the compound shown in Formula 7 are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 8.

[0078]

[0079] Under nitrogen protection, organic base B and activator A are added sequentially to an anhydrous organic solvent E containing the intermediate shown in Formula 6, and the mixture is stirred at 0°C. Then, the compound shown in Formula 7 and inorganic base A are added, and the mixture is heated to 40-60°C with continued stirring. After the reaction is complete, the intermediate shown in Formula 8 is obtained by separation. The anhydrous organic solvent E can be dichloromethane (DCM) or acetonitrile (ACN), etc.; the activator A can be methanesulfonyl chloride (MsCl) or p-toluenesulfonyl chloride (TsCl), etc.; and the inorganic base A can be K₂CO₃ or Cs₂CO₃, etc.

[0080] Step S06: Under certain conditions, the protecting group PG-II of the intermediate shown in Formula 8 is removed to obtain the diacylimidazolium-based biomimetic lipid compound shown in Formula 9;

[0081]

[0082] The intermediate shown in Formula 8 was dissolved in anhydrous organic solvent F. After complete dissolution, deprotecting agent B was slowly added under nitrogen protection and stirred at room temperature. After the reaction was completed, the diacylimidazolium-based biomimetic lipid compound shown in Formula 9 was obtained by separation. The anhydrous organic solvent F can be tetrahydrofuran (THF), dichloromethane (DCM), or acetonitrile (ACN), etc.; the deprotecting agent B can be tetrabutylammonium fluoride (TBAF) or triethylamine hydrogen fluoride (Et3N·3HF), etc.

[0083] Step S07: The diacylimidazolium biomimetic lipid compound shown in Formula 9 is subjected to an esterification reaction with the compound shown in Formula 10 under certain conditions, and then formed a salt with the compound shown in Formula 11 to obtain the imidazolium binary asymmetric biomimetic lipid compound shown in Formula 12.

[0084]

[0085] The intermediate shown in Formula 9 was dissolved in anhydrous organic solvent G. Organic base B, activator B, organic catalyst C, and the compound shown in Formula 10 were added sequentially at 0°C under nitrogen protection. The mixture was stirred at 0°C, slowly raised to room temperature, and stirred further. After the reaction was complete, the mixture was separated and then reacted with the compound shown in Formula 11 (HX) to form a salt. The compound shown in Formula 12 was obtained after further separation. The anhydrous organic solvent G can be dichloromethane (DCM) or N,N-dimethylformamide (DMF), etc.; the activator B can be 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC·HCl), dicyclohexylcarbodiimide (DCC), or N,N'-diisopropylcarbodiimide (DIC), etc.

[0086] Furthermore, unless otherwise defined, all terms used in this invention (including technical and scientific terms) have their ordinary meanings as understood by those skilled in the art. The letters "A," "B," "C," "D," and "E" appearing in this invention are codes for reagents or solvents, used only to distinguish similar reagents or solvents, and do not indicate or imply the relative importance or order of the reagents or solvents represented. Moreover, the reagents or solvents represented by the letters "A," "B," "C," "D," and "E" used in this invention can be interchanged where appropriate. It should be noted that all terms used in this invention are merely for describing specific embodiments and are not intended to limit the invention.

[0087] In some embodiments of the present invention, R' and R" in Formula 12 and Formula 9 are the same group or different groups. When R' and R" are different groups, they can be groups with the same carbon chain length or groups with different carbon chain lengths; preferably, R' and R" are each independently selected from groups with a chain length of C 13 ~C 17 Straight-chain alkyl, monoalkenyl, or dienyl; specifically, one or both of the following structural formulas:

[0088]

[0089] The carbon chain length and unsaturation of R' and R" can modulate the biomimetic and self-assembly polymorphism of imidazole binary asymmetric biomimetic lipid compounds, thereby affecting their biocompatibility and the stability of the drug-loaded lipid nanoparticles they form, thus improving their drug loading and delivery efficiency.

[0090] In some embodiments of the present invention, m in Formula 12 is preferably 2, 3, or 4. The value of m is the length of the flexible lipid chain between the cholesterol steroid ring unit and the hydrophilic imidazole ring in the hydrophobic structure of the imidazole-based binary asymmetric biomimetic lipid compound. This value directly affects the membrane physiological behavior and function of the cholesterol steroid ring unit in the lipid bilayer, and indirectly affects the biocompatibility of the imidazole-based binary asymmetric biomimetic lipid compound, as well as the stability and biosafety of the drug-loaded lipid nanoparticles composed of it.

[0091] In some embodiments of the present invention, n in Formulas 12 and 9 is preferably 3, 4, or 5. The value of n represents the length of the flexible lipid chain between the dimethylamino group and the imidazole ring in the hydrophilic structure of the imidazole-based binary asymmetric biomimetic lipid compound, directly affecting the affinity of the dimethylamino group for the blood-brain barrier tightly bound functional protein, thus determining the blood-brain barrier permeability. This, in turn, affects the drug delivery efficiency of drug-loaded lipid nanoparticles composed of imidazole-based binary asymmetric biomimetic lipid compounds across the blood-brain barrier.

[0092] In some embodiments of the present invention, the imidazole-based binary asymmetric biomimetic lipid compound may be one of the following formulas:

[0093]

[0094]

[0095]

[0096] Bio-mimetic imidazolium-based lipids (BILs) are a class of biomimetic imidazolium-based ionizable lipids. The imidazolium ring, as a histidine side chain, is ubiquitous in peptides and proteins, with a pKa of approximately 6.0. It exhibits significant buffering capacity and superior pH responsiveness in endosomes compared to commercially available ionizable aminocationic lipids (such as ALC-0315), demonstrating excellent endosome escape capabilities and drug delivery potential. Furthermore, the chemical modifiability of the imidazolium ring and the π-π stacking effect contribute to improving drug loading rates and targeted delivery efficiency. This invention utilizes a biomimetic design strategy that splices molecular fragments of hydrophilic imidazolium rings with hydrophobic units of diacylglycerols from natural phospholipids and hydrophobic units of steroidal rings from cholesterol. This results in a class of BILs based on imidazolium rings and possessing the hydrophobic structural characteristics of both phospholipids and cholesterol, namely, asymmetric binary bio-mimeticimidazolium-based lipids (ABBILs). In the ABBILs structure, diacylglycerols are linked to imidazole rings via alkyl ether bonds, similar to the structure of Brain PE, an important phospholipid in the brain, thus functioning as a hydrophobic framework for biological membranes. Meanwhile, cholesterol steroidal ring units are linked to imidazole rings via flexible lipid chains, interacting hydrophobically with the diacylglycerols on the proximal side of the molecule. They can also rotate flexibly, fully interacting with neighboring molecules, closely mimicking the membrane physiological behavior of cholesterol as a structural lipid, regulating the fluidity of biological membranes while maintaining their integrity.

[0097] The binary asymmetric hydrophobic units of diacylglycerols and cholesterol steroid rings can act independently or synergistically, enabling ABBILs molecules to simultaneously mimic the membrane physiological behavior and function of natural phospholipids and cholesterol, exhibiting binary biomimetic properties. Therefore, ABBILs demonstrate good biocompatibility with cell membranes and superior biosafety compared to traditional ionizable cationic lipids such as ALC-0315, Dlin-MC3-DMA, and SM-102. They can be combined with other lipid excipients to form innovative biomimetic LNP delivery systems for the delivery of small molecule drugs, peptide drugs, and small nucleic acid drugs.

[0098] Furthermore, the present invention also relates to a drug-loaded lipid nanoparticle comprising an imidazole-based binary asymmetric biomimetic lipid compound of Formula 12 or a pharmaceutically acceptable solvate thereof; further comprising a diacylimidazolium-based biomimetic lipid compound of Formula 9 and a therapeutic drug. The diacylimidazolium-based biomimetic lipid compound of Formula 9 is the remaining portion of the molecular structure of the imidazole-based binary asymmetric biomimetic lipid compound of Formula 12 after removing the cholesterol carboxylic acid derivative fragment (i.e., the compound shown in Formula 10), and contains only a hydrophilic imidazole ring and a diacylglycerol hydrophobic unit. The diacylimidazolium-based biomimetic lipid compound of Formula 9 and the imidazolium-based binary asymmetric biomimetic lipid compound of Formula 12, which can be mixed to prepare drug-loaded lipid nanoparticles, can have the same R' and R" groups, or they can have different R' and R" groups; preferably, they have the same R' and R" groups. When using the diacylimidazolium-based biomimetic lipid compound of Formula 9 and the imidazolium-based binary asymmetric biomimetic lipid compound of Formula 12 with the same R' and R" groups, more stable drug-loaded lipid nanoparticles can be formed due to the same hydrophobic lipid flexible tail chain. The therapeutic drug is one or more of small molecule drugs, peptide drugs, and small nucleic acid drugs. Among them, the small molecule chemical drugs are one or more of synthetic small molecule chemical drugs and natural product drugs; the peptide drugs are one or more of neuropeptides, neurokinins, and bradykinins; and the small nucleic acid drugs are one or more of ASO, siRNA, snRNA, shRNA, saRNA, and miRNA.

[0099] In this invention, the term "solvent" refers to a complex formed by the imidazole-based binary asymmetric biomimetic lipid compound shown in Formula 12 and a solvent (e.g., ethanol or water). For example, the term "hydrate" refers to the case where the solvent in the aforementioned term "solvent" is water. Furthermore, the imidazole-based binary asymmetric biomimetic lipid compound shown in Formula 12 can be separated into solvate forms, and any solvate is included within the scope of protection of this invention.

[0100] The imidazole-based binary asymmetric biomimetic lipid compound shown in Formula 12 and the diacylimidazole-based biomimetic lipid compound shown in Formula 9 can be mixed at a molar ratio of 1:(0.5~1) to prepare lipid nanoparticles (LNPs) with diameters of 80-220 nm by thin film hydration or microfluidic system.

[0101] Furthermore, these LNPs can be used as delivery systems to load different types of drugs for drug delivery. This invention also employs thin-film hydration or microfluidic systems to prepare drug-loaded lipid nanoparticles, such as... Figure 1 As shown.

[0102] In imidazole-based binary asymmetric biomimetic lipid compounds (ABBILs), the introduction of dimethylamino groups with varying alkyl chain lengths at the 2-position of the imidazole ring can effectively trigger the opening of tight junctions at the blood-brain barrier, improving its permeability. This enables drug-loaded lipid nanoparticles based on ABBILs to effectively cross the blood-brain barrier and deliver drugs to the brain, facilitating the preparation of brain-targeted drugs.

[0103] The imidazole-based binary asymmetric biomimetic lipid compound shown in Formula 12 differs significantly in structure from representative ionizable cationic lipids in existing delivery technologies, such as ALC-0315 and SM-102, and exhibits highly biomimetic structural features, demonstrating good biocompatibility and low cytotoxicity. Furthermore, ABBIL-based drug-loaded lipid nanoparticles have a broad drug loading spectrum and can be widely used to prepare brain-targeted drug delivery systems and formulations capable of crossing the blood-brain barrier. Their brain-targeted delivery efficiency is significantly superior to LNPs delivery systems composed of ionizable cationic lipids ALC-0315, D-Lin-MC3-DMA, or SM-102.

[0104] The present invention will now be described with reference to the accompanying drawings. Experimental methods not specifically described in the accompanying drawings are performed according to the corresponding product instructions. Unless otherwise specified, the instruments, reagents, and consumables used in the embodiments can be purchased from commercial companies. It should be noted that, unless otherwise defined, the technical or scientific terms used in this invention should have the ordinary meaning understood by those skilled in the art.

[0105] Example 1: Imidazole-based binary asymmetric biomimetic lipid compound dA5Z 2 Synthesis of 18C4-JI

[0106] dA5Z 2 The synthesis process of 18C4-JI is shown in the following formula:

[0107]

[0108] The specific synthesis process is as follows:

[0109] (1) Preparation of 1-N-Boc-4,5-dihydroxymethylimidazolium (I-1)

[0110] 128 mg (1.0 mmol, 1.0 eq.) of 4,5-dihydroxymethylimidazolium (I-0) was dissolved in 4.0 mL of anhydrous dichloromethane. Under nitrogen protection, 121 mg of triethylamine (1.2 mmol, 1.2 eq.) and 12 mg of 4-dimethylaminopyridine (0.1 mmol, 0.1 eq.) were added sequentially. After mixing thoroughly at 0 °C, 1.0 mL of anhydrous dichloromethane solution of di-tert-butyl dicarbonate (1.05 mmol, 1.05 eq.) was slowly added dropwise. The mixture was stirred at 0 °C for 1 h. After the starting material I-0 was basically eliminated by TLC, the mixture was raised to room temperature and stirred for 2 h until the reaction was complete. The reaction solution was quenched with saturated ammonium chloride solution, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then collected as a white solid I-1 (217 mg, 0.95 mmol) by filtration and concentration, with a yield of 95.0%.

[0111] (2) Preparation of 1-N-Boc-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-2)

[0112] 217 mg (0.95 mmol, 1.0 eq.) of 1-N-Boc-4,5-dihydroxymethylimidazolium (I-1) was added to 4.8 mL of anhydrous dichloromethane under nitrogen protection. After complete dissolution, the solution was incubated at 0 °C for 10 min. Then, 147 mg of N,N-diisopropylethylamine (1.14 mmol, 1.2 eq.) was added. After stirring until homogeneous, 1.5 mL of a dilute solution of tert-butyldiphenylchlorosilane in anhydrous dichloromethane (0.97 mmol, 1.02 eq.) was slowly added dropwise. The solution was stirred at 0 °C for 4 h, and the reaction was monitored by TLC until complete. The reaction solution was quenched with ice water, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then collected as a colorless oily crude product by filtration and concentration. The crude product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 1:4) to obtain colorless solid I-2 (401 mg, 0.86 mmol), with a yield of 90.5%.

[0113] (3) Preparation of 1-N-Boc-2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-3)

[0114] 401 mg (0.86 mmol, 1.0 eq.) of 1-N-Boc-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-2) was dissolved in 2.7 mL of anhydrous tetrahydrofuran under nitrogen protection. The solution was cooled to -78 °C, stirred until homogeneous, and kept at this temperature for 15 min. Then, 3.0 mL of anhydrous tetrahydrofuran dilute solution of hexamethyldisilamide potassium (0.94 mmol, 1.1 eq.) was slowly added dropwise, and the mixture was stirred at -78 °C for 1.5 h. Under this temperature-controlled condition, 2.8 mL of anhydrous tetrahydrofuran dilute solution of 1-bromo-7-(dimethylamino)heptane (0.90 mmol, 1.05 eq.) was slowly added dropwise, and the mixture was stirred for 2 h. The temperature was then gradually increased to -20 °C and stirred for 1 h. The reaction was monitored by TLC until complete. The reaction solution was quenched with saturated ammonium chloride solution at -20℃, and the organic phase was collected after being heated to room temperature. The organic phase was washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then collected as a yellow oily crude product by filtration and concentration. The crude product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 1:3) to obtain yellow solid I-3 (443 mg, 0.73 mmol), with a yield of 84.9%.

[0115] (4) Preparation of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-4)

[0116] 443 mg (0.73 mmol, 1.0 eq.) of 1-N-Boc-2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-3) was dissolved in 2.0 mL of anhydrous dichloromethane. Then, 1.6 mL of anhydrous trifluoroacetic acid (7.3 mmol, 10.0 eq.) was slowly added dropwise. The mixture was stirred at room temperature for 2 h. After the reaction was completed by TLC monitoring, the reaction solution was diluted with 5 mL of dichloromethane and then slowly neutralized with saturated sodium bicarbonate solution. The organic phases were combined and washed with saturated sodium chloride solution. After drying with anhydrous sodium sulfate, the mixture was filtered and concentrated to collect the solid crude product I-4 (360 mg, 0.71 mmol), with a yield of 97.3%.

[0117] (5) Preparation of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-[((R)-2,3-di(octadecanoyloxy)propoxy)methyl]-1H-imidazolium (I-5)

[0118] 360 mg (0.71 mmol, 1.0 eq.) of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-hydroxymethylimidazolium (I-4) was added to 3.0 mL of anhydrous dichloromethane under nitrogen protection and stirred at 0 °C for 10 min until fully dissolved. Then, 72 mg of triethylamine (0.71 mmol, 1.0 eq.) was added and stirred until homogeneous. Finally, 0.5 mL of a dilute solution of methanesulfonyl chloride in anhydrous dichloromethane (0.71 mmol, 1.0 eq.) was slowly added dropwise and stirred at 0 °C for 30 min. After the reaction was monitored by TLC until complete and no excess methanesulfonyl chloride or triethylamine remained, 3.5 mL of anhydrous dichloromethane solution of distearate (0.85 mmol, 1.2 eq.) was added directly, followed by 148 mg of dried triethylamine (1.07 mmol, 1.5 eq.). Potassium carbonate powder (eq.) was stirred until homogeneous, then heated to 45°C and stirred for 3–4 h. The reaction was monitored by TLC until complete. The reaction solution was quenched with ice water, ethyl acetate was added to collect the organic phase, and the mixture was washed with saturated sodium chloride solution. After drying with anhydrous sodium sulfate, the product was filtered and concentrated to collect a yellow oily crude product. This crude product was then purified by column chromatography (ethyl acetate: petroleum ether = 1:4) to obtain a yellow solid I-5 (635 mg, 0.57 mmol), with a yield of 80.3%.

[0119] (6) Preparation of 2-[7-(dimethylamino)heptyl]-4-hydroxymethyl-5-[((R)-2,3-di(octadecanoyloxy)propoxy)methyl]-1H-imidazolium (diaylate imidazolium-based biomimetic lipid compound dA5Z) 2 18, I-6)

[0120] 635 mg (0.57 mmol, 1.0 eq.) of 2-[7-(dimethylamino)heptyl]-4-[(tert-butyldiphenylsiloxy)methyl]-5-[((R)-2,3-di(octadecanoyloxy)propoxy)methyl]-1H-imidazolium (I-5) was added to 2.0 mL of anhydrous tetrahydrofuran under nitrogen protection and stirred at room temperature until fully dissolved. Then, 0.8 mL of a dilute solution of tetrabutylammonium fluoride in anhydrous tetrahydrofuran (0.68 mmol, 1.2 eq.) was slowly added dropwise, and the mixture was stirred for 2 h at room temperature. The reaction was monitored by TLC until complete. The reaction solution was quenched with deionized water, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then filtered and concentrated to collect a colorless oily crude product. The product was then separated and purified by column chromatography (ethyl acetate: petroleum ether = 2:1) to obtain a colorless solid I-6 (473 mg, 0.54 mmol), with a yield of 94.9%.

[0121] The prepared diacylimidazolium-based biomimetic lipid compound dA5Z 2Characterization was performed using 18 (I-6) high-resolution mass spectrometry (HRMS) [M+H]. + : C 53 H 102 N3O6 + Theoretical value of m / z: 876.7768, measured value: 876.7772.

[0122] The proton NMR results are as follows:

[0123] 1 H NMR (400 MHz, CDCl3) δ 6.50-7.00 (br s, 1H), 5.10-5.20 (m, 1H), 4.55 (d, J=5.5, 2H), 4.25-4.40 (dd, J=5.8, 11.9, 4H), 3.50-3.55 (t, J=6.5,2H), 2.55-2.60 (t, J=7.5, 2H), 2.28-2.35 (t, J=7.5, 6H), 2.22 (s, 6H), 2.10-2.50 (br s, 1H), 1.40-1.70 (m, 10H), 1.20-1.40 (br m, 60H), 0.86-0.90 (t, J=6.8, 6H).

[0124] The carbon spectrum results are as follows:

[0125] 13 C NMR (100 MHz, CDCl3) δ 173.8, 173.5, 145.7, 120.3, 70.5, 62.8,62.5, 59.0, 57.2, 45.2, 34.0, 31.9, 23.0-30.0 (m), 22.7, 14.1.

[0126] (7) Preparation of 2-[7-(dimethylammonium)heptyl]-4-[((5-(cholest-5-en-3β-oxy)pentanoyl)oxy)methyl]-5-[((R)-2,3-di(octadecanoyloxy)propoxy)methyl]-1H-imidazol-3-onium diiodide (dA5Z) 2 18C4-JI)

[0127] 473 mg (0.54 mmol, 1.0 eq.) 2-[7-(dimethylamino)heptyl]-4-hydroxymethyl-5-[((R)-2,3-di(octadecanoyloxy)propoxy)methyl]-1H-imidazolium (I-6) was added to 2.4 mL of anhydrous dichloromethane at 0 °C under nitrogen protection, followed by the addition of 69.8 mg N,N-diisopropylethylamine (0.54 mmol, 1.0 eq.), and stirred at 0 °C until fully dissolved. 277 mg of 5-(cholest-5-en-3β-oxy)valerate (0.57 mmol, 1.05 eq.) was mixed with 115 mg of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (0.60 mmol, 1.1 eq.) and 6.11 mg of 4-dimethylaminopyridine (0.05 mmol, 1.05 eq.). 0.1 eq. was dissolved in 3.0 mL of anhydrous dichloromethane under nitrogen protection. After stirring at room temperature for 30 min, a mixed dichloromethane solution of I-6 and N,N-diisopropylethylamine was slowly added dropwise at 0 °C and stirred for 1 h. The mixture was then slowly raised to room temperature and stirred for another 3 h. The reaction was monitored by TLC until complete. The reaction solution was quenched with saturated sodium bicarbonate solution, the organic phase was collected, washed with saturated sodium chloride solution, dried with anhydrous sodium sulfate, and then filtered and concentrated to collect a white solid crude product. This crude product was then purified by column chromatography (ethyl acetate: petroleum ether = 1:4) to obtain a high-purity white solid. After further vacuum drying for 2 h to remove the solvent, 4.0 mL of anhydrous ethyl acetate was added and stirred at room temperature in the dark until completely dissolved. Then, 0.3 mL of 33 wt% anhydrous HI acetic acid solution (9.09 mmol, 2.1 eq.) was slowly added dropwise in the dark, and the mixture was stirred at room temperature in the dark for another 2 h. The salt formation reaction was monitored by TLC until complete. The precipitated solid was collected and washed three times with ice-cold anhydrous ethyl acetate, then dried under vacuum in the dark at 45 °C for 5 h to obtain a white solid product dA5Z. 2 18C4-JI (656 mg, 0.41 mmol), yield 75.9%.

[0128] The prepared imidazole-based binary asymmetric biomimetic lipid compound dA5Z 2 Characterized by 18C4-JI (compound 1) using high-resolution mass spectrometry (HRMS) [M-2I]. 2+ : C 85 H 155 N3O8 + Theoretical value of m / z: 673.0907, measured value: 673.0917.

[0129] The proton NMR results are as follows:

[0130] 1H NMR (400 MHz, CDCl3) δ 8.0-9.0 (br s, 2H), 5.35 (br d, J=5.2, 1H), 5.10-5.20 (m, 1H), 4.25-4.40 (dd, J=5.8, 11.9, 4H), 4.00-4.20 (m, 4H), 3.50-3.55 (t, J=6.5, 2H), 3.40-3.45 (m, 1H), 2.95-3.00 (s, 6H), 2.85-2.90 (t, J=7.5, 2H), 2.28-2.35 (t, J=7.5, 6H), 2.00-2.05 (m, 2H), 1.20-1.70 (br m,103H), 1.01 (s, 3H), 0.86-0.92 (m, 15H), 0.68 (s, 3H).

[0131] The carbon spectrum results are as follows:

[0132] 13 C NMR (100 MHz, CDCl3) δ 173.8, 173.5, 146.2, 145.0, 140.8, 121.7,78.9, 70.5, 67.2, 66.8, 62.5, 56.8, 56.2, 50.1, 42.3, 34.0, 31.9, 23.0-30.0(m), 22.8, 22.7, 19.4, 18.7, 14.1, 11.8.

[0133] Example 2: Synthesis and characterization of imidazole-based binary asymmetric biomimetic lipid compounds 2-18

[0134] dA3Z was synthesized according to the method in Example 1. 2 15C2-JI, dA4Z 2 15C3-JI, dA4Z 2 15C4-JI, dA5Z 2 15C4-JCl, dA5Z 2 15C4-JI, dA4Z ij 2 15C3-JI, dA4Z ij 2 15C4-JI, dA5Z ij 2 15C4-JI, dA5Z ij 2 15C4-JCl, dA4Z15Z ij15C3-JI, dA4Z15Z ij 15C4-JI, dA5Z15Z ij 15C4-JI, dA4Z 2 18C4-JI, dA5Z ij 2 18C4-JI, dA4Z15Z ij 18C4-JI、dA5Z15Z ij 18C4-JCl, dA5Z18Z ij / lm 18C4-JI (imidazolyl binary asymmetric biomimetic lipid compound 2~18).

[0135] The above-mentioned compound synthesis method is similar to dA5Z 2 Similar to 18C4-JI (compound 1), the difference lies in that in step (3), 1-bromo-7-(dimethylamino)heptane can be replaced with 1-bromo-5-(dimethylamino)pentane or 1-bromo-6-(dimethylamino)hexane; in step (5), distearate can be replaced with 1,2-diacylglycerols with different chain lengths and saturations; in step (7), 5-(cholest-5-en-3β-oxy)valerate can be replaced with 3-(cholest-5-en-3β-oxy)propionic acid or 4-(cholest-5-en-3β-oxy)butyric acid, and hydroiodic acid can be replaced with hydrochloric acid. The reactants, reaction conditions, and yields used in steps (3), (5), and (7) for synthesizing the above imidazole binary asymmetric biomimetic lipid compounds are shown in Table 1. The reaction conditions for the remaining steps are the same as in Example 1.

[0136] Table 1

[0137]

[0138] Subsequently, the imidazole-based binary asymmetric biomimetic lipid compounds 2-18 synthesized in Table 1 were characterized, and the 1H NMR spectra are as follows:

[0139] dA3Z 2 15C2-JI (Compound 2):

[0140] 1¹H NMR (400 MHz, CDCl₃) δ 9.2-9.8 (br s, 3H), 5.35 (br d, J=5.2, 1H), 5.10-5.20 (m, 1H), 4.20-4.35 (m, 4H), 3.50-3.65 (m, 7H), 2.92 (s, 6H), 2.78 (t, J=7.5, 2H), 2.58 (t, J=6.5, 2H), 2.28-2.35 (t, J=7.5, 4H), 2.00-2.05 (m, 2H), 1.20-1.70 (br m, 80H), 1.01 (s, 3H), 0.86-0.90 (m, 15H), 0.68 (s, 3H).

[0141] dA4Z 2 15C3-JI (Compound 3):

[0142] 1 ¹H NMR (400 MHz, CDCl₃) δ 9.0-9.6 (br s, 3H), 5.35 (br d, J=5.2, 1H), 5.10-5.20 (m, 1H), 4.20-4.40 (m, 6H), 3.40-3.65 (m, 5H), 2.90 (s, 6H), 2.80 (t, J=7.5, 2H), 2.70 (t, J=7.5, 2H), 2.50 (t, J=7.0, 2H), 2.30 (t, J=7.5, 4H), 1.95-2.05 (m, 4H), 1.20-1.70 (br m, 82H), 1.01 (s, 3H), 0.86-0.90 (m, 15H), 0.68 (s, 3H).

[0143] dA4Z 2 15C4-JI (Compound 4):

[0144] 1¹H NMR (400 MHz, CDCl₃) δ 9.0-9.8 (br s, 3H), 5.35 (br d, J=5.2, 1H), 5.12-5.22 (m, 1H), 4.22-4.35 (m, 4H), 3.45-3.60 (m, 7H), 2.88 (s, 6H), 2.82 (t, J=7.5, 2H), 2.75 (t, J=7.5, 2H), 2.52 (t, J=7.0, 2H), 2.32 (t, J=7.5, 4H), 1.90-2.00 (m, 4H), 1.22-1.75 (br m, 84H), 1.05 (s, 3H), 0.85-0.89 (m, 15H), 0.68 (s, 3H).

[0145] dA5Z 2 15C4-JCl (compound 5):

[0146] 1 ¹H NMR (400 MHz, CDCl₃) δ 9.2-9.8 (br s, 3H), 5.30 (br d, J=5.2, 1H), 5.12-5.25 (m, 1H), 4.20-4.45 (m, 4H), 3.40-3.65 (m, 7H), 2.90 (s, 6H), 2.82 (t, J=7.5, 2H), 2.72 (t, J=7.5, 2H), 2.55 (t, J=7.0, 2H), 2.35 (t, J=7.5, 4H), 1.95-2.05 (m, 4H), 1.20-1.75 (br m, 86H), 1.00 (s, 3H), 0.86-0.90 (m, 15H), 0.68 (s, 3H).

[0147] dA5Z 2 15C4-JI (compound 6):

[0148] 1¹H NMR (400 MHz, CDCl₃) δ 9.0-9.6 (br s, 3H), 5.32 (br d, J=5.2, 1H), 5.15-5.20 (m, 1H), 4.20-4.40 (m, 4H), 3.42-3.63 (m, 7H), 2.89 (s, 6H), 2.81 (t, J=7.5, 2H), 2.73 (t, J=7.5, 2H), 2.50 (t, J=7.0, 2H), 2.33 (t, J=7.5, 4H), 1.95-2.07 (m, 4H), 1.22-1.71 (br m, 86H), 1.02 (s, 3H), 0.80-0.90 (m, 15H), 0.70 (s, 3H).

[0149] dA4Z ij 2 15C3-JI (Compound 7):

[0150] 1 ¹H NMR (400 MHz, CDCl₃) δ 9.0-9.8 (br s, 3H), 5.32-5.41 (m, 5H), 5.12-5.25 (m, 1H), 4.21-4.45 (m, 4H), 3.42-3.66 (m, 7H), 2.91 (s, 6H), 2.85 (t, J=7.5, 2H), 2.70 (t, J=7.5, 2H), 2.53 (t, J=7.0, 2H), 2.32 (t, J=7.5, 4H), 1.90-2.06 (m, 12H), 1.21-1.72 (br m, 66H), 1.05 (s, 3H), 0.85-0.90 (m, 15H), 0.72 (s, 3H).

[0151] dA4Z ij 2 15C4-JI (Compound 8):

[0152] 1H NMR (400 MHz, CDCl3) δ 9.2-9.8 (br s, 3H), 5.30-5.45 (m, 5H), 5.10-5.22 (m, 1H), 4.20-4.33 (m, 4H), 3.40-3.60 (m, 7H), 2.89 (s, 6H), 2.84 (t, J=7.5, 2H), 2.77 (t, J=7.5, 2H), 2.51 (t, J=7.0, 2H), 2.30 (t, J=7.5, 4H),1.95-2.05 (m, 12H), 1.25-1.75 (br m, 68H), 1.01 (s, 3H), 0.86-0.90 (m, 15H), 0.66 (s, 3H).

[0153] dA5Z ij 2 15C4-JI (Compound 9):

[0154] 1 H NMR (400 MHz, CDCl3) δ 9.0-9.8 (br s, 3H), 5.32-5.40 (m, 5H), 5.12-5.25 (m, 1H), 4.20-4.45 (m, 4H), 3.40-3.65 (m, 7H), 2.90 (s, 6H), 2.80 (t, J=7.5, 2H), 2.72 (t, J=7.5, 2H), 2.55 (t, J=7.0, 2H), 2.32 (t, J=7.5, 4H),1.95-2.05 (m, 12H), 1.23-1.72 (br m, 70H), 1.01 (s, 3H), 0.86-0.90 (m, 15H), 0.68 (s, 3H).

[0155] dA5Z ij 2 15C4-JCl (Compound 10):

[0156] 1H NMR (400 MHz, CDCl3) δ 9.0-9.8 (br s, 3H), 5.30-5.40 (m, 5H), 5.10-5.20 (m, 1H), 4.20-4.40 (m, 4H), 3.45-3.65 (m, 7H), 2.89 (s, 6H), 2.85 (t, J=7.5, 2H), 2.70 (t, J=7.5, 2H), 2.52 (t, J=7.0, 2H), 2.35 (t, J=7.5, 4H),1.95-2.05 (m, 12H), 1.22-1.75 (br m, 70H), 1.00 (s, 3H), 0.85-0.90 (m, 15H), 0.72 (s, 3H).

[0157] dA4Z15Z ij 15C3-JI (Compound 11):

[0158] 1 H NMR (400 MHz, CDCl3) δ 9.2-9.8 (br s, 3H), 5.35-5.45 (m, 3H), 5.12-5.25 (m, 1H), 4.20-4.45 (m, 4H), 3.42-3.60 (m, 7H), 2.88 (s, 6H), 2.80 (t, J=7.5, 2H), 2.72 (t, J=7.5, 2H), 2.55 (t, J=7.0, 2H), 2.28 (t, J=7.5, 4H), 1.90-2.00 (m, 8H), 1.21-1.70 (br m, 74H), 1.01 (s, 3H), 0.85-0.90 (m, 15H), 0.70 (s, 3H).

[0159] dA4Z15Z ij 15C4-JI (Compound 12):

[0160] 1H NMR (400 MHz, CDCl3) δ 9.2-9.6 (br s, 3H), 5.30-5.40 (m, 3H), 5.12-5.22 (m, 1H), 4.24-4.45 (m, 4H), 3.40-3.65 (m, 7H), 2.90 (s, 6H), 2.82 (t, J=7.5, 2H), 2.71 (t, J=7.5, 2H), 2.50 (t, J=7.0, 2H), 2.30 (t, J=7.5, 4H), 1.95-2.05 (m, 8H), 1.20-1.75 (br m, 76H), 1.01 (s, 3H), 0.86-0.90 (m, 15H), 0.68 (s, 3H).

[0161] dA5Z15Z ij 15C4-JI (Compound 13):

[0162] 1 H NMR (400 MHz, CDCl3) δ 9.0-9.8 (br s, 3H), 5.32-5.48 (m, 3H), 5.10-5.20 (m, 1H), 4.22-4.40 (m, 4H), 3.43-3.65 (m, 7H), 2.91 (s, 6H), 2.85 (t, J=7.5, 2H), 2.75 (t, J=7.5, 2H), 2.52 (t, J=7.0, 2H), 2.33 (t, J=7.5, 4H), 1.90-2.00 (m, 8H), 1.22-1.71 (br m, 78H), 1.00 (s, 3H), 0.85-0.90 (m, 15H), 0.72 (s, 3H).

[0163] dA4Z 2 18C4-JI (Compound 14):

[0164] 11H NMR (400 MHz, CDCl3) δ 9.0-9.8 (br s, 3H), 5.35 (br d, J=5.2, 1H), 5.10-5.25 (m, 1H), 4.20-4.45 (m, 4H), 3.42-3.63 (m, 7H), 2.91 (s, 6H), 2.84 (t, J=7.5, 2H), 2.71 (t, J=7.5, 2H), 2.53 (t, J=7.0, 2H), 2.33 (t, J=7.5, 4H), 1.90-2.00 (m, 4H), 1.20-1.75 (br m, 96H), 1.02 (s, 3H), 0.86-0.90 (m, 15H), 0.68 (s, 3H).

[0165] dA5Z ij 2 18C4-JI (Compound 15):

[0166] 1 1H NMR (400 MHz, CDCl3) δ 9.2-9.8 (br s, 3H), 5.32-5.45 (m, 5H), 5.10-5.22 (m, 1H), 4.22-4.48 (m, 4H), 3.41-3.66 (m, 7H), 2.92 (s, 6H), 2.85 (t, J=7.5, 2H), 2.72 (t, J=7.5, 2H), 2.51 (t, J=7.0, 2H), 2.32 (t, J=7.5, 4H), 1.95-2.05 (m, 12H), 1.20-1.75 (br m, 82H), 1.01 (s, 3H), 0.86-0.90 (m, 15H), 0.71 (s, 3H).

[0167] dA4Z15Z ij 18C4-JI (Compound 16):

[0168] 1H NMR (400 MHz, CDCl3) δ 9.2-9.6 (br s, 3H), 5.32-5.45 (m, 3H), 5.15-5.25 (m, 1H), 4.21-4.45 (m, 4H), 3.40-3.65 (m, 7H), 2.88 (s, 6H), 2.78 (t, J=7.5, 2H), 2.71 (t, J=7.5, 2H), 2.50 (t, J=7.0, 2H), 2.30 (t, J=7.5, 4H),1.95-2.05 (m, 8H), 1.21-1.70 (br m, 82H), 1.05 (s, 3H), 0.85-0.90 (m, 15H), 0.68 (s, 3H).

[0169] dA5Z15Z ij 18C4-JCl (Compound 17):

[0170] 1 H NMR (400 MHz, CDCl3) δ 9.0-9.8 (br s, 3H), 5.32-5.40 (m, 3H), 5.10-5.25 (m, 1H), 4.20-4.40 (m, 4H), 3.45-3.60 (m, 7H), 2.91 (s, 6H), 2.85 (t, J=7.5, 2H), 2.73 (t, J=7.5, 2H), 2.52 (t, J=7.0, 2H), 2.33 (t, J=7.5, 4H),1.90-2.00 (m, 8H), 1.20-1.71 (br m, 84H), 1.02 (s, 3H), 0.86-0.90 (m, 15H), 0.70 (s, 3H).

[0171] dA5Z18Z ij / lm 18C4-JI (Compound 18):

[0172] 1H NMR (400 MHz, CDCl3) δ 9.2-9.8 (br s, 3H), 5.35-5.40 (m, 5H), 5.12-5.22 (m, 1H), 4.22-4.45 (m, 4H), 3.42-3.65 (m, 7H), 2.91 (s, 6H), 2.82 (t, J=7.5, 2H), 2.71 (t, J=7.5, 2H), 2.50 (t, J=7.0, 2H), 2.32 (t, J=7.5, 4H),1.90-2.01 (m, 12H), 1.22-1.72 (br m, 86H), 1.01 (s, 3H), 0.85-0.95 (m, 15H), 0.68 (s, 3H).

[0173] Example 3: Preparation of LNPs based on imidazole binary asymmetric biomimetic lipid compounds

[0174] Lipid nanoparticles (LNPs) were prepared by mixing the imidazole-based binary asymmetric biomimetic lipid compounds 1-18 synthesized in Examples 1 and 2 with their respective diacylimidazole-based biomimetic lipid compounds.

[0175] First, the dA5Z prepared in Example 1 was subjected to thin-film hydration. 2 18C4-JI (compound 1) and the corresponding diacylimidazolium-based biomimetic lipid compound dA5Z 2 18 were mixed to prepare LNPs-1.

[0176] dA5Z 2 18C4-JI and dA5Z 2 18 μL of the mixture was dissolved in a 1:0.6 molar ratio in a MeOH / CHCl3 (1:1, v / v) mixed solvent. After removing the organic solvent by nitrogen blowing or rotary evaporation at 50°C, a semi-transparent mixed lipid film was formed on the inner wall of the container. Then, an equal volume of PBS buffer was added to the container, and the mixture was incubated at 50°C for 5 min, followed by vortexing for 1–3 min to fully hydrate the lipid film. This hydration process was repeated 5 times to obtain a turbid mixed lipid colloidal solution. After sonication for 30 min, the colloidal solution was repeatedly extruded through a 100 nm pore size PC filter membrane 30–40 times to obtain a dA5Z-based solution. 2 18C4-JI and dA5Z 2 18 lipid nanoparticles (LNPs-1) delivery system.

[0177] Secondly, following the method described above, LNPs were prepared using the imidazole-based binary asymmetric biomimetic lipid compounds (compounds 2-18) and their corresponding diacylimidazole-based biomimetic lipid compounds listed in Table 1 as raw materials. dA5Z 2 18C4-JI and dA5Z 2 18 was replaced with compounds 2~18 in Table 1 and the corresponding diacylimidazole biomimetic lipid compounds, respectively, and other conditions remained unchanged to prepare LNPs-2~LNPs-18.

[0178] Comparative Example 1:

[0179] The imidazole-based binary asymmetric biomimetic lipid compound dA5Z from Example 3 was used. 2 18C4-JI was replaced with cationic lipid compounds ALC-0315 (CAS:2036272-55-4), D-Lin-MC3-DMA (CAS:1224606-06-7), and SM-102 (CAS:2089251-47-6) for drug delivery, respectively, and dA5Z, a diacylimidazole biomimetic lipid compound. 2 18 was replaced with distearylphosphatidylcholine (DSPC, CAS: 816-94-4) with the same lipid chain length, and other conditions remained unchanged to obtain LNPs of Control Examples 1-3.

[0180] Example 4: Physicochemical and cytotoxic characterization of LNPs

[0181] The physicochemical properties and cytotoxicity of LNPs-1 to LNPs-18 prepared in Example 3 and LNPs of Control Examples 1 to 3 prepared in Comparative Example 1 were characterized.

[0182] (1) Physicochemical properties

[0183] The morphology of the prepared LNPs-1 to LNPs-18 and the LNPs of control examples 1 to 3 was characterized by transmission electron microscopy (TEM). Figure 2 The image shows a morphological comparison of LNPs-1 and three control examples. All LNPs in each group exhibited a relatively complete globular vesicle structure with no significant changes. The structures of LNPs-2 to LNPs-18 are similar to those of LNPs-1, also possessing a complete globular vesicle structure.

[0184] In addition, the average particle size and zeta potential of LNPs-1 to LNPs-18 and control examples 1 to 3 were characterized by nanoflow cytometry (NanoFCM) and zeta potential analyzer (ZetaPALS), respectively. The characterization results are shown in Table 2.

[0185] Table 2

[0186]

[0187] As shown in Table 2, the average particle size of LNPs-1 to LNPs-18 ranges from 134.2 to 142.5 nm, and the median zeta potential ranges from 32.4 to 39.2 mV. In contrast, the average particle sizes of LNPs in Control Examples 1 to 3 are 190.7 nm, 181.4 nm, and 185.5 nm, respectively, and the median zeta potentials are 15.4 mV, 14.2 mV, and 17.6 mV, respectively. Compared with LNPs based on imidazole binary asymmetric biomimetic lipid compounds, the control examples have larger average particle sizes and lower median zeta potentials.

[0188] (2) Cytotoxicity

[0189] The cytotoxicity of LNPs-1 to LNPs-18 and controls 1 to 3 in human glioma cells U-118MG was further evaluated using the MTT assay. U-118MG cells were cultured in DMEM medium containing 10% fetal bovine serum and seeded at a density of 3000 cells / well in 96-well plates, incubated for 24 h at 5% CO2 and 37°C. Then, different concentrations of various LNPs were added to each well, with a final concentration of 1 × 10⁻⁶. 7 LNPs / mL, 5×10 7 LNPs / mL, 1×10 8 LNPs / mL, 5×10 8 LNPs / mL, 1×10 9 LNPs / mL, 2×10 9 LNPs / mL and 5×10 9 LNPs were added at a concentration of 1 / mL, and incubation continued for 24 h. Afterward, 5 mg / mL MTT reagent was added to each well, and incubation continued for 4 h. The culture medium was then discarded, and 150 μL of DMSO was added to each well. After shaking for 10 min, the absorbance of each well was measured at 570 nm using a microplate reader. U-118MG cells without added LNPs were used as a negative control, and cell viability was calculated. If cell viability was greater than 80%, this type of LNP was considered non-cytotoxic.

[0190] The test results are shown in Table 2. No significant cytotoxicity was observed in LNPs-1 to LNPs-18 and in Control Examples 1 to 3.

[0191] Example 5: Preparation of drug-loaded LNPs based on imidazole-based binary asymmetric biomimetic lipid compounds and lipid excipients for loading small molecule drugs

[0192] The imidazole-based binary asymmetric biomimetic lipid compounds 1-18 synthesized in Examples 1 and 2 were mixed with lipid excipients to load small molecule chemical drugs, forming drug-loaded LNPs.

[0193] First, the dA5Z prepared in Example 1 was subjected to thin-film hydration. 2 18C4-JI (compound 1) was mixed with lipid excipients (phospholipid DSPC and cholesterol) to prepare drug-loaded LNPs loaded with the antitumor small molecule drug paclitaxel (PTX, CAS:33069-62-4).

[0194] dA5Z 2 18C4-JI, DSPC, cholesterol (Chol.), and PTX were dissolved in a mixed solvent of MeOH / CHCl3 (1:1, v / v) at a molar ratio of 8:8:2:1. After removing the organic solvent by nitrogen blowing or rotary evaporation at 50°C, a translucent mixed lipid film was formed on the inner wall of the container. Then, an equal volume of PBS buffer was added to the container, and the mixture was incubated at 50°C for 5 min, followed by vortexing for 1–3 min to fully hydrate the lipid film. This hydration process was repeated 5 times to obtain a turbid mixed lipid colloidal solution. After sonication for 30 min, the colloidal solution was repeatedly extruded through a 100 nm pore size PC filter membrane 30–40 times and purified by column chromatography to obtain the dA5Z-based product. 2 18C4-JI and lipid excipient loading of PTX LNPs: PTX@dA5Z 2 18C4-JI / DSPC / Chol. (PTX@LNPs-1').

[0195] Secondly, dA5Z is processed using the method described above. 2 18C4-JI is replaced with compounds 2 to 18 in Table 1. As shown in Table 3, DSPC is replaced with phosphatidylcholine with the same or similar lipid chain structure as the diacylimidazolium-based biomimetic lipid compounds corresponding to compounds 2 to 18. With other conditions unchanged, PTX-loaded LNPs can be obtained: PTX@LNPs-2' to PTX@LNPs-18'.

[0196] Table 3

[0197]

[0198] Example 6: Preparation of drug-loaded LNPs based on imidazole-based binary asymmetric biomimetic lipid compounds and their corresponding diacylimidazole-based biomimetic lipid compounds for loading small molecule drugs

[0199] The imidazole-based binary asymmetric biomimetic lipid compounds 1-18 synthesized in Examples 1 and 2 were used to completely replace the lipid excipients (phospholipids and cholesterol) in Example 5, and were used to load small molecule chemical drugs to form drug-loaded LNPs.

[0200] First, the dA5Z prepared in Example 1 was subjected to thin-film hydration. 2 18C4-JI (compound 1) and the corresponding diacylimidazolium-based biomimetic lipid compound dA5Z 2 18. Mixing and preparing to form drug-loaded LNPs loaded with PTX.

[0201] dA5Z 2 18C4-JI, dA5Z 2 18 and PTX were dissolved in a mixed solvent of MeOH / CHCl3 (1:1, v / v) at a molar ratio of 8:4.8:1. After removing the organic solvent by nitrogen blowing or rotary evaporation at 50°C, a semi-transparent mixed lipid film was formed on the inner wall of the container. Then, an equal volume of PBS buffer was added to the container, and the mixture was incubated at 50°C for 5 min, followed by vortexing for 1–3 min to fully hydrate the lipid film. This hydration process was repeated 5 times to obtain a turbid mixed lipid colloidal solution. After sonication for 30 min, the colloidal solution was repeatedly extruded through a 100 nm pore size PC filter membrane 30–40 times, and purified by column chromatography to obtain the dA5Z-based product. 2 18C4-JI and dA5Z 2 18 LNPs for loading PTX: PTX@dA5Z 2 18C4-JI / dA5Z 2 18 (PTX@LNPs-1).

[0202] Secondly, dA5Z is processed using the method described above. 2 18C4-JI and dA5Z 2 Replace 18 with compounds 2~18 in Table 1 and the corresponding diacylimidazolium-based biomimetic lipid compounds, respectively, and keep other conditions unchanged to obtain PTX-loaded LNPs: PTX@LNPs-2~PTX@LNPs-18.

[0203] Example 7: Encapsulation efficiency characterization of LNPs delivery system loaded with small molecule drugs

[0204] 1% Triton X-100 was added to each group of drug-loaded LNPs in Examples 5 and 6, and the mixture was incubated in PBS buffer at 25°C for 15 min to release the PTX encapsulated in the drug-loaded LNPs. The PTX content encapsulated in PTX@LNPs-1'~PTX@LNPs-18' and PTX@LNPs-1~PTX@LNPs-18 was determined by HPLC, and the encapsulation efficiency of PTX in each group of drug-loaded LNPs was calculated. The results are shown in Table 4.

[0205] Table 4

[0206]

[0207] Table 4 shows that the encapsulation efficiency of PTX in PTX@LNPs-1' to PTX@LNPs-18' ranges from 72.5% to 80.9%, while that in PTX@LNPs-1 to PTX@LNPs-18 ranges from 76.4% to 91.9%. This indicates that replacing the lipid excipient with a diacylimidazole-based biomimetic lipid compound increases the overall encapsulation efficiency of PTX in drug-loaded LNPs. Furthermore, for each drug-loaded LNP, it was found that replacing the lipid excipient with a diacylimidazole-based biomimetic lipid compound increased the encapsulation efficiency of PTX, with the largest increase observed in PTX@LNPs-1 (13.6%).

[0208] Therefore, drug-loaded LNPs based on imidazole-based binary asymmetric biomimetic lipid compounds 1-18 that load PTX were selected if and only if the diacylimidazole-based biomimetic lipid compound dA5Z 2 The 18-component replacement of lipid excipients resulted in the most significant increase in PTX encapsulation efficiency, achieving the highest encapsulation efficiency (91.9%) for PTX.

[0209] Comparative Example 2 and its Encapsulation Efficiency Characterization

[0210] The imidazole-based binary asymmetric biomimetic lipid compound dA5Z from Example 5 was used. 2 18C4-JI was replaced with cationic lipid compounds ALC-0315, D-Lin-MC3-DMA, and SM-102, respectively, while other conditions remained unchanged, to obtain the drug-loaded LNPs loaded with PTX in Control Examples 4-6: PTX@ALC-0315 / DSPC / Chol., PTX@D-Lin-MC3-DMA / DSPC / Chol., and PTX@SM-102 / DSPC / Chol.

[0211] Following the method described in Example 7, the encapsulation efficiency of PTX in the drug-loaded LNPs of Comparative Examples 4-6 was characterized (Table 4). As shown in Table 4, the encapsulation efficiencies of PTX in PTX@ALC-0315 / DSPC / Chol., PTX@D-Lin-MC3-DMA / DSPC / Chol., and PTX@SM-102 / DSPC / Chol. were 32.7%, 25.4%, and 30.2%, respectively, significantly lower than the encapsulation efficiencies of PTX in PTX@LNPs-1' to PTX@LNPs-18' in Table 4.

[0212] Comparative Example 3 and its Encapsulation Efficiency Characterization

[0213] The imidazole-based binary asymmetric biomimetic lipid compound dA5Z from Example 6 was used. 2 18C4-JI was replaced with cationic lipid compounds ALC-0315, D-Lin-MC3-DMA, and SM-102, respectively, and with diacylimidazolium-based biomimetic lipid compound dA5Z. 2 All 18 were replaced with DSPCs with the same lipid chain length, and other conditions remained unchanged, to obtain the drug-loaded LNPs loaded with PTX in Control Examples 7-9: PTX@ALC-0315 / DSPC, PTX@D-Lin-MC3-DMA / DSPC and PTX@SM-102 / DSPC.

[0214] Following the method described in Example 7, the encapsulation efficiency of PTX in the drug-loaded LNPs of Control Examples 7-9 was characterized (Table 4). Table 4 shows that the encapsulation efficiencies of PTX@ALC-0315 / DSPC, PTX@D-Lin-MC3-DMA / DSPC, and PTX@SM-102 / DSPC for PTX were 8.4%, 17.2%, and 12.0%, respectively, significantly lower than the encapsulation efficiencies of PTX in PTX@LNPs-1 to PTX@LNPs-18 in Table 4, and also lower than the encapsulation efficiencies of PTX in Control Examples 4-6. This demonstrates that for the cationic lipid compounds ALC-0315, D-Lin-MC3-DMA, and SM-102, reducing the content of DSPC and Chol. in the PTX-loaded LNPs composed of these compounds and lipid excipients (DSPC and Chol.) leads to a decrease in the PTX encapsulation efficiency.

[0215] Example 8: Preparation of drug-loaded LNPs based on imidazole binary asymmetric biomimetic lipid compounds and lipid excipients loaded with small nucleic acid drugs

[0216] The imidazole-based binary asymmetric biomimetic lipid compounds 1-18 synthesized in Examples 1 and 2 were mixed with lipid excipients to load small nucleic acid drugs, forming drug-loaded LNPs.

[0217] First, the dA5Z prepared in Example 1 was processed using a microfluidic method. 2 18C4-JI (compound 1) was mixed with lipid excipients (phospholipid DSPC and cholesterol) to prepare drug-loaded LNPs that loaded antisense oligonucleotides (ASO, sequence UUUAUCUUCAAAUAACUUGGAGGCG (SEQ ID No. 1)) targeting the LRRK2 gene of Parkinson's disease.

[0218] dA5Z 2 18C4-JI, DSPC, and Chol were simultaneously dissolved in anhydrous ethanol at a molar ratio of 6:6:1 to prepare an organic phase mixture. Cy7 was selected to label the 5' end of the above ASO, i.e., Cy7-ASO. Cy7-ASO was dissolved in citrate buffer (10 mM, pH 4.0) at an N / P ratio of 5 to prepare an aqueous phase solution. At room temperature, the organic phase mixture and the aqueous phase solution were rapidly mixed using an automated high-throughput microfluidic system at a flow rate ratio of 1:4 and a volume ratio of 1:3, passing through a microfluidic chip at a mixing rate between 10 and 15 mL / min to prepare drug-loaded lipid nanoparticles. The mixture was then diluted 1:5 with water for injection to obtain a crude solution. The crude solution was ultrafiltered using a Millipore ultrafiltration tube to obtain a concentrate. Finally, the concentrate was filtered and sterilized using a 0.22 μm pore size aqueous filter membrane to obtain the dA5Z-based drug-loaded lipid nanoparticles. 2 18C4-JI and lipid excipient-loaded ASO LNPs: Cy7-ASO@dA5Z 2 18C4-JI / DSPC / Chol. (Cy7-ASO@LNPs-1').

[0219] Secondly, dA5Z is processed using the method described above. 2 18C4-JI is replaced with compounds 2 to 18 in Table 1. As shown in Table 3, DSPC is replaced with phosphatidylcholine with the same or similar lipid chain structure as the diacylimidazolium-based biomimetic lipid compounds corresponding to compounds 2 to 18. With other conditions unchanged, LNPs loaded with ASO can be obtained: Cy7-ASO@LNPs-2' to Cy7-ASO@LNPs-18'.

[0220] Example 9: Preparation of drug-loaded LNPs based on imidazole-based binary asymmetric biomimetic lipid compounds and their corresponding diacylimidazole-based biomimetic lipid compounds loaded with small nucleic acid drugs

[0221] The imidazole-based binary asymmetric biomimetic lipid compounds 1-18 synthesized in Examples 1 and 2 were used to completely replace the lipid excipients (phospholipids and cholesterol) in Example 8, and were used to load small nucleic acid drugs to form drug-loaded LNPs.

[0222] First, the dA5Z prepared in Example 1 was processed using a microfluidic method. 2 18C4-JI (compound 1) and the corresponding diacylimidazolium-based biomimetic lipid compound dA5Z 2 18. Mixed preparation to form drug-loaded LNPs loaded with ASO (sequence SEQ ID No. 1) targeting the LRRK2 gene of Parkinson's disease.

[0223] dA5Z 2 18C4-JI and dA5Z 2 18 molars were simultaneously dissolved in anhydrous ethanol at a molar ratio of 7:5 to prepare an organic phase mixture. Cy7 was selected to label the 5' end of the above ASO, i.e., Cy7-ASO. Cy7-ASO was dissolved in citrate buffer (10 mM, pH 4.0) at an N / P ratio of 5 to prepare an aqueous phase solution. At room temperature, the organic phase mixture and the aqueous phase solution were rapidly mixed using an automated high-throughput microfluidic system at a flow rate ratio of 1:4 and a volume ratio of 1:3, passing through a microfluidic chip at a mixing rate between 10 and 15 mL / min to prepare drug-loaded lipid nanoparticles. The mixture was then diluted 1:5 with water for injection to obtain a crude solution. The crude solution was ultrafiltered using a Millipore ultrafiltration tube to obtain a concentrate. Finally, the concentrate was filtered and sterilized using a 0.22 μm pore size aqueous filter membrane to obtain the dA5Z-based drug-loaded lipid nanoparticles. 2 18C4-JI and dA5Z 2 18 LNPs with ASO loaded: Cy7-ASO@dA5Z 2 18C4-JI / dA5Z 2 18 (Cy7-ASO@LNPs-1).

[0224] Secondly, dA5Z is processed using the method described above. 2 18C4-JI and dA5Z 2 Replace 18 with compounds 2~18 in Table 1 and the corresponding diacylimidazole biomimetic lipid compounds, respectively, and keep other conditions unchanged to obtain ASO-loaded LNPs: Cy7-ASO@LNPs-2~Cy7-ASO@LNPs-18.

[0225] Example 10: Encapsulation efficiency characterization of LNPs delivery system loaded with small nucleic acid drugs

[0226] The Cy7-ASO content encapsulated in Cy7-ASO@LNPs-1'~Cy7-ASO@LNPs-18' and Cy7-ASO@LNPs-1~Cy7-ASO@LNPs-18 was calculated by fluorescence spectrophotometry, and the encapsulation efficiency of ASO by each group of drug-loaded LNPs in Examples 8 and 9 was estimated. The results are shown in Table 5.

[0227] Table 5

[0228]

[0229] Table 5 shows that the encapsulation efficiency of ASO in Cy7-ASO@LNPs-1' to Cy7-ASO@LNPs-18' ranges from 68.2% to 85.9%, while the encapsulation efficiency in Cy7-ASO@LNPs-1 to Cy7-ASO@LNPs-18 ranges from 71.8% to 98.1%. This indicates that replacing the lipid excipient with a diacylimidazole-based biomimetic lipid compound increases the overall encapsulation efficiency of ASO in drug-loaded LNPs. Furthermore, for each drug-loaded LNP, it was found that the encapsulation efficiency of ASO increased after replacing the lipid excipient with a diacylimidazole-based biomimetic lipid compound, with the largest increase observed in Cy7-ASO@LNPs-1 (14.7%).

[0230] Therefore, drug-loaded LNPs based on imidazole-based binary asymmetric biomimetic lipid compounds 1–18 loaded with Cy7-ASO were screened for if and only if the diacylimidazole-based biomimetic lipid compound dA5Z 2 The 18-component alternative to lipid excipients resulted in the most significant increase in ASO encapsulation efficiency, achieving the highest ASO encapsulation efficiency (98.1%).

[0231] Comparative Example 4 and its Encapsulation Efficiency Characterization

[0232] The imidazole-based binary asymmetric biomimetic lipid compound dA5Z from Example 8 was used. 2 18C4-JI was replaced with cationic lipid compounds ALC-0315, D-Lin-MC3-DMA, and SM-102, respectively, while other conditions remained unchanged, to obtain the drug-loaded LNPs loaded with Cy7-ASO as in Control Examples 10-12: Cy7-ASO@ALC-0315 / DSPC / Chol., Cy7-ASO@D-Lin-MC3-DMA / DSPC / Chol., and Cy7-ASO@SM-102 / DSPC / Chol.

[0233] Following the method described in Example 10, the encapsulation efficiency of ASO by the drug-loaded LNPs loaded with Cy7-ASO in Comparative Examples 10-12 was characterized (Table 5). As shown in Table 5, the encapsulation efficiencies of Cy7-ASO@ALC-0315 / DSPC / Chol., Cy7-ASO@D-Lin-MC3-DMA / DSPC / Chol., and Cy7-ASO@SM-102 / DSPC / Chol. for ASO were 60.9%, 78.0%, and 66.4%, respectively, significantly lower than the encapsulation efficiencies of Cy7-ASO@LNPs-1' to Cy7-ASO@LNPs-18' in Table 5.

[0234] Comparative Example 5 and its Encapsulation Efficiency Characterization

[0235] The imidazole-based binary asymmetric biomimetic lipid compound dA5Z from Example 9 was used. 2 18C4-JI was replaced with cationic lipid compounds ALC-0315, D-Lin-MC3-DMA, and SM-102, respectively, and with diacylimidazolium-based biomimetic lipid compound dA5Z. 2 All 18 were replaced with DSPCs having the same lipid chain length, and other conditions remained unchanged, to obtain the drug-loaded LNPs loaded with Cy7-ASO as in Control Examples 13-15: Cy7-ASO@ALC-0315 / DSPC, Cy7-ASO@D-Lin-MC3-DMA / DSPC and Cy7-ASO@SM-102 / DSPC.

[0236] Following the method described in Example 10, the encapsulation efficiency of ASO by the drug-loaded LNPs loaded with Cy7-ASO in Comparative Examples 13-15 was characterized (Table 5). As shown in Table 5, the encapsulation efficiencies of Cy7-ASO@ALC-0315 / DSPC, Cy7-ASO@D-Lin-MC3-DMA / DSPC, and Cy7-ASO@SM-102 / DSPC for ASO were 41.4%, 22.8%, and 26.7%, respectively. These efficiencies were significantly lower than those of Cy7-ASO@LNPs-1 to Cy7-ASO@LNPs-18 in Table 5, and also lower than those of Comparative Examples 10-12. This demonstrates that for cationic lipid compounds ALC-0315, D-Lin-MC3-DMA, and SM-102, reducing the content of DSPC and Chol. in LNPs loaded with Cy7-ASO, which consist of these compounds and lipid excipients (DSPC and Chol.), leads to a decrease in ASO encapsulation efficiency.

[0237] Example 11: Membrane physiological properties and biocompatibility of imidazole-based binary asymmetric biomimetic lipid compounds

[0238] Based on the results of Examples 5-7 and Examples 8-10, the imidazole-based binary asymmetric biomimetic lipid compound dA5Z was used... 2 18C4-JI and its corresponding diacylimidazolium-based biomimetic lipid compound dA5Z 2 18 (or lipid excipients DSPC and Chol.) were mixed in a certain proportion to construct monolayer and lipid bilayer models, respectively. dA5Z was characterized using film balance and differential scanning calorimetry (DSC), respectively. 2 Membrane physiological properties and biocompatibility of 18C4-JI.

[0239] (1) Langmuir monolayer lipid membrane model

[0240] dA5Z 2 18C4-JI, dA5Z 2 18. DSPC and Chlorine were dissolved separately in a mixed solvent of MeOH / CHCl3 (1:1, v / v) to prepare stock solutions with a concentration of 1.0 mM, and stored at -20 °C for later use. dA5Z was then prepared according to the molar ratio of 4:4:1 in Example 5. 2 Three mother liquors, 18C4-JI, DSPC, and Chol, were mixed to prepare a 1.0 mM mixed solution A'. 72 mL of ultrapure water (pH 7.0) was injected as the film-forming subphase into the water bath of an analytical-grade Wilhelmy membrane balance (Riegler and Kirstein, Germany). Then, 15 μL of the mixed solution A' was evenly spread onto the surface of the film-forming subphase using a syringe. After standing at room temperature for 10 min to allow the organic solvent to completely evaporate, a dA5Z structure formed on the surface of the film-forming subphase. 2 A monolayer lipid membrane model composed of 18C4-JI, DSPC, and Chol. was constructed. The mobile barrier was positioned at 3.6 cm... 2 The monolayer lipid membrane was uniformly extruded at a rate of / min, and the surface pressure (π) - membrane area (S) isotherm was recorded simultaneously. Each independent experiment was repeated three times (n = 3), and the surface pressure and membrane area were taken as the arithmetic mean.

[0241] dA5Z was prepared according to the molar ratio of 6:6:1 in Example 8. 2 Mix the three mother liquors 18C4-JI, DSPC, and Chol to prepare a 1.0 mM mixed solution B'. Repeat the above experiment under the same conditions and record the changes from dA5Z. 2 π-S isotherm of a monolayer lipid membrane model composed of 18C4-JI, DSPC, and Chol.

[0242] According to the molar ratio of 8:4.8 in Example 6, dA5Z 2 18C4-JI and dA5Z 2 18. Mix the two mother liquors to prepare a 1.0 mM mixed solution A. Repeat the above experiment under the same conditions and record the concentration of dA5Z. 2 18C4-JI and dA5Z 2 π-S isotherm of a monolayer lipid membrane model composed of 18.

[0243] According to the molar ratio of 7:5 in Example 9, dA5Z 2 18C4-JI and dA5Z 218. Mix the two mother liquors to prepare a 1.0 mM mixed solution B. Repeat the above experiment under the same conditions and record the results. 2 18C4-JI and dA5Z 2 π-S isotherm of a monolayer lipid membrane model composed of 18.

[0244] like Figure 3 As shown in Figure A, the mixed solution A'(dA5Z) 2 The monolayer lipid film formed at the gas-liquid interface of 18C4-JI / DSPC / Chol., 4:4:1) exhibits a smoothly rising π-S isotherm and no obvious phase separation plateau, indicating that dA5Z 2 18C4-JI exhibits good compatibility with lipid components (DSPC and Chol.). When dA5Z... 2 When the lipid components (DSPC and Chol.) are replaced, the π-S isotherm of the monolayer lipid membrane formed by the mixed solution A almost coincides with that of the former, indicating that the diacidimidazolium-based biomimetic lipid compound dA5Z 2 18 can replace DSPC and Chol. It is also a substitute for the bulk compound imidazole-based binary asymmetric biomimetic lipid compound dA5Z. 2 18C4-JI forms a monolayer lipid membrane with similar membrane physiological properties. Due to dA5Z 2 The hydrophobic structure of 18 is consistent with that of DSPC, therefore it can be proven that dA5Z 2 The distearate moiety in the asymmetric hydrophobic tail of 18C4-JI can mimic the membrane physiological behavior and function of phospholipid DSPC, while the membrane physiological behavior and function of cholesterol are undertaken by the cholesterol steroidal ring moiety in its asymmetric hydrophobic tail. Furthermore, the mixed solution B'(dA5Z) 2 18C4-JI / DSPC / Chol., 6:6:1) and mixed solution B(dA5Z) 2 18C4-JI / dA5Z 2 The π-S isotherms of the monolayer lipid membrane formed by 18, 7:5) have a gentler slope and almost overlap, which corroborates the above conclusion. This indicates that the imidazole-based binary asymmetric biomimetic lipid compound dA5Z 2 18C4-JI can simultaneously simulate the membrane physiological behavior and function of phospholipid DSPC and cholesterol in a monolayer lipid membrane model, exhibiting good biocompatibility and being independent of the molar ratio of lipid membrane composition.

[0245] (2) Lipid bilayer model

[0246] dA5Z 2 18C4-JI, dA5Z 218. DSPC and Chlorine were dissolved in CHCl3 respectively, and both were prepared into stock solutions with a concentration of 2.7 mM. dA5Z was then prepared according to the molar ratio of 4:4:1 in Example 5. 2 Three mother liquors, 18C4-JI, DSPC, and Chol, were mixed. The organic solvent was removed by nitrogen blowing or rotary evaporation at 50°C, followed by vacuum drying at 60°C for 3 h to remove residual organic solvent. A semi-transparent mixed lipid film was formed on the inner wall of the container. Then, an equal volume of ultrapure water (pH 7.0) was added to the container, and the mixture was incubated at 50°C for 10 min, followed by vortexing for 1–3 min to fully hydrate the lipid film. This hydration process was repeated 5 times to obtain a turbid mixed lipid colloidal solution. After ultrasonic treatment for 50 min, the colloidal solution was repeatedly extruded 30 times through a 100 nm pore size PC filter membrane to obtain the dA5Z-based product. 2 The lipid bilayer model (liposomes) of 18C4-JI, DSPC, and Chol. was used. Subsequently, 800 μL of the above liposome sample and an equal volume of ultrapure water (pH 7.0) were added to the sample chamber and reference chamber of a Setaram III differential scanning calorimeter, respectively. The temperature of both chambers was then uniformly heated from 15°C to 60°C at a rate of 30°C / h using a programmed temperature control method. Immediately afterwards, the temperature of both chambers was cooled from 60°C to 15°C at the same rate, thus obtaining a single complete steady-state heating-cooling cycle. Each independent experiment was repeated three times (n = 3), and the DSC curves of each independent cycle were recorded. The phase transition temperature was taken as the arithmetic mean.

[0247] dA5Z was prepared according to the molar ratio of 6:6:1 in Example 8. 2 Mix 18C4-JI, DSPC, and Chol. stock solutions, keep other conditions unchanged, repeat the above experiment, and record the results. 2 DSC curves of a lipid bilayer model (liposome) composed of 18C4-JI, DSPC, and Chol.

[0248] According to the molar ratio of 8:4.8 in Example 6, dA5Z 2 18C4-JI and dA5Z 2 18. Mix the two mother liquors, keep other conditions unchanged, repeat the above experiment, and record the results. 2 18C4-JI and dA5Z 2 DSC curves of a lipid bilayer model (liposome) composed of 18 molecules.

[0249] According to the molar ratio of 7:5 in Example 9, dA5Z 2 18C4-JI and dA5Z 2 18. Mix the two mother liquors, keep other conditions unchanged, repeat the above experiment, and record the results. 218C4-JI and dA5Z 2 DSC curves of a lipid bilayer model (liposome) composed of 18 molecules.

[0250] like Figure 3 As shown in B, the lipid bilayer model (dA5Z) 2 In the DSC curve of 18C4-JI / DSPC / Chol., 4:4:1), the main phase transition peak appears at 59.2℃ and there is no obvious phase separation peak, indicating that dA5Z 2 The 18C4-JI, DSPC, and Chol. tricomponents exhibit excellent compatibility and... Figure 3 The results in A are consistent. The lipid components (DSPC and Chol.) were affected by dA5Z. 2 After 18 substitution, the lipid bilayer model (dA5Z) 2 18C4-JI / dA5Z 2 The DSC curve of (18, 8:4.8) shows a main phase transition peak at 59.4℃, and the peak shape is consistent with the former. In contrast, the lipid bilayer model (dA5Z) 2 The cholesterol content in 18C4-JI / DSPC / Chol., 6:6:1 was slightly reduced, and the main phase transition peak of its DSC curve shifted slightly to the left, with a phase transition temperature of 57.1℃. (dA5Z lipid bilayer model) 2 18C4-JI / dA5Z 2 The main phase transition peak of (18, 7:5) appears at 57.0℃, and the peak shape is consistent with the lipid bilayer model (dA5Z). 2 18C4-JI / DSPC / Chol., 6:6:1) is completely identical. This demonstrates that the imidazole-based binary asymmetric biomimetic lipid compound dA5Z 2 18C4-JI can simultaneously simulate the membrane physiological behavior and function of phospholipid DSPC and cholesterol in lipid bilayer models (liposomes), exhibiting good biocompatibility and independent of the molar ratio of liposome composition.

[0251] In summary, based on its structural characteristics, the imidazole-based binary asymmetric biomimetic lipid compound dA5Z... 2 18C4-JI can simultaneously mimic the membrane physiological properties of phospholipid DSPC and cholesterol, exhibiting good biocompatibility.

[0252] Example 12: Regulation of transmembrane resistance in a blood-brain barrier model by imidazole-based binary asymmetric biomimetic lipid compounds

[0253] This embodiment characterizes the dynamic regulation of transmembrane resistance in an in vitro blood-brain barrier model by using LNPs-1 to LNPs-18 prepared in Example 3 and LNPs of Control Examples 1 to 3 prepared in Comparative Example 1 as a delivery system.

[0254] HCMEC / D3 immortalized human brain microvascular endothelial cells were cultured in ECM medium containing 5% fetal bovine serum and seeded at a density of 50,000 cells / well in Transwell chambers. TM Collagen-coated polycarbonate membrane (0.4 µm pore size and 0.33 cm² growth area) in No. 3413 Costar. 2 Replace the medium with fresh ECM medium containing 5% fetal bovine serum and continue culturing for 2-3 days. Then replace the medium with DMEM / F12 serum-free medium containing 550 nM hydrocortisone and continue culturing for two more days at 5% CO2 and 37°C until the HCMEC / D3 cell monolayers fuse to form a barrier model.

[0255] The transmembrane resistance (TEER) of the HCMEC / D3 cell barrier formed above was measured using a CellZscope II real-time cell dynamics analyzer (nanoAnalytic, Germany). The test module and serum-free DMEM / F12 medium containing 550 nM hydrocortisone were preheated at 5% CO2 and 37°C for 1 h. 1.2 mL of DMEM / F12 serum-free medium was added to each metal chamber of the test module. After transferring the aforementioned Transwell chambers to the metal chambers of the test module, the TEER in each Transwell chamber was measured at a rate of one chamber / min under 5% CO2 and 37°C. The results showed that the TEER of each chamber was greater than 300 Ω·cm. 2 This indicates that the fused HCMEC / D3 cell monolayer possesses barrier function, and the in vitro blood-brain barrier model has been successfully constructed, which can be used for experiments on the dynamic regulation of the blood-brain barrier.

[0256] The LNPs-1 to LNPs-18 prepared in Example 3 and the LNPs of Control Examples 1 to 3 prepared in Comparative Example 1 were added to each Transwell cell, and the TEER of each cell was measured according to the above method. Real-time changes within 24 hours were observed. The maximum amplitude of TEER downregulation, the corresponding time, and the recovery window for each group were recorded, as shown in Table 6. Among them, LNPs-1(dA5Z) 2 18C4-JI / dA5Z 2 18) LNPs-3(dA4Z 2 15C3-JI / dA4Z 2 15) LNPs-8(dA4Z) ij 2 15C4-JI / dA4Z ij 2 15) LNPs-12(dA4Z15Z ij 15C4-JI / dA4Z15Zij 15) LNPs-15(dA5Z ij 2 18C4-JI / dA5Z ij 2 18) and LNPs-17(dA5Z15Z) ij 18C4-JCl / dA5Z15Z ij 18) and the real-time dynamic changes of TEER mediated by Comparative Examples 1-3, such as Figure 4 As shown.

[0257] Table 6

[0258]

[0259] (*The TEER recovery window is the time interval when the TEER recovery level is ≥95%)

[0260] Table 6 shows that all LNPs-1 to LNPs-18 delivery systems mediated the downregulation of TEER in the in vitro blood-brain barrier model constructed from HCMEC / D3 cells, with the TEER reduction ranging from 39.7% to 64.8%. Among them, LNPs-1 (dA5Z) 2 18C4-JI / dA5Z 2 18) Under LNP-mediated delivery, the maximum TEER decrease was 64.8% (maximum value) at 5.4 h. In other groups, the maximum TEER decrease occurred within 5–8 h under LNP-mediated delivery. In contrast, no significant TEER downregulation was observed after delivery by the LNP delivery systems prepared in Examples 1–3. Table 6 demonstrates that the LNPs-1–LNPs-18 delivery systems composed of imidazole-based binary asymmetric biomimetic lipid compounds prepared in Examples 1 and 2 can dynamically regulate TEER in an in vitro blood-brain barrier model, thus possessing the potential to dynamically regulate the degree of blood-brain barrier opening in vivo.

[0261] In addition, LNPs-1(dA5Z) in Table 6 2 18C4-JI / dA5Z 2 18) LNPs-3(dA4Z 2 15C3-JI / dA4Z 2 15) LNPs-8(dA4Z) ij 2 15C4-JI / dA4Z ij 2 15) LNPs-12(dA4Z15Z ij 15C4-JI / dA4Z15Z ij 15) LNPs-15(dA5Z ij 218C4-JI / dA5Z ij 2 18) and LNPs-17(dA5Z15Z) ij 18C4-JCl / dA5Z15Z ij 18) Real-time dynamic changes in TEER mediated by the delivery system, such as Figure 4 As shown in the figure, all LNPs mediated the downregulation of TEER in the in vitro blood-brain barrier model constructed from HCMEC / D3 cells, and the TEER level was almost completely restored within 24 h, with the TEER recovery window ranging from 4.3 to 7.8 h (Table 6). In contrast, no downregulation of TEER was observed in the in vitro blood-brain barrier models mediated by Control Example 1 (ALC-0315 / DSPC), Control Example 2 (D-Lin-MC3-DMA / DSPC), and Control Example 3 (SM-102 / DSPC) in Comparative Example 1.

[0262] In summary, it can be demonstrated that the LNPs-1 to LNPs-18 delivery system, composed of imidazole-based binary asymmetric biomimetic lipid compounds 1 to 18, can mediate the largest reduction in TEER (39.7% to 64.8%) in the extracorporeal blood-brain barrier model within 5 to 8 hours, and can regulate TEER to essentially return to pre-mediation levels within 4.3 to 7.8 hours. Among them, the imidazole-based binary asymmetric biomimetic lipid compound dA5Z... 2 18C4-JI and the corresponding diacylimidazolium-based biomimetic lipid compound dA5Z 2 LNPs-1(dA5Z) composed of 18 2 18C4-JI / dA5Z 2 18) Under the mediation, TEER showed a maximum decrease of 64.8% (maximum value) at 5.4 h, and basically recovered to the pre-mediation level within 4.3 h.

[0263] Example 13: Regulation of blood-brain barrier permeability in a model by imidazole-based binary asymmetric biomimetic lipid compounds

[0264] Based on the results of Example 12, this example characterizes the dynamic regulatory effect of LNPs-1 to LNPs-18 prepared in Example 3 and LNPs of Control Examples 1 to 3 prepared in Comparative Example 1 as delivery systems on the permeability of an in vitro blood-brain barrier model.

[0265] An in vitro blood-brain barrier model based on HCMEC / D3 immortalized human brain microvascular endothelial cells was constructed according to the method described in Example 12 (the culture medium was replaced with phenol red-free DMEM / F12 serum-free medium). Subsequently, the TEER of each compartment was characterized as greater than 300 Ω·cm using a CellZscope II real-time cell dynamics analyzer. 2This indicates that the in vitro blood-brain barrier model has been successfully constructed.

[0266] Following the method described in Example 12, LNPs-1 to LNPs-18 prepared in Example 3 and LNPs from Control Examples 1 to 3 prepared in Comparative Example 1 were added to each Transwell chamber. After 5 h, 300 µL of phenol red-free DMEM / F12 serum-free medium containing 15 µg / mL fluorescein sodium (SF, CAS: 518-47-8) was added to each chamber. After 30 min, the concentration of SF in each metal chamber of the test module was measured at Ex / Em: 488 / 525 nm using a microplate reader (FLUOstar Omega, BMG Labtech), and the SF flow rate (ΔQ) was calculated based on the volume of medium in the metal chamber. The result was obtained using the following formula:

[0267]

[0268] (ΔQ / Δt: mass flow rate of SF, µg / s; C) d (0): Initial concentration of SF in the Transwell chamber, µg / mL; S: Membrane growth area within the Transwell chamber, cm² 2 )

[0269] Calculate the apparent permeability (P) of SF across the in vitro blood-brain barrier model. app (Table 7) characterizes the dynamic regulatory effect of LNPs-1 to LNPs-18 prepared in Example 3 and LNPs of Control Examples 1 to 3 prepared in Comparative Example 1 on the permeability of the in vitro blood-brain barrier model.

[0270] Table 7

[0271]

[0272] As shown in Table 7, the apparent permeation rates of SF across the in vitro blood-brain barrier model mediated by LNPs-1 to LNPs-18 delivery systems ranged from 2.57 to 4.14 cm / s. Among them, LNPs-1(dA5Z) 2 18C4-JI / dA5Z 2 Under LNPs-1 to LNPs-18 mediated by LNPs-1, the apparent permeation rate of SF reached a maximum of 4.14 cm / s, which is consistent with the results obtained in Table 6. In contrast, the apparent permeation rates of SF mediated by the LNPs delivery systems prepared in Examples 1 to 3 were 0.01 cm / s (ALC-0315 / DSPC), 0.02 cm / s (D-Lin-MC3-DMA / DSPC), and 0.05 cm / s (SM-102 / DSPC), respectively, which are much lower than the results mediated by LNPs-1 to LNPs-18.

[0273] Combined with the results shown in Table 6 of Example 12, it is evident that the LNPs-1~LNPs-18 delivery system composed of imidazole-based binary asymmetric biomimetic lipid compounds prepared in Examples 1 and 2 can downregulate the TEER of the in vitro blood-brain barrier model, enhance the permeability of the in vitro blood-brain barrier model, and mediate the recovery of barrier function to the pre-mediation level within a short time window, demonstrating the potential to dynamically and reversibly regulate the opening of the blood-brain barrier in vivo.

[0274] Example 14: Delivery effect of drug-loaded lipid nanoparticles PTX@LNPs-1 to the brain at the in vivo level

[0275] Based on the above results, the imidazole-based binary asymmetric biomimetic lipid compound dA5Z was further evaluated. 2 The efficacy of 18C4-JI drug-loaded lipid nanoparticles PTX@LNPs-1 in in vivo brain delivery.

[0276] U-118MG cell suspension (1×10⁻⁶) was implanted into the brains of immunodeficient female nude mice with an average weight of approximately 25 g at 4-8 weeks of age. 6 (cells / mL), after 1-2 weeks of growth, a tumor volume of approximately 100-150 mm was obtained. 3 An immunodeficient mouse model was established. These mice were randomly divided into three groups of three. PTX@LNPs-1, PTX@LNPs-1', and the following PTX@ALC-0315 / DSPC / Chol., PTX@D-Lin-MC3-DMA / DSPC / Chol., PTX@SM-102 / DSPC / Chol., PTX@ALC-0315 / DSPC, PTX@D-Lin-MC3-DMA / DSPC, and PTX@SM-102 / DSPC from Comparative Examples 2-3 (Control Examples 4-9) were injected via tail vein (dose 10 mg / kg, injection volume 200 μL). The blank control group received an equal volume of physiological saline. Brain tissue was collected at 4, 8, 12, 18, and 24 h post-injection. The concentration of PTX in brain tissue and plasma was determined by HPLC, and the brain tissue-to-plasma concentration ratio (B / P ratio) was calculated for each group. The results are shown below. Figure 5 As shown in Figure A. The above experiment was repeated, except that mouse brain tissue was removed one week after injection. Tumor weights were compared between groups, and the relative tumor proliferation rate (T / C ratio) was calculated. The results are shown below. Figure 5 As shown in B.

[0277] Depend on Figure 5A indicates that after intravenous injection of PTX@LNPs-1' into the tail vein of a mouse model, the average B / P ratio at 4, 8, 12, 18, and 24 h were approximately 0.6, 1.2, 1.4, 1.8, and 1.8, respectively, while after injection of PTX@LNPs-1, the average B / P ratio at 4, 8, 12, 18, and 24 h were approximately 0.9, 1.4, 1.8, 2.6, and 2.2, respectively. This suggests that the lipid components (DSPC and Chol.) are affected by dA5Z. 2 After 18 is replaced, it is dA5Z 2 18C4-JI and dA5Z 2 LNPs-1(dA5Z) composed of 18 2 18C4-JI / dA5Z 2 18) showed superior brain delivery efficiency for PTX. In contrast, tail vein injection of PTX@ALC-0315 / DSPC / Chol., PTX@D-Lin-MC3-DMA / DSPC / Chol., and PTX@SM-102 / DSPC / Chol. from Comparative Examples 2 (Controls 4-6), and PTX@ALC-0315 / DSPC, PTX@D-Lin-MC3-DMA / DSPC, and PTX@SM-102 / DSPC from Comparative Examples 3 (Controls 7-9) resulted in average B / P ratios at all time points not exceeding 0.4, significantly lower than those of PTX@LNPs-1' and PTX@LNPs-1. This indicates that dA5Z, a binary asymmetric biomimetic lipid compound based on imidazole groups, exhibits superior brain delivery efficiency. 2 Drug-loaded LNPs of 18C4-JI significantly enhanced the blood-brain barrier permeability of PTX and the brain tissue distribution in mouse models, with brain delivery effects far superior to those of comparative examples 2-3 (control examples 4-9).

[0278] Figure 5 In sample B, one week after tail vein injection of PTX@LNPs-1' and PTX@LNPs-1, the mean T / C ratios were 0.57 and 0.42, respectively, indicating mean relative tumor inhibition rates of 43% and 58%. This suggests that the lipid components (DSPC and Chol.) were inhibited by dA5Z. 2 After 18 is replaced, it is dA5Z 2 18C4-JI and dA5Z 2 LNPs-1(dA5Z) composed of 18 2 18C4-JI / dA5Z 2 18) Pharmacodynamics is better after PTX is delivered to the brain, compared with... Figure 5The results shown in A are consistent. After one week of tail vein injection of PTX@ALC-0315 / DSPC / Chol., PTX@D-Lin-MC3-DMA / DSPC / Chol., and PTX@SM-102 / DSPC / Chol. from Comparative Examples 2 (Controls 4-6), and PTX@ALC-0315 / DSPC, PTX@D-Lin-MC3-DMA / DSPC, and PTX@SM-102 / DSPC from Comparative Examples 3 (Controls 7-9), the average T / C ratio ranged from 0.96 to 1.05, i.e., the average relative tumor inhibition rate ranged from -5% to 4%. This indicates that the drug-loaded LNPs in Comparative Examples 2-3 (Controls 4-9) failed to significantly inhibit tumor proliferation. At the same PTX dose, the pharmacodynamics of PTX@LNPs-1' and PTX@LNPs-1 after delivering PTX to the brain were significantly better than those of the drug-loaded LNPs in Comparative Examples 2-3 (Controls 4-9). Figure 5 The results shown in A are consistent.

[0279] Example 15: Drug-loaded lipid nanoparticle Cy7-ASO@LNPs-1 delivery effect in the brain at the in vivo level

[0280] This embodiment further evaluates the imidazole-based binary asymmetric biomimetic lipid compound dA5Z. 2 The in vivo brain delivery efficacy of 18C4-JI drug-loaded lipid nanoparticles Cy7-ASO@LNPs-1.

[0281] Female SPF-grade BALB / c mice, aged 6-8 weeks and with an average weight of approximately 20 g, were randomly divided into three groups of three mice each. Cy7-ASO@LNPs-1, Cy7-ASO@LNPs-1', and the control examples 4-5 (control examples 10-15) of Cy7-ASO@ALC-0315 / DSPC / Chol., Cy7-ASO@D-Lin-MC3-DMA / DSPC / Chol., Cy7-ASO@SM-102 / DSPC / Chol., Cy7-ASO@ALC-0315 / DSPC, Cy7-ASO@D-Lin-MC3-DMA / DSPC, and Cy7-ASO@SM-102 / DSPC were administered via a single dose of 0.25 mg / kg Cy7-ASO via the tail vein. The control group received an equal volume of physiological saline. Six hours after drug administration, the total fluorescence intensity in the mouse brain was detected using the small animal in vivo imaging system IVIS. The results are as follows: Figure 6 As shown in Figure A. Furthermore, the content of target mRNA in the brains of mice in each group was measured using real-time quantitative PCR to determine the knockout status of the target mRNA in each group. The results are shown in Figure A. Figure 6 As shown in B.

[0282] Depend on Figure 6 As shown in A, after injecting Cy7-ASO@LNPs-1' and Cy7-ASO@LNPs-1 into the tail vein of a mouse model, the total fluorescence intensity in the mouse brain was 3.6 × 10⁻⁶, respectively. 9 p / s and 4.5×10 9 p / s indicates that the lipid components (DSPC and Chol.) are affected by dA5Z. 2 After 18 is replaced, it is dA5Z 2 18C4-JI and dA5Z 2 LNPs-1(dA5Z) composed of 18 2 18C4-JI / dA5Z 2 18) showed superior brain delivery efficiency for ASO. In contrast, after tail vein injection of Cy7-ASO@ALC-0315 / DSPC / Chol., Cy7-ASO@D-Lin-MC3-DMA / DSPC / Chol., and Cy7-ASO@SM-102 / DSPC / Chol. from Comparative Examples 4 (Controls 10-12), and Cy7-ASO@ALC-0315 / DSPC, Cy7-ASO@D-Lin-MC3-DMA / DSPC, and Cy7-ASO@SM-102 / DSPC from Comparative Examples 5 (Controls 13-15), the total fluorescence intensity in each group did not exceed 1.0 × 10⁻⁶. 9 The p / s ratio is significantly lower than that of Cy7-ASO@LNPs-1' and Cy7-ASO@LNPs-1. This indicates that the imidazole-based binary asymmetric biomimetic lipid compound dA5Z... 2 Drug-loaded LNPs of 18C4-JI significantly improved brain tissue distribution in ASO mouse models, with brain delivery effects far superior to those of control examples 4-5 (control examples 10-15).

[0283] Depend on Figure 6 As shown in B, Cy7-ASO@LNPs-1' and Cy7-ASO@LNPs-1 achieved knockout rates of 52% and 64% for the target mRNA, respectively, indicating that the lipid components (DSPC and Chol.) were knocked out by dA5Z. 2 After 18 is replaced, it is dA5Z 2 18C4-JI and dA5Z 2 LNPs-1(dA5Z) composed of 18 2 18C4-JI / dA5Z 2 18) Pharmacodynamics is better after ASO is delivered to the brain, compared with... Figure 6The results shown in A are consistent. In contrast, the knockout rates of target mRNA by Cy7-ASO@ALC-0315 / DSPC / Chol., Cy7-ASO@D-Lin-MC3-DMA / DSPC / Chol., and Cy7-ASO@SM-102 / DSPC / Chol. in Comparative Examples 4 (Controls 10-12) and Cy7-ASO@ALC-0315 / DSPC, Cy7-ASO@D-Lin-MC3-DMA / DSPC, and Cy7-ASO@SM-102 / DSPC in Comparative Examples 5 (Controls 13-15) ranged from 12% to 29%, which were much lower than those of Cy7-ASO@LNPs-1' and Cy7-ASO@LNPs-1. At the same ASO dose, the pharmacodynamics of Cy7-ASO@LNPs-1' and Cy7-ASO@LNPs-1 after delivering ASO to the brain were significantly better than those of the drug-loaded LNPs in Comparative Examples 4-5 (Control Examples 10-15). Figure 6 The results shown in A are consistent.

[0284] In summary, it can be demonstrated that the drug-loaded LNPs based on imidazole-based binary asymmetric biomimetic lipid compounds in this invention can effectively cross the blood-brain barrier to achieve brain-targeted delivery of different types of drugs. Among them, the imidazole-based binary asymmetric biomimetic lipid compound dA5Z... 2 18C4-JI and the corresponding diacylimidazolium-based biomimetic lipid compound dA5Z 2 LNPs-1(dA5Z) composed of 18 2 18C4-JI / dA5Z 2 The preparation process of 18) is simpler, easier to scale up, and its brain-targeted delivery efficiency is better.

[0285] The embodiments of the present invention have been described in detail above, but they should not be used to limit the scope of the present invention. All variations made within the scope of the present invention should still fall within the patent coverage of the present invention.

Claims

1. An imidazolyl binary asymmetric biomimetic lipid compound, characterized in that: The structure is shown in Equation 12; Equation 12; Where R' is C 13 ~C 17 A straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R" is C 13 ~C 17 The straight-chain saturated hydrocarbon group or the straight-chain unsaturated hydrocarbon group, where R' and R" are the same group or different groups; m is an integer from 2 to 5; n is an integer from 3 to 9; X - It is an anionic group, specifically I - ,Br - Cl - BF4 - or PF6 - .

2. The imidazole-based binary asymmetric biomimetic lipid compound according to claim 1, characterized in that: R' and R" can be one or both of the following structures: 。 3. A method for preparing the imidazole-based binary asymmetric biomimetic lipid compound of claim 1, characterized in that: Includes the following steps: Step S01: The compound shown in Formula 1 is reacted with a protecting agent containing the protecting group PG-I to obtain the intermediate shown in Formula 2; ； Step S02: The intermediate shown in Formula 2 is reacted with a protecting agent containing the protecting group PG-II to obtain the intermediate shown in Formula 3; ； Step S03: The intermediate shown in Formula 3 and the compound shown in Formula 4 are reacted together under anaerobic and strongly alkaline conditions to obtain the intermediate shown in Formula 5. ； Step S04: Under certain conditions, the protecting group PG-I of the intermediate shown in Formula 5 is removed to obtain the intermediate shown in Formula 6. ； Step S05: The intermediate shown in Formula 6 and the compound shown in Formula 7 are subjected to an etherification reaction under certain conditions to obtain the intermediate shown in Formula 8. ； Step S06: Under certain conditions, the protecting group PG-II of the intermediate shown in Formula 8 is removed to obtain the diacylimidazolium-based biomimetic lipid compound shown in Formula 9. ； Step S07: The diacylimidazolium biomimetic lipid compound shown in Formula 9 is esterified with the compound shown in Formula 10, and then salted with the compound shown in Formula 11 to obtain the imidazolium binary asymmetric biomimetic lipid compound shown in Formula 12. 。 4. A drug-loaded lipid nanoparticle, characterized in that: It includes the imidazole-based binary asymmetric biomimetic lipid compound as described in claim 1 or 2, phospholipids, cholesterol, and therapeutic drugs; the therapeutic drugs are small molecule drugs, peptide drugs, or small nucleic acid drugs.

5. A drug-loaded lipid nanoparticle, characterized in that: Includes the imidazole-based binary asymmetric biomimetic lipid compound as described in claim 1 or 2, the therapeutic drug, and the diacylimidazole-based biomimetic lipid compound shown in Formula 9; the therapeutic drug is a small molecule drug, a peptide drug, or a small nucleic acid drug; Equation 9; Where R' is C 13 ~C 17 A straight-chain saturated hydrocarbon group or a straight-chain unsaturated hydrocarbon group, where R" is C 13 ~C 17 The straight-chain saturated hydrocarbon group or the straight-chain unsaturated hydrocarbon group, where R' and R" are the same group or different groups; n is an integer from 3 to 9.

6. The drug-loaded lipid nanoparticles according to claim 5, characterized in that: Compound 9 has the same R' and R" as compound 12.

7. The drug-loaded lipid nanoparticles according to claim 5, characterized in that: The molar ratio of the imidazole-based binary asymmetric biomimetic lipid compound shown in Formula 12 to the diacylimidazole-based biomimetic lipid compound shown in Formula 9 is 1:(0.5~1).

8. The method for preparing drug-loaded lipid nanoparticles according to any one of claims 5-7, characterized in that: By mixing imidazole-based binary asymmetric biomimetic lipid compounds with therapeutic drugs and diacylimidazole-based biomimetic lipid compounds, drug-loaded lipid nanoparticles containing therapeutic drugs are prepared.

9. The method for preparing drug-loaded lipid nanoparticles according to claim 8, characterized in that: Lipid nanoparticles containing therapeutic drugs are prepared by mixing imidazole-based binary asymmetric biomimazole-based biomimazole-based lipid compounds with therapeutic drugs, using a thin-film hydration method or a microfluidic system.

10. The use of the drug-loaded lipid nanoparticles according to any one of claims 4-7 in the preparation of brain-targeting drugs.

Images