Sense strand sORF10 small protein and its application in prevention and treatment of wheat basal stem rot

Abstract

The application discloses a positive strand sORF10 small protein and application thereof in prevention and treatment of wheat stem base rot, and belongs to the field of agricultural biotechnology and biological control of plant diseases. The positive strand sORF10 small protein is a small protein coded by a positive strand, which is identified and separated from a Fusarium graminearum virus FgV1-DK21 genome. The amino acid sequence of the small protein is shown as SEQ ID NO. 1. The coding gene of the small protein is unique to a strong strain, and the corresponding nucleic acid sequence is deleted in a weak strain FgV1-ch. Overexpression of the positive strand sORF10 can significantly inhibit the vegetative growth of the Fusarium graminearum, and the colony diameter is reduced and the aerial hypha is sparse. Greenhouse tests show that after the chemical synthesis of the positive strand sORF10 small protein is applied by root irrigation, the length of the wheat stem base browning is significantly reduced. The application can be applied to construction of a weak Fusarium graminearum engineering strain or preparation of a biological pesticide for preventing and treating wheat stem base rot, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the fields of agricultural biotechnology and biological control of plant diseases, and in particular to the positive-sense chain sORF10 (+sORF10) small protein and its application in the control of wheat stem base disease. Background Technology

[0002] Fusarium graminearum ( Fusarium graminearum Fusarium graminearum is a highly destructive plant pathogen, a major cause of both Fusarium head blight (FBB) and Fusarium crown rot. Currently, FBB control relies primarily on chemical agents; however, long-term, large-scale application has led to resistance in Fusarium graminearum to commonly used fungicides such as carbendazim. Furthermore, some agents, at sub-lethal concentrations, can even induce the fungus to synthesize more mycotoxins, exacerbating food safety risks. Simultaneously, Fusarium graminearum can also infect the base of wheat stems, causing stem rot, resulting in premature aging and whiteheads, and in severe years, yield losses can reach 20%–50%. Although integrated management measures such as chemical control and crop rotation are employed in production, their effectiveness in preventing stem rot caused by this fungus is limited. Therefore, there is an urgent need to develop novel, green control strategies based on the pathogenic mechanism of Fusarium graminearum.

[0003] Mycoviruses, as a natural biocontrol resource, offer a new approach to the green control of fungal diseases. Among them, Fusarium graminearum virus 1 (FgV1) has been reported to include a virulent strain from South Korea, FgV1-DK21, which causes severe decline in pathogenicity in its host, and a weakly virulent strain from China, FgV1-ch, which causes asymptomatic infection. Utilizing attenuated or infected strains for biocontrol is a traditional strategy, but this strategy faces two major bottlenecks: first, vegetative incompatibility (VIC) of fungi limits the horizontal transmission of the virus between different strains; second, attenuated strains are prone to virus loss during field propagation, leading to unstable control effects.

[0004] Therefore, the key to overcoming the aforementioned bottlenecks lies in crossing the barrier of live bacterial strains, directly identifying key symptom-manifesting factors of viruses, and developing them into molecular biocontrol tools. In the field of fungal virus research, specific proteins encoded by viruses are often key factors mediating abnormal host phenotypes and decreased virulence. For example, when the p29 protein encoded by the attenuated virus CHV1 is expressed alone in *Phytophthora chinensis*, it is sufficient to induce typical symptom-manifesting phenotypes such as reduced pigment deposition and decreased sporulation; overexpression of the ORF3 protein encoded by the *S. sylvatica* virus SlMV1 leads to almost complete loss of host pigment and pathogenicity. However, there are currently no reports on whether small proteins encoded by potential small open reading frames (sORFs) in the FgV1-DK21 genome, excluding the four known main ORFs (the four large ORFs do not have the function of inhibiting Fusarium growth), have symptom-manifesting functions. Summary of the Invention

[0005] The purpose of this invention is to provide a positive-strand sORF10 small protein and its application in the control of wheat stem base rot, thereby solving the problems existing in the prior art. This invention provides a positive-strand sORF10 small protein derived from Fusarium graminearum virus FgV1-DK21. This small protein can significantly inhibit the growth of Fusarium graminearum and reduce its pathogenicity. After chemical synthesis, direct application shows excellent control efficacy against wheat stem base rot and can be used as a protein-based biological pesticide for the green control of fungal diseases.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides the application of the positive-strand sORF10 small protein in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease; By increasing the expression level of the positive-strand sORF10 small protein, Fusarium graminearum can be inhibited and wheat stem base disease can be prevented. The amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.1.

[0007] Furthermore, in this invention, the amino acid sequence of the positive chain sORF10 small protein is not limited to the amino acid shown in SEQ ID NO.1 in the examples, but also includes functional variants or conserved modified variants that have at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO.1 and have inhibitory activity against Fusarium graminearum growth.

[0008] This invention also provides the use of the nucleic acid molecule encoding the positive-strand sORF10 small protein in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease.

[0009] Furthermore, in the embodiments of the present invention, the above-mentioned nucleic acid molecules are illustrated using the sequence shown in SEQ ID NO.2 as an example. However, the present invention is not limited to this nucleotide sequence, but also includes nucleotide sequences that have at least 95% sequence identity with the nucleotide sequence shown in SEQ ID NO.2 and encode a small protein that has inhibitory activity against the growth of Fusarium graminearum.

[0010] The present invention also provides the use of a heavy-load vector containing a nucleic acid molecule encoding the said positive-strand sORF10 small protein in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease.

[0011] Furthermore, in this invention, the recombinant vector contains the aforementioned nucleotide sequence and a regulatory element operatively linked to the nucleotide sequence; the regulatory element includes a promoter, a terminator, and a selection marker gene. Preferably, the promoter is the fungal strong promoter RP27; the selection marker gene is the G418 resistance gene or the hygromycin resistance gene.

[0012] The recombinant vector also includes a tag protein fused to the N-terminus of the positive-strand sORF10 small protein, wherein the tag protein is selected from Flag tag, His tag, GFP tag or HA tag.

[0013] The present invention also provides the use of recombinant bacteria containing nucleic acid molecules encoding the positive-strand sORF10 small protein in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease.

[0014] The present invention also provides a biopesticide comprising a positive-strand sORF10 small protein, the amino acid sequence of which is shown in SEQ ID NO.1.

[0015] The present invention also provides a method for constructing a virulent transgenic Fusarium graminearum, comprising overexpressing a nucleic acid molecule encoding a positive-strand sORF10 small protein in Fusarium graminearum to obtain a virulent transgenic Fusarium graminearum; wherein the amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.1.

[0016] Preferably, the overexpression method includes: The nucleic acid molecule encoding the positive-sense strand sORF10 small protein was cloned into an expression vector to obtain a recombinant expression vector; The recombinant expression vector was transformed into Fusarium graminearum to obtain transformants that overexpressed nucleic acid molecules encoding the positive-sense strand sORF10 small protein; Transformants with inhibited growth and sparse aerial hyphae were selected as attenuated transgenic Fusarium graminearum.

[0017] The present invention also provides a virulent transgenic Fusarium graminearum, which is constructed using the aforementioned construction method.

[0018] The present invention also provides a method for inhibiting Fusarium graminearum, comprising the step of overexpressing a nucleic acid molecule encoding a positive-strand sORF10 small protein in Fusarium graminearum; wherein the amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.1.

[0019] The present invention also provides a method for preventing and controlling wheat stem base disease, comprising the step of applying the positive-strand sORF10 small protein to wheat or its growth environment; wherein the amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.1. Further, the application methods include, but are not limited to, root irrigation, seed dressing, seed soaking, or spraying.

[0020] The present invention discloses the following technical effects: This invention is the first to identify the +sORF10 small protein from the FgV1-DK21 genome as a key factor leading to symptomatic phenotypes such as growth inhibition and sparse aerial hyphae in the host fungus. This discovery fills a gap in the study of the symptomatic mechanism of FgV1-DK21.

[0021] This invention does not rely on intact live viruses or virus-carrying strains, but directly utilizes a small protein derived from a virus and its encoding gene, effectively avoiding the limitations of fungal vegetative incompatibility and the easy loss of viruses. The +sORF10 small protein and its encoding gene of this invention can be used in various scenarios such as constructing attenuated engineered strains, developing nucleic acid-based biopesticides, and as a molecular marker-assisted breeding tool. This invention further demonstrates that when the +sORF10 small protein obtained through chemical synthesis is applied as a root irrigation after wheat emergence, the length of browning at the base of the wheat stem is reduced by 90.0% compared to the control group, indicating that this small protein can be directly used as a protein-based biopesticide with the advantages of simplicity, high efficiency, and stability. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 Distribution of sORFs encoded by the FgV1-DK21 genome; (A) Distribution of 20 sORFs on the positive and negative strands, where "+" represents the positive strand of the genome and "-" represents the negative strand of the genome; (B) Specific locations and molecular weights of the 20 sORFs on the genome; Figure 2 A schematic diagram of the construction of the pGTN-sORF10 overexpression vector and the vector construction process; (A) Schematic diagram of the construction of the pGTN-sORF overexpression vector; (B) Results of double enzyme digestion detection of 20 sORF-specific fragments with pGTN vector; (C) PCR detection results of bacterial cultures of recombinant plasmids constructed with pGTN vector from 20 sORFs; M: DNA marker; Figure 3 Phenotypic and expression level analysis of +sORF10 overexpressing strains; (A) Colony morphology of wild-type PH-1 and +sORF10 transformants (+sORF10 10⁻⁸, +sORF10 10⁻⁹) after 5 days of culture on PDA plates; (B) Statistical comparison of colony growth rates of transformed strains; (C) qRT-PCR analysis of the relative expression level of the +sORF10 gene in +sORF10 transformants; Figure 4To assess the control effect of +sORF10 on wheat stem base rot; (A) Browning and rotting of wheat stem base after +sORF10 application, with the wheat seedlings on the left being the blank control and the wheat seedlings on the right being the +sORF10 application group; (B) Statistical analysis results of the length of browning at the wheat stem base after +sORF10 application; CK is the blank control group, and sORF10 is the group treated with +sORF10 small protein. Detailed Implementation

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0028] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0029] The following examples involve culture media: (1) LB medium: 10 g tryptone, 5 g yeast extract, 10 g sodium chloride, add water to 1000 mL, autoclave at 121℃ for 15 min.

[0030] (2) Potato glucose agar medium (PDA medium): Cut 200 g of potatoes into small pieces and put them in a pot. Add 1000 mL of water and heat to boiling. Maintain boiling for 30 min. Filter with two layers of gauze. Add 20 g of glucose and 20 g of agar to the filtrate and add water to 1000 mL. Autoclave at 121℃ for 15 min.

[0031] (3) CMC culture medium: 15 g sodium carboxymethyl cellulose, 1 g yeast extract, 2 g sodium nitrate (NaNO3), 1 g potassium dihydrogen phosphate (KH2PO4), 0.5 g magnesium sulfate heptahydrate (MgSO4·7H2O), dissolved in 900 mL ddH2O, brought to a final volume of 1 L and then autoclaved.

[0032] (4) YEPD medium: 3 g yeast extract, 10 g peptone, 20 g glucose, dissolved in 900 mL ddH2O, brought to a final volume of 1 L and then autoclaved.

[0033] (5) STC Buffer: Weigh 200 g of sucrose and 11 g of calcium chloride (CaCl2); add 100 ml of 1 M Tris-HCl (pH 8.0), dissolve in 800 ml of ddH2O, bring the volume up to 1 L, and then autoclave.

[0034] (6) PTC Buffer: Weigh 40 g of PEG 4000, add STC Buffer to 100 mL, heat to dissolve, filter with a 0.22 μm filter for sterilization, and prepare fresh before use.

[0035] (7) TB3 regeneration medium: Take 3 g of yeast extract, 3 g of casein amino acids, and 200 g of sucrose, dissolve them in 900 ml of ddH2O, and then bring the volume to 1 L. Add 15 g of agar powder per liter of solid medium and autoclave.

[0036] Example 1: Bioinformatics prediction of +sORF10 in the FgV1-DK21 genome Using NCBI's ORFfinder analysis tool (https: / / www.ncbi.nlm.nih.gov / orffinder / ), comprehensive sORF prediction was performed on the positive strand (+) of the full-length FgV1-DK21 genome sequence (GenBank accession number: NC_006937). Prediction parameters were set as follows: minimum ORF length of 30 codons, start codon of ATG, and standard genetic code table.

[0037] Prediction results show that multiple potential sORFs exist in the FgV1-DK21 genome. Figure 1After comprehensive analysis and screening, +sORF10 was selected as a candidate for in-depth study. +sORF10 is located in a specific segment of the viral genome, encoding a small protein composed of 32 amino acids with a predicted molecular weight of 3.4 kDa. Its amino acid sequence is shown in SEQ ID NO.1.

[0038] SEQ ID NO.1 (amino acid sequence of the +sORF10 small protein): MCRGAQREHPGVCILPARSGQATRSPQSRGLS*.

[0039] SEQ ID NO.2 (nucleotide sequence of the gene encoded by +sORF10): ATGTGCAGAGGTGCGCAGAGAGAACACCCGGGAGTATGCATACTCCCTGCTCGAAGTGGCCAAGCGACGAGATCCCCGCAATCACGTGGGTTATCGTGA.

[0040] Example 2: Construction of +sORF10 overexpression vector 1. Primer design Based on the genomic sequence of +sORF10, specific amplification primers were designed. Protective bases, an XhoI restriction site, a 1×Flag tag sequence (ATGGATTACAAGGACGACGATGACAAG, SEQ ID NO.5), and a flexible linker peptide (Gly4Ser1, SEQ ID NO.6) were sequentially introduced at the 5' end of the forward primer (+sORF10-F), followed by the +sORF10 specific sequence. The reverse primer (+sORF10-R) contained a NotI restriction site and protective bases (…). Figure 2 (A)

[0041] +sORF10-F: CCCTCGAGATGGATTACAAGGACGACGATGACAAGGGTGGCGGTGGCTCTTGCAGAGGTGCGCAGAG (SEQ ID NO.3) +sORF10-R:ATAAGAATGCGGCCGCTCACGATAACCCACGTGATTG (SEQ ID NO.4) 2. PCR amplification Using plasmid pGTN-DK21 containing the full-length cDNA of FgV1-DK21 virus as a template, high-fidelity PCR amplification was performed using the primers described above. The reaction mixture (50 μL) consisted of: 25 μL 2×Gloria Nova HS Master Mix, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 1 μL template DNA, and ddH2O to a final volume of 50 μL. Reaction conditions were: 98℃ pre-denaturation for 45 s; 98℃ denaturation for 10 s, 60℃ annealing for 30 s, and 72℃ extension for 15 s, for a total of 35 cycles; and a final extension at 72℃ for 5 min. The PCR product was detected by 1% agarose gel electrophoresis, and the target band of approximately 150 bp was recovered. Figure 2 (B)

[0042] 3. Vector digestion and ligation The pGTN plasmid was selected (refer to Wang Y, Chen W, Zhang L, et al. Methylation of mycovirus DNA is mediated by the RNAi machinery in vegetative hyphaeof). Fusarium graminearum The pGTN plasmid was used as the basic expression vector and double-digested with XhoI and NotI. The digestion system (50 μL) consisted of: 2 μg pGTN plasmid, 5 μL 10×Cut Smart Buffer, 1 μL XhoI, 1 μL NotI, and ddH2O to a final volume of 50 μL. The mixture was incubated at 37°C for 3 h. After gel purification, the digested products were ligated with the PCR products using T4 DNA ligase for recombination.

[0043] 4. Conversion and Screening The ligation product was transformed into *E. coli* Trelief 5α competent cells, plated on LB agar plates containing ampicillin, and incubated overnight at 37°C inverted position. Single colonies were picked for colony PCR detection. Figure 2 (C). Positive clones were sent for sequencing verification, and the recombinant plasmid with correct sequencing results was named pGTN-sORF10.

[0044] In addition, this invention uses the same method to design specific amplification primers (Table 1) to amplify, detect, and recover 19 other sORFs (detection results are shown in Table 1). Figure 1 (B) and then ligated them with pGTN to construct recombinant plasmids. The results are shown in […]. Figure 2 C.

[0045] Table 1 Primers used for constructing sORF overexpression vectors Example 3: PEG-mediated protoplast transformation of Fusarium graminearum 1. Preparation of protoplasts Wild-type strain PH-1 of *Fusarium graminearum* was inoculated onto PDA plates and cultured at 25°C for 3 days. Mycelial blocks were picked up with sterile toothpicks and inoculated into CMC liquid medium, then cultured at 25°C with shaking at 180 rpm for 5 days to induce conidia. Conidia were collected by aseptic filtration and the concentration was adjusted to 10-1. 7 1 mL of spore suspension was inoculated into 50 mL of YEPD liquid medium and cultured overnight at 25°C and 180 rpm with shaking. The young mycelia were collected by filtration and washed with 1.2 M KCl.

[0046] Weigh 0.15 g of lysozyme (Solepro, C8100), 0.1 g of lysozyme (Solepro, L8140), and 0.1 g of snailase (Solepro, S8280), dissolve them in 10 mL of 1.2 M KCl solution, and treat at 28℃ and 90 rpm for 1.5 h. Filter to remove bacteria to obtain the enzymatic hydrolysate. Add mycelia to the hydrolysate and incubate at 28℃ and 90 rpm for 3-4 h. Observe the release of protoplasts under a microscope. Filter through double-layered lens paper, centrifuge at 4℃ and 5000 rpm for 10 min to collect the protoplasts, resuspend in STC buffer, and adjust the concentration to 3 × 10⁻⁶. 7 Protoplasts were obtained at a concentration of 1 per mL for a protoplast suspension, which was then set aside for later use.

[0047] 2. Transformation Place 400 μL of protoplast suspension on ice, add 20 μg of pGTN-sORF10 plasmid, mix gently, and incubate on ice for 20 min. Slowly add 2 mL of PTC Buffer and incubate at room temperature for 20 min. Add 5 mL of TB3 liquid resuscitation medium (containing 50 μg / mL ampicillin) and incubate at 25°C with gentle shaking for 14 h.

[0048] After melting TB3 solid medium and cooling it to approximately 48°C, add ampicillin to a concentration of 50 μg / mL and genimycin G418 to a concentration of 150 μg / mL. Mix with the resuscitation and transformation solution, pour into plates, allow to solidify, then add 15 mL of the upper layer of TB3 solid medium (containing 50 μg / mL ampicillin and 300 μg / mL G418), and incubate in the dark at 25°C.

[0049] 3. Screening and validation of transformants Transformants grown on 300 μg / mL G418 plates were selected and transferred to antibiotic-free PDA medium. Genomic DNA was extracted from the transformants using the CTAB method for PCR verification. Positive transformants were purified by single-spore extraction to obtain genetically stable +sORF10 overexpression transformants.

[0050] Example 4: Phenotypic analysis of +sORF10 overexpression transformants 1. Colony morphology observation Wild-type strain PH-1 and two +sORF10 overexpression transformants (+sORF10 10⁻⁸ and +sORF10 10⁻⁹) were inoculated into the center of PDA plates and incubated at 25°C for 5 days. Colony morphology was then observed. The results showed that, compared to PH-1, the +sORF10 overexpression transformants (+sORF10 10⁻⁸ and +sORF10 10⁻⁹) exhibited significantly abnormal mycelial growth, slow growth, and sparse aerial hyphae. Figure 3 (A)

[0051] 2. Growth rate measurement The colony diameter of each strain was measured using the cross-multiplication method, and the growth rate was calculated. The results showed that the colony growth rates of the +sORF10 overexpression transformants (+sORF10 10⁻⁸, +sORF10 10⁻⁹) were significantly lower than those of the wild-type PH-1 and the GFP control (P < 0.05). Figure 3 (B)

[0052] 3. RT-qPCR detection + sORF10 expression level Total RNA was extracted from each transformant using the TRIzol method, and cDNA was synthesized by reverse transcription. qPCR was performed using the +sORF10 specific primers (+sORF10-qF / R) for detection. Actin The gene was used as an internal control. Results showed that in strains with severe phenotypic defects, the relative expression levels were 5 to 15 times higher than the baseline. Figure 3 (C). This indicates that the degree of phenotypic variation in transformants is highly positively correlated with the transcriptional expression level of the +sORF10 gene.

[0053] Table 2 qPCR detection primers Example 5: Deletion analysis of the +sORF10 sequence in the attenuated strain FgV1-ch The whole genome sequence of the attenuated strain FgV1-ch was analyzed and compared with that of the virulent strain FgV1-DK21. Sequence alignment results showed that the FgV1-ch genome lacked a coding sequence corresponding to +sORF10, which is one of the significant differences between the two viruses at the ORF level. This result further confirms that +sORF10 is a key symptom-manifesting factor specific to FgV1-DK21.

[0054] Example 6: Greenhouse control efficacy of chemically synthesized sORF10 small protein against wheat stem rot To evaluate the direct control effect of +sORF10 small protein on wheat stem base rot, GenScript Biotech Co., Ltd. was commissioned to chemically synthesize +sORF10 small protein (purity ≥95%), and pot efficacy test was conducted under greenhouse conditions.

[0055] 1. Experimental Materials and Methods The wheat variety used in the experiment was Jimai 22. Fusarium graminearum was artificially prepared. Fusarium graminearum Infected soil: Fusarium graminearum colonies cultured in millet culture medium were mixed with sterilized soil at a ratio of 1:5 (w / w) to obtain infected millet soil. Wheat seeds were surface sterilized with 1% sodium hypochlorite for 10 min, rinsed three times with sterile water, and then sown in plastic pots (20 cm in diameter and 25 cm in height) containing sterilized nutrient soil (soil-to-sand volume ratio 3:1), with 10 seeds sown per pot and covered with soil to a depth of 2 cm. The infected millet soil (approximately 50 g per pot) was evenly distributed on the surface of the potting soil to simulate field pathogen infection.

[0056] The test protein was a chemically synthesized +sORF10 small protein (synthesized by Genscript Biotech Co., Ltd.), dissolved and diluted with sterile water to a working concentration of 100 μg / mL. An equal volume of sterile water served as a blank control. After wheat emergence, each treatment group received 20 mL of the +sORF10 small protein solution (100 μg / mL) as a root drenching treatment, while the control group received an equal volume of sterile water. Each treatment was replicated in 5 pots and cultured in a 25℃ light incubator with a 12 h / d photoperiod. Routine management continued after application, maintaining soil moisture at approximately 60%. Five days after application, stem base tissue was collected to observe and analyze the occurrence of browning at the stem base. Plants with obvious browning lesions at the stem base were considered diseased, and the length of browning at the stem base was recorded for each treatment group.

[0057] Browning length reduction rate (%) = (browning length of control group - browning length of treatment group) / browning length of control group × 100%.

[0058] 2. Results like Figure 4 As shown, severe browning occurred at the base of the wheat stems in the blank control group. Figure 4In the control group (A), the browning length of the coleoptile reached 85.6%. However, the browning length at the base of the wheat stem was significantly reduced to 8.6% in the +sORF10 small protein treatment group, a 90.0% decrease compared to the control group. Figure 4 (B) indicates that the chemically synthesized +sORF10 small protein has excellent control effect on wheat stem base rot.

[0059] The above results indicate that the chemically synthesized +sORF10 small protein can significantly reduce the length of wheat stem base browning under greenhouse conditions, by 90.0% compared to the control group, and can be directly used as a protein-based biological pesticide for the green control of wheat stem base rot.

[0060] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of the sORF10 small protein in the positive strand in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease; By increasing the expression level of the positive-strand sORF10 small protein, Fusarium graminearum can be inhibited and wheat stem base disease can be prevented. The amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.

1.

2. The use of the nucleic acid molecule encoding the positive-strand sORF10 small protein of claim 1 in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease.

3. The use of a heavy-load vector containing a nucleic acid molecule encoding the positive-strand sORF10 small protein of claim 1 in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease.

4. The use of a recombinant bacterium containing a nucleic acid molecule encoding the positive-strand sORF10 small protein as described in claim 1 in any of the following: (1) Application in inhibiting Fusarium graminearum; (2) Application in the prevention and control of wheat stem base disease; (3) Application in the construction of attenuated transgenic Fusarium graminearum; (4) Application in the preparation of biological pesticides for inhibiting Fusarium graminearum and / or controlling wheat stem base disease.

5. A biological pesticide, characterized in that, It contains a positive-strand sORF10 small protein, the amino acid sequence of which is shown in SEQ ID NO.

1.

6. A method for constructing a transgenic attenuated Fusarium graminearum, characterized in that, The invention comprises overexpressing a nucleic acid molecule encoding the positive-strand sORF10 small protein in Fusarium graminearum to obtain a virulent transgenic Fusarium graminearum; wherein the amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.

1.

7. The construction method as described in claim 6, characterized in that, The overexpression method includes: The nucleic acid molecule encoding the positive-sense strand sORF10 small protein was cloned into an expression vector to obtain a recombinant expression vector; The recombinant expression vector was transformed into Fusarium graminearum to obtain transformants that overexpressed nucleic acid molecules encoding the positive-sense strand sORF10 small protein; Transformants with inhibited growth and sparse aerial hyphae were selected as attenuated transgenic Fusarium graminearum.

8. A transgenic, attenuated Fusarium graminearum, characterized in that, It is constructed using the construction method described in claim 6 or 7.

9. A method for inhibiting Fusarium graminearum, characterized in that, The method includes the step of overexpressing a nucleic acid molecule encoding a positive-strand sORF10 small protein in Fusarium graminearum; wherein the amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.

1.

10. A method for preventing and controlling wheat stem base disease, characterized in that, The method includes the step of applying the positive-strand sORF10 small protein to wheat or its growth environment; wherein the amino acid sequence of the positive-strand sORF10 small protein is shown in SEQ ID NO.1.

Images