An antibacterial peptide hipamp19, polynucleotide, expression vector, host cell, preparation method and application thereof

Abstract

The application belongs to the technical field of peptide antibiotics, and discloses an antibacterial peptide hipAMP19, a polynucleotide, an expression vector, a host cell, a preparation method and application of the antibacterial peptide hipAMP19. The antibacterial peptide hipAMP19 is a polypeptide composed of 16 amino acids, and the amino acid sequence is shown as SEQ ID NO. 1, and the theoretical molecular weight is 1888.22 Da. The polypeptide is obtained through a deep learning model screening and experimental verification, and the coding gene, a recombinant expression system and a suitable solid-phase synthesis method are provided. The antibacterial peptide has the advantages of clear structure, small molecular weight and convenient artificial synthesis, and has a broad-spectrum and high-efficiency inhibitory effect on gram-positive bacteria and gram-negative bacteria. The application also provides the application of the antibacterial peptide in the preparation of antibacterial agents, antibacterial infection drugs, food preservatives and feed additives, and provides a new candidate molecule for the development and application of the antibacterial peptide in the medical, agricultural and food industries.

Description

Technical Field

[0001] This invention belongs to the field of peptide antibiotic technology, specifically an antimicrobial peptide hipAMP19 and its polynucleotides, expression vector, host cell, preparation method and application. Background Technology

[0002] With the long-term use and abuse of antimicrobial drugs, antimicrobial resistance has become a serious public health problem worldwide, while the research and development and production of novel antimicrobial drugs have failed to meet clinical needs. Therefore, the development of novel antimicrobial drugs has become a focus of global scientific research. Antimicrobial peptides (AMPs), due to their unique antimicrobial mechanisms and broad-spectrum antimicrobial activity, have become a research hotspot.

[0003] Antimicrobial peptides are a class of antimicrobial molecules widely found in eukaryotes, bacteria, and archaea. Produced through mRNA ribosome translation or non-ribosomal peptide synthesis, they serve as key components of the organism's innate immune system, playing a crucial role in defending against invading pathogenic microorganisms. Antimicrobial peptides can exert direct and potent antimicrobial activity against a variety of microorganisms, including Gram-negative bacteria, Gram-positive bacteria, fungi, and viruses, through multiple mechanisms of action (such as disrupting bacterial cell membrane integrity and interfering with intracellular physiological processes). The broad-spectrum and complex antimicrobial activity of antimicrobial peptides, coupled with their low tendency to induce drug resistance, makes them promising candidates for applications in medicine, food, and agriculture.

[0004] Due to the complex structures and diverse sequences of antimicrobial peptides, identifying, screening, designing, and predicting the properties of different antimicrobial peptides from a large pool of candidate peptides is extremely difficult. Wet experiments are time-consuming and labor-intensive for discovering antimicrobial peptides. Deep learning technology, with its powerful pattern recognition and feature extraction capabilities, can learn the relationship between the structure and function of antimicrobial peptides from large amounts of data, providing new ideas and methods for antimicrobial peptide screening and design. Commonly used deep learning models in antimicrobial peptide identification and screening include convolutional neural networks (CNNs), recurrent neural networks (RNNs), long short-term memory networks (LSTMs), graph convolutional networks (GCNs), and graph attention networks (GATs). These models can model and predict the sequence, structure, and function of antimicrobial peptides from different perspectives, greatly improving research efficiency and accuracy.

[0005] However, existing deep learning models still have certain limitations in practical applications, mainly due to the uneven distribution of training data sources. This leads to significant biases in the model's predictive ability for antimicrobial peptides from different biological groups. Currently, publicly available antimicrobial peptide databases primarily contain sequences from well-studied sources such as terrestrial mammals, amphibian skin secretions, and some bacteriocins. Information on antimicrobial peptide sequences from marine invertebrates and bony fish, which have unique evolutionary positions or environmental adaptation mechanisms, is extremely scarce. This uneven data distribution means that deep learning models trained on existing databases are better at identifying candidate peptides with similar sequence characteristics to known antimicrobial peptides. However, for potential antimicrobial peptides with high sequence novelty, distant lineages, unique amino acid compositions, or special structural motifs, their generalization prediction ability significantly decreases, easily leading to missed or misjudged results.

[0006] Furthermore, antimicrobial peptides from different biological proteomes exhibit significant differences in sequence length, charge distribution, hydrophobic patterns, and secondary structure preferences. Marine fish, having adapted to high-salt, high-pressure, low-temperature environments and high abundance of pathogenic microorganisms, often develop unique sequence characteristics in their antimicrobial peptides during evolution, such as higher glycine content to enhance structural flexibility and specific proline motifs to impart salt tolerance. The specificity of sequence characteristics among antimicrobial peptides from different sources means that a uniform structure and activity pattern cannot be applied. Therefore, screening models trained on data from a specific group are difficult to effectively extend to the task of discovering antimicrobial peptides from other groups. Current technologies lack effective solutions for systematically and deeply mining the sequence characteristics of antimicrobial peptides from specific biological proteomes, especially for marine bony fish like seahorses, which possess both unique immune niches and medicinal value; the large number of potential antimicrobial peptide sequences contained in their proteomes have not yet been fully analyzed and utilized. Summary of the Invention

[0007] The purpose of this invention is to provide an antimicrobial peptide, hipAMP19, its polynucleotide, expression vector, host cell, preparation method, and application. By constructing a peptide database for feature analysis and digital encoding, and using the PyTorch deep learning framework to build a model for prediction and screening, an antimicrobial peptide, hipAMP19, with inhibitory effects against various Gram-positive and Gram-negative bacteria and an inhibition rate of over 95% is obtained. A suitable preparation method is also provided to offer candidate molecules for the development of novel antimicrobial agents.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] On the one hand, the present invention provides an antimicrobial peptide hipAMP19, the amino acid sequence of which is shown in SEQ ID NO.1.

[0010] SEQ ID NO. 1: DNKKRHYGMGVVGKWL.

[0011] The corresponding amino acid sequence is Asp-Asn-Lys-Lys-Arg-His-Tyr-Gly-Met-Gly-Val-Val-Gly-Lys-Trp-Leu.

[0012] In a second aspect, the present invention provides a polynucleotide, wherein the polynucleotide is a polynucleotide H1 (SEQ ID NO.2) encoding the antimicrobial peptide hipAMP19 or a polynucleotide H2 (SEQ ID NO.3) complementary to the polynucleotide H1.

[0013] SEQ ID NO.2:GACAACAAAAAACGCCACTACGGTATGGGTGTTGTTGGTAAATGGCTG

[0014] SEQ ID NO.3: CAGCCATTTACCAACAACACCCATACCGTAGTGGCGTTTTTTGTTGTC

[0015] Polynucleotides, including DNA and RNA, can be artificially synthesized using solid-phase synthesis technology.

[0016] Furthermore, the present invention also includes polypeptides or polypeptide analogs and derivatives, such as polynucleotide variants, encoding polypeptides having the same amino acid sequence as those of the present invention. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, some polynucleotide variants are substitutions of polynucleotides that do not substantially alter the function of the polypeptide they encode.

[0017] Thirdly, the present invention also provides an expression vector containing the aforementioned polynucleotides.

[0018] In this invention, the polynucleotide sequence of the antimicrobial peptide hipAMP19 is inserted into a recombinant expression vector using genetic engineering techniques. The term "expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors well-known in the art. In short, any plasmid and vector can be used as long as it can replicate and remain stable within the host.

[0019] Fourthly, the present invention also provides a host cell containing the above-described expression vector.

[0020] In this invention, the host cell can be a prokaryotic cell, such as a bacterial cell; a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Examples include, but are not limited to, *Escherichia coli*, *Bacillus subtilis*, and yeast.

[0021] The preferred host cell for this invention is Bacillus subtilis. When Bacillus subtilis is used as the host cell to express the antimicrobial peptide of this invention, it is not necessary to separate and purify the antimicrobial peptide. The Bacillus subtilis culture broth after induced expression can be directly used as a feed additive.

[0022] Fifthly, the present invention also provides the use of the aforementioned antimicrobial peptide hipAMP19 or polynucleotide in the preparation of antimicrobial agents, antibacterial drugs, food preservatives or feed additives.

[0023] As a limitation, the aforementioned antimicrobial agents, antibacterial drugs, food preservatives, or feed additives are used to inhibit the growth of Gram-positive or Gram-negative bacteria;

[0024] The Gram-positive bacteria include Staphylococcus aureus, Bacillus subtilis, and Listeria.

[0025] The Gram-negative bacteria include Escherichia coli, Pseudomonas aeruginosa, and Salmonella.

[0026] In a sixth aspect, the present invention also provides an antibacterial agent comprising the antimicrobial peptide hipAMP19, which is an injection, ointment, spray or drop.

[0027] Furthermore, the antibacterial agent also includes a drug-acceptable carrier and excipients suitable for the corresponding dosage form. For example, in an injection, it may contain sterile solvents such as physiological saline and phosphate buffer, as well as necessary stabilizers; in an ointment, it may contain a matrix such as petrolatum, lanolin, or hydroxypropyl methylcellulose; and in a spray or drop, it may contain isotonic adjusters, pH buffers, and preservatives.

[0028] In a seventh aspect, the present invention also provides a method for preparing the antimicrobial peptide hipAMP19, wherein, in accordance with the amino acid sequence shown in SEQ ID NO.1, amino acid monomers with protecting groups on the amino group are coupled to a solid support by a coupling reaction, the protecting groups on the amino acid monomers are removed to expose the free amino groups, and the amino acid monomers are sequentially coupled by a coupling reaction to synthesize a peptide chain.

[0029] The peptide chain was separated from the solid-phase support and purified to obtain the antimicrobial peptide hipAMP19.

[0030] As a further limitation, the protecting group is an Fmoc protecting group;

[0031] The solid support is Rink amide MBHA resin or Wang resin.

[0032] The coupling reaction uses HBTU-HOBt-DIEA combined coupling agent, ATU-HOAt-DIEA combined coupling agent, or DIC-Oxyma Pure combined coupling agent.

[0033] Among them, the Fmoc protecting group is a 9-fluorenylmethoxycarbonyl protecting group, which protects the α-amino group in the solid-phase synthesis of peptides and can be gently removed by piperidine under alkaline conditions;

[0034] HBTU is O-benzotriazole-tetramethylurea hexafluorophosphate, HOBt is 1-hydroxybenzotriazole, DIEA is N,N-diisopropylethylamine; ATU is (7-azabenzotriazole-1-yl)oxytripyrrolidinylphosphine hexafluorophosphate, HOAt is 1-hydroxy-7-azobenzotriazole, DIC is N,N'-diisopropylcarbodiimide, and Oxyma Pure is (cyano(hydroxyimino)ethyl acetate).

[0035] As a further limitation, a deprotecting solution is used to remove the protecting group of the amino acid monomer, wherein the deprotecting solution is a piperidine N,N-dimethylformamide solution with a volume concentration of 20%~30%;

[0036] A cleavage fluid is used to separate the peptide chain from the solid support. The cleavage fluid is prepared by mixing trifluoroacetic acid, triisopropylsilane and water in a volume ratio of 95:2.5:2.5.

[0037] Trifluoroacetic acid (TFA), as a strong acid and solvent, is responsible for cleaving the peptide chain-resin linkage and removing the protecting groups of the amino acid side chains; triisopropylsilane (TIS), as a cation scavenger, can effectively capture the active cation intermediates generated during the cleavage process, prevent them from modifying the sensitive amino acid side chains, and thus protect the integrity of the target peptide.

[0038] By adopting the above technical solution, the technical progress achieved by this invention compared with the prior art is as follows:

[0039] (1) The present invention uses a deep learning model to screen and predict the antibacterial activity of peptide data from millions of hippocampal proteomes. The resulting antimicrobial peptide hipAMP19 exhibits broad-spectrum and highly efficient inhibitory activity against a variety of pathogens, including Gram-positive and Gram-negative bacteria. Experiments have verified that when the final concentration is 200 μg / mL, the highest inhibition rate can reach 96.7%, which is suitable for developing a new generation of safe and efficient antimicrobial agents.

[0040] (2) Based on the amino acid sequence characteristics of the antimicrobial peptide hipAMP19, this invention optimizes and establishes a solid-phase synthesis process using Rink amide MBHA resin or Wang resin as a carrier. This method for preparing the antimicrobial peptide hipAMP19 has high yield, good biological activity, and few by-products, providing a material basis for subsequent formulation research, activity evaluation, and application in the fields of medicine, agriculture, and food.

[0041] (3) This invention covers the polynucleotide sequence, expression vector, host cell and preparation method of antimicrobial peptide hipAMP19, forming a complete system from molecular design, synthesis and preparation to application development, which is applicable to the development of new antimicrobial drugs, preservatives or biocontrol agents based on this antimicrobial peptide. Attached Figure Description

[0042] Figure 1 This is a high-performance liquid chromatography (HPLC) image of the antimicrobial peptide hipAMP19.

[0043] Figure 2 This is the secondary mass spectrum of the antimicrobial peptide hipAMP19;

[0044] Figure 3 The inhibition rate of Staphylococcus aureus ATCC25923 after treatment with different concentrations of the antimicrobial peptide hipAMP19 was determined.

[0045] Figure 4 The inhibition rate of Escherichia coli after treatment with different concentrations of the antimicrobial peptide hipAMP19.

[0046] The present invention will be further described in detail below through specific embodiments. It should be understood that the described embodiments are only for explaining the present invention and do not limit the present invention. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0047] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0048] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.

[0050] Example 1: Antimicrobial peptide hipAMP19

[0051] This embodiment describes the antimicrobial peptide hipAMP19 and its screening method, as detailed below:

[0052] T1. Constructing a peptide database: Hippocampal proteome data were obtained from the NCBI database. Simulated enzyme digestion was performed on the hippocampal proteome data using a variety of protease digestion systems, including digestive system proteases, intracellular degradation systems, signal peptidases, and restriction proteolytic enzyme systems. A peptide database for predictive analysis was constructed, which contains more than 1 million peptide data from the hippocampal proteome.

[0053] T2. Characterization of Known Antimicrobial Peptides: Collect known antimicrobial peptide data, digitally encode the physicochemical properties of peptide sequences, including molecular weight, isoelectric point, amino acid composition, and charge; simultaneously perform homology analysis of peptide sequences, construct evolutionarily conserved domain maps, identify evolutionarily conserved amino acid residues and domains, and mine pattern features in the sequences.

[0054] T3. Deep Learning Model Construction and Prediction: A model is built based on the PyTorch deep learning framework. The model is trained using the feature data obtained in T2. ​​Then, the model is applied to the peptide database constructed in T1 to predict antibacterial activity. The corresponding prediction probability and activity score are output for each peptide sequence fragment.

[0055] T4. Candidate Sequence Screening: The prediction results obtained in T3 are sorted and screened according to the activity score to obtain more than 1,000 candidate peptides with potential antibacterial activity.

[0056] T5. Wet Experiment Validation: The candidate peptides obtained in T4 were further screened in batches, and the corresponding peptides were artificially synthesized using a solid-phase synthesis method for antibacterial activity experiments to verify their antibacterial properties. Among them, the peptides hipAMP19, hipAMP19B, hipAMP19C, hipAMP19D, hipAMP19E, hipAMP19F, hipAMP19G, hipAMP19H, hipAMP19I, hipAMP19J, hipAMP19K, hipAMP19L, hipAMP19M, hipAMP19N, hipAMP19O, hipAMP19P, hipAMP19Q, hipAMP19R, hipAMP19S, and hipAMP19T were serially diluted with MHB medium to concentrations of 500 μg / mL, 250 μg / mL, 125 μg / mL, 62.50 μg / mL, 31.25 μg / mL, 15.63 μg / mL, 7.81 μg / mL, and 3.91 μg / mL, respectively. Each peptide was placed in a culture tube, labeled with its corresponding peptide number and concentration, and recorded as a concentration tube. Add an equal amount of Staphylococcus aureus ATCC25923 test bacterial solution to each concentration tube, incubate at 37℃ for 12 h, and observe bacterial growth.

[0057] Compared with control tubes containing only bacterial suspension and culture medium, but no peptides, the lowest peptide concentration tube that was completely clear and without turbidity was identified as the minimum inhibitory concentration (MIC). The results are shown in Table 1. Only the peptide hipAMP19 exhibited antibacterial activity; hipAMP19B to hipAMP19T showed no antibacterial activity against Staphylococcus aureus.

[0058] Table 1. Antibacterial activity and MIC results of the peptides against Staphylococcus aureus

[0059]

[0060] Through wet testing, a polypeptide with highly efficient antibacterial activity was finally identified and named antimicrobial peptide hipAMP19. It is a polypeptide composed of 16 amino acids, and the amino acid sequence is shown in SEQ ID NO.1.

[0061] SEQ ID NO. 1: DNKKRHYGMGVVGKWL.

[0062] Example 2: Preparation method of antimicrobial peptide hipAMP19

[0063] This embodiment describes a solid-phase synthesis method for the antimicrobial peptide hipAMP19, specifically including the following steps performed sequentially:

[0064] S1. Resin swelling and pretreatment: Weigh 0.1 mmol equivalent of Rink Amide MBHA resin into a solid-phase synthesis column, add 10 mL of dichloromethane (DCM) solution, and shake to swell for 30 min at room temperature. After removing the DCM, wash the resin three times with 10 mL of N,N-dimethylformamide (DMF).

[0065] S2. Removal of Fmoc protecting groups: Add 5 mL of DMF solution containing 20% ​​(v / v) piperidine to the reaction column, and shake at room temperature for 15 min to remove the Fmoc protecting groups on the resin. Discard the reaction solution and wash the resin 5 times with 10 mL of DMF.

[0066] S3. Amino acid coupling: Dissolve 0.4 mmol of Fmoc-amino acid monomer, 0.4 mmol of diisopropylcarbodiimide (DIC), and 0.4 mmol of Oxyma Pure in DMF. Activate at room temperature for 3 min, then add the activated solution to the reaction column and mix with the resin. Continue shaking at room temperature for 60 min. After the reaction, drain the coupling solution and wash the resin three times with DMF. After each round of coupling, sample the resin using ninhydrin or bromophenol blue detection to ensure complete reaction; if the test is positive, perform a second coupling.

[0067] S4. Cyclic synthesis: Repeat steps S2 and S3, sequentially linking each Fmoc-protected amino acid monomer according to the amino acid sequence from C-terminus to N-terminus of the antimicrobial peptide hipAMP19 shown in SEQ ID NO.1.

[0068] S5. Final Deprotection and Resin Cleavage: After all amino acid sequences were assembled, final Fmoc removal was performed. The resin was washed with DCM and dried under vacuum. A cleavage buffer was prepared by mixing trifluoroacetic acid (TFA), triisopropylsilane (TIS), and water in a volume ratio of 95:2.5:2.5. The dried resin was added to 10 mL of cooled cleavage buffer, and the reaction was carried out with shaking at room temperature for 3 h. After the reaction was completed, the mixture was filtered, and the filtrate (containing crude peptide) was collected and precipitated in cold diethyl ether. The white peptide precipitate was collected by centrifugation at 5000 rpm for 10 min at 4 °C.

[0069] S6. Crude Peptide Washing and Purification: The peptide precipitate was washed three times with cold anhydrous diethyl ether, collected by centrifugation, and vacuum dried to obtain the crude antimicrobial peptide hipAMP19. The crude product was dissolved in an acetonitrile / water solution containing 0.1% TFA and purified by semi-preparative reversed-phase high-performance liquid chromatography. Chromatographic conditions were: C 18The column was 4.6 × 250 mm × 5 μm; mobile phase A was 0.1% TFA aqueous solution, and mobile phase B was 0.1% TFA acetonitrile solution; the gradient elution program was: 20% B to 50% B, 30 min; 50% B to 100% B, 3 min; 100% B, hold for 5 min; 100% B to 20% B, 2 min; 20% B, hold for 10 min; the detection wavelength was 214 nm. The main peak fraction was collected, and after confirming a purity greater than 90% by analytical HPLC, the fractions were combined and lyophilized to obtain purified antimicrobial peptide hipAMP19 white powder. The HPLC chromatogram is shown below. Figure 1 As shown.

[0070] S7. Product Identification: The purified product was dissolved in a 15% (v / v) acetonitrile aqueous solution and identified by electrospray ionization mass spectrometry. The mass spectrometry analysis results are as follows: Figure 2 As shown, the theoretical molecular weight is [M+H]. + The theoretical value was 1888.22 Da, while the measured value was 1888.80 Da, consistent with the theoretical and measured results. The purity of the product was determined using analytical HPLC, and the results showed a purity of 90.30% (greater than 90%).

[0071] This embodiment successfully prepared the antimicrobial peptide hipAMP19 with high purity.

[0072] In other embodiments, the solid support is Rink amide MBHA resin or Wang resin; the coupling agent used in the coupling reaction is HBTU-HOBt-DIEA combined coupling agent, ATU-HOAt-DIEA combined coupling agent, or DIC-Oxyma Pure combined coupling agent. A piperidine N,N-dimethylformamide solution with a volume concentration of 23%, 25%, 28%, or 30% is used as the deprotection solution to remove the protecting groups of the amino acid monomers. A cleavage fluid is prepared by mixing trifluoroacetic acid, triisopropylsilane, and water in a volume ratio of 95:2.5:2.5, which is used to cleave the peptide chain and separate it from the solid support. Other preparation steps are the same as in Example 2, and the antimicrobial peptide can be obtained in all cases.

[0073] Example 3: Determination of the antibacterial effect of the antimicrobial peptide hipAMP19

[0074] The antimicrobial effects of the antimicrobial peptide hipAMP19 against Staphylococcus aureus, Bacillus subtilis, Listeria monocytogenes, Escherichia coli, Pseudomonas aeruginosa, and Salmonella were tested, and the minimum inhibitory concentration (MIC) was determined. Details are as follows:

[0075] (1) Experimental method for determining antibacterial rate

[0076] Six indicator bacteria—Staphylococcus aureus, Bacillus subtilis, Listeria monocytogenes, Escherichia coli, Pseudomonas aeruginosa, and Salmonella—which had been cultured overnight, were adjusted to a concentration of 1×10⁻⁶ using MHB liquid medium. 6 The working bacterial suspension was prepared at CFU / mL. Experimental groups were established in 96-well cell culture plates, including an experimental group, an indicator bacteria control group, and a blank control group. Each group had three replicate wells to ensure reproducibility. Specifically, 120 μg of lyophilized antimicrobial peptide hipAMP19 powder and MHB medium were used to prepare a 300 μL solution. In the experimental group, 100 μL of the working bacterial suspension and the hipAMP19 solution were added to each well to achieve a final hipAMP19 concentration of 200 μg / mL. In the indicator bacteria control group, 100 μL of the working bacterial suspension and 100 μL of MHB medium were added to each well. In the blank control group, 200 μL of sterile MHB medium was added to each well.

[0077] The 96-well plate was placed in a 37°C incubator and incubated statically for 18 h. After incubation, the absorbance (OD) of each well was measured at 600 nm using a microplate reader. 600 ).

[0078] The formula for calculating the antibacterial rate is as follows:

[0079] Antibacterial rate = [1- (OD)] 实验组 - OD 空白组 ) / (OD 指示菌对照组 - OD 空白组 )] × 100%.

[0080] (2) Method for determining the minimum inhibitory concentration

[0081] The lyophilized antimicrobial peptide hipAMP19 powder was prepared into a solution using MHB medium and then serially diluted to create concentration gradients of 500 μg / mL, 250 μg / mL, 125 μg / mL, 62.50 μg / mL, 31.25 μg / mL, 15.63 μg / mL, 7.81 μg / mL, and 3.91 μg / mL. Each solution was placed in a sterile tube, and an equal volume of working bacterial suspension was added to each tube. The tubes were thoroughly mixed and incubated at 35°C for 12 h, and bacterial growth was observed. The lowest peptide concentration in the tube, completely clear and without turbidity, was compared to a control tube containing only bacterial suspension and culture medium, and no visible peptide. This lowest peptide concentration was considered the minimum inhibitory concentration (MIC) of hipAMP19 against this bacterium.

[0082] The inhibition rates of the antimicrobial peptide hipAMP19 against six indicator bacteria at a concentration of 200 μg / mL and the minimum inhibitory concentrations (MICs) at different concentrations are summarized in Table 2. The inhibition rates of Staphylococcus aureus and Escherichia coli after treatment with different concentrations of hipAMP19 are shown in Table 2. Figure 3 and Figure 4 .

[0083] Table 2. Antibacterial effect of antimicrobial peptide hipAMP19

[0084]

[0085] Experimental results showed that the antimicrobial peptide hipAMP19 exhibited significant broad-spectrum inhibitory activity against a variety of tested Gram-positive and Gram-negative bacteria. At a concentration of 200 μg / mL, the antimicrobial peptide achieved an inhibition rate of over 85% against all tested strains, with particularly outstanding antimicrobial performance against Staphylococcus aureus, reaching a maximum inhibition rate of 96.7%. The minimum inhibitory concentration (MIC) determination further validated the highly efficient antimicrobial activity of the antimicrobial peptide hipAMP19.

[0086] Example 4: Construction of a polynucleotide encoding the antimicrobial peptide hipAMP19 and its expression vector

[0087] This embodiment provides the construction of a polynucleotide encoding the antimicrobial peptide hipAMP19 and its expression vector. Based on the amino acid sequence of the antimicrobial peptide hipAMP19, its encoding gene sequence was designed and chemically synthesized, named polynucleotide H1. Polynucleotide H1 was inserted into the multiple cloning site of the expression vector to construct a recombinant expression vector. Enzyme digestion and sequencing verification confirmed that the target gene was correctly inserted and maintained the correct reading frame.

[0088] In other embodiments, a polynucleotide H2 complementary to polynucleotide H1 was also synthesized, which can be used in genetic engineering experiments related to the antimicrobial peptide hipAMP19.

[0089] Example 5: Construction of genetically engineered bacteria expressing the antimicrobial peptide hipAMP19

[0090] This embodiment provides host cells expressing the antimicrobial peptide hipAMP19. The recombinant expression vector constructed in Example 4 was transformed into *E. coli* BL21(DE3) competent cells using a heat shock method. The transformed bacterial culture was plated on LB agar containing kanamycin (50 µg / mL) and incubated overnight at 37°C. Single colonies were picked for expansion culture, and colony PCR and enzyme digestion verification were performed, successfully obtaining genetically engineered bacteria containing the target expression vector.

[0091] Example 6: Application of antimicrobial peptide hipAMP19 in the preparation of antimicrobial sprays

[0092] This embodiment provides a specific application of the antimicrobial peptide hipAMP19 in the preparation of antimicrobial agents. 10 mg of the antimicrobial peptide hipAMP19 synthesized in Example 2 was weighed and dissolved in 10 mL of sterile phosphate buffer to prepare a 1 mg / mL peptide solution. 0.1 mL of Tween-80 was added to this solution as a dispersant, and sterile physiological saline was added to bring the volume to 100 mL. The solution was then filtered through a 0.22 µm filter membrane for sterilization to obtain an antimicrobial spray. This spray can be used for antimicrobial treatment of skin or environmental surfaces.

[0093] In other embodiments, the antimicrobial peptide hipAMP19 is formulated with pharmaceutical excipients into a lyophilized powder for injection, used to prepare formulations for treating bacterial infections. Alternatively, the antimicrobial peptide hipAMP19 is mixed with an ointment base to prepare a topical antimicrobial ointment for local antibacterial treatment of skin infections. The antimicrobial peptide hipAMP19 or its polynucleotides can also be used to prepare food preservatives or feed additives.

[0094] It should be noted that the above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any other way. Any person skilled in the art may use the above technical content as inspiration to make changes or modifications to equivalent embodiments. However, any simple modifications, equivalent changes and modifications made to the above embodiments without departing from the technical essence of the claims of the present invention shall still fall within the scope of protection of the claims of the present invention.

Claims

1. An antimicrobial peptide, hipAMP19, characterized in that, The amino acid sequence is shown in SEQ ID NO.

1.

2. A polynucleotide, characterized in that, The polynucleotide is a polynucleotide H1 encoding the antimicrobial peptide hipAMP19 as described in claim 1, or a polynucleotide H2 complementary to the polynucleotide H1.

3. An expression carrier, characterized in that, It contains the polynucleotide described in claim 2.

4. A host cell, characterized in that, It contains the expression vector as described in claim 3.

5. The use of the antimicrobial peptide hipAMP19 of claim 1 or the polynucleotide of claim 2 in the preparation of antimicrobial agents, antibacterial drugs, food preservatives or feed additives.

6. The application according to claim 5, characterized in that, The antibacterial agents, antibacterial drugs, food preservatives, or feed additives are used to inhibit the growth of Gram-positive or Gram-negative bacteria. The Gram-positive bacteria include Staphylococcus aureus, Bacillus subtilis, and Listeria. The Gram-negative bacteria include Escherichia coli, Pseudomonas aeruginosa, and Salmonella.

7. An antibacterial agent, characterized in that, The antimicrobial agent contains the antimicrobial peptide hipAMP19 and is available as an injection, ointment, spray, or drop.

8. A method for preparing the antimicrobial peptide hipAMP19 according to claim 1, characterized in that, Following the amino acid sequence shown in SEQ ID NO.1, amino acid monomers with protecting groups on the amino group were coupled to a solid support via a coupling reaction. The protecting groups on the amino acid monomers were removed to expose the free amino groups. The amino acid monomers were then sequentially coupled via a coupling reaction to synthesize a peptide chain. The peptide chain was then separated from the solid support and purified to obtain the antimicrobial peptide hipAMP19.

9. The method for preparing the antimicrobial peptide hipAMP19 according to claim 8, characterized in that, The protecting group is an Fmoc protecting group; The solid support is Rink amide MBHA resin or Wang resin. The coupling reaction uses HBTU-HOBt-DIEA combined coupling agent, ATU-HOAt-DIEA combined coupling agent, or DIC-Oxyma Pure combined coupling agent.

10. The method for preparing the antimicrobial peptide hipAMP19 according to claim 8 or 9, characterized in that, The protecting groups of amino acid monomers are removed using a descaling solution, wherein the descaling solution is a 20%~30% (v / v) N,N-dimethylformamide solution of piperidine. A cleavage fluid is used to separate the peptide chain from the solid support. The cleavage fluid is prepared by mixing trifluoroacetic acid, triisopropylsilane and water in a volume ratio of 95:2.5:2.5.

Images