A recombinant human collagen type III and a method for preparing the same

Abstract

The application discloses a kind of recombinant human type III collagen and preparation method thereof, belong to biomedical technology field.Type III collagen is an important structural protein, mainly used for medical beauty filling and medical instrument field, market demand is larger.Based on this, the application provides a kind of biosynthesis method of collagen protein, after the optimization and screening of nucleotide sequence, expression vector and host cell of coding type III collagen, the inventor finds that, compared with conventional CHO cell, select HEK293 cell as host cell, and the expression system protein expression amount is highest with the sequence shown in SEQ ID NO.4 as coding gene construction, the conformation of obtained recombinant human type III collagen is close to natural human type III collagen, and the proportion of proline hydroxylation of protein molecule is significantly better than existing level.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a recombinant human type III collagen and its preparation method. Background Technology

[0002] Collagen is an essential natural protein for connective tissue, accounting for 25-30% of the total protein content. Collagen can be classified into several types, including Type I, Type II, Type III, and Type IV collagen. Currently, commercially available collagen mainly includes Type I and Type III, with Type III collagen primarily used in cosmetic fillers and medical devices.

[0003] Type III collagen is an important structural protein, classified as one of the main fibrous collagens, accounting for about 5-20% of the total collagen content in the human body. It consists of three identical α1 chains, encoded by the COL3A1 gene, and is in the form of a loose, fine filamentous network. It is mainly found in tissues such as blood vessels, internal organs, and muscles, providing elasticity and stress resistance to the skin and playing a role in promoting repair and elasticity.

[0004] The raw materials for collagen products on the market are mainly extracted from the connective tissues of animals such as pigs, cattle, and fish using acid, alkali, and enzymatic methods. However, extracting collagen from animals carries certain risks of viral infection, human rejection reactions, and damage to the collagen structure during extraction, leading to reduced efficacy and poor stability. Compared to traditional animal collagen, recombinant collagen prepared through a microbial fermentation system has the characteristics of being free of viral risks, having excellent biocompatibility and efficacy, and low immunogenicity. It effectively avoids the viral risks and rejection reactions of traditional animal-derived collagen and overcomes the drawbacks of traditional animal collagen, such as uncertain clinical efficacy and unstable quality of end products due to differences in animal age and species.

[0005] However, the technical challenge in the field of collagen microbial synthesis lies in the fact that collagen has a unique triple helix structure, which is composed of three α chains wound in a right-handed helix. A significant feature of its primary structure is the presence of large amounts of glycine (about 1 / 3) and proline, forming a characteristic (Gly-XY) structure. n The repetitive sequences, where X is often proline and Y is often hydroxyproline, form the basis for the stable triple helix structure of collagen. The biological activity of collagen is highly dependent on its complex post-translational modifications, mainly including the hydroxylation and glycosylation of proline and lysine. Proline 4-hydroxylase catalyzes the hydroxylation of proline residues at the Y position, a process crucial for the stability of the triple helix structure at physiological temperatures.

[0006] Collagen biosynthesis is a highly complex process involving multiple key post-translational modification systems. Proline 4-hydroxylase is one of the most important enzymes involved, catalyzing the hydroxylation of proline residues, which requires α-ketoglutarate, O2, and Fe. 2+ Collagen synthesis also requires the participation of cofactors such as ascorbic acid. Besides proline 4-hydroxylase, prolyl 3-hydroxylase and lysine hydroxylase are also necessary. Prolyl 3-hydroxylase catalyzes the hydroxylation of proline residues at the 3-position, a process that requires the presence of the Pro-Hyp-Gly sequence. Lysine hydroxylase catalyzes the hydroxylation of lysine residues, a prerequisite for subsequent glycosylation modifications, and has a significant impact on collagen cross-linking and stability.

[0007] Glycosylation modifications of collagen mainly occur on hydroxylysine residues, forming galactosylhydroxylysine and glucosylgalactosylhydroxylysine. These glycosylation modifications not only affect the structural stability of collagen but also participate in biological functions such as cell adhesion and signal transduction. Studies have shown that abnormal glycosylation modifications can lead to collagen functional defects, affecting normal tissue development and repair.

[0008] The most fundamental problem facing prokaryotic cells in expressing collagen is the lack of a post-translational modification system unique to eukaryotes. Prokaryotes such as Escherichia coli lack organelles such as the endoplasmic reticulum and Golgi apparatus, making it impossible to perform the key modifications required for collagen synthesis, especially the hydroxylation of proline and lysine. This modification deficiency prevents the expressed collagen from forming a stable triple helix structure, severely affecting its biological function.

[0009] The modification systems lacking in prokaryotic cells mainly include proline 4-hydroxylase, prolyl 3-hydroxylase, lysine hydroxylase, and related glycosyltransferases. These enzymes not only require specific subcellular localization environments but also depend on complex cofactor systems. For example, proline 4-hydroxylase requires α-ketoglutarate, O2, and Fe. 2+ The involvement of ascorbic acid and prokaryotic cells is crucial, but prokaryotic cells cannot provide the correct concentration and localization of these factors. Studies have shown that even the addition of hydroxyproline to the culture medium cannot completely solve this problem, because hydroxyproline can appear at either the X or Y position of the Gly-XY sequence, while in natural collagen, hydroxyproline is mainly located at the Y position. This positional difference affects the stability of collagen.

[0010] To solve the aforementioned production challenges of type III collagen, this invention provides the following technical solution to obtain recombinant human type III collagen that more closely approximates the natural conformation (including triple helix characteristics and the hydroxyproline ratio of protein molecules). Summary of the Invention

[0011] One object of the present invention is to provide recombinant human type III collagen and a method for preparing the same; another object of the present invention is to provide biomaterials for preparing said recombinant human type III collagen, including nucleotides, expression vectors and recombinant cells; a further object of the present invention is to provide the use of said recombinant human type III collagen in the preparation of biomedical materials.

[0012] In a first aspect, the present invention provides a method for preparing recombinant human type III collagen, comprising:

[0013] 1) DNA encoding type III collagen was introduced into a vector to construct a recombinant expression vector;

[0014] 2) Transform or transfect host cells to obtain recombinant cells;

[0015] 3) Cultivate or develop the recombinant cells, and isolate and purify type III collagen with a triple helix structure from the cells or culture supernatant.

[0016] The DNA encoding type III collagen is selected from at least one of the following DNA types:

[0017] a) Any DNA in the nucleotide sequence shown in SEQ ID NO. 1, 2, 3 or 4;

[0018] b) DNA that hybridizes under strict conditions with any of the nucleotide sequences shown in SEQ ID NO. 1, 2, 3 or 4.

[0019] The recombinant human type III collagen is human type III collagen or a portion thereof.

[0020] In a preferred embodiment of the present invention, the DNA encoding type III collagen is the nucleotide sequence shown in SEQ ID NO.4.

[0021] In some embodiments of the present invention, the vector for introducing DNA encoding type III collagen is pCHO-GS, the structure of which is as follows: Figure 1 As shown, its nucleotide sequence is shown in SEQ ID NO.9.

[0022] In step 2), the host cell is selected from eukaryotic cells or prokaryotic cells. The eukaryotic cells are preferably CHO cells, yeast cells, HEK293, BHK-21, C127, MDCK, NAMALWA, SP2 / 0, or COS. The yeast cells are more preferably Pichia pastoris and Saccharomyces cerevisiae. The prokaryotic cells are preferably Escherichia coli cells. The Escherichia coli cells are preferably BL21(DE3), BL21(DE3)pLysS, BL21 Star(DE3), VERO, BL21-CodonPlus(DE3)-RIPL, Rosetta 2(DE3), or Rosetta 2(DE3)pLysS.

[0023] In a preferred embodiment of the present invention, the host cell is a CHO cell or a HEK293 cell; more preferably, the host cell is a HEK293 cell.

[0024] In a specific embodiment of the present invention, the separation and purification described in step 3) includes the following steps:

[0025] 3.1) Use an ultrafiltration membrane to concentrate the sample to 1 / 2-1 / 3 of its original volume. At room temperature, use pepsin to digest the concentrated sample. Stop the digestion after 2-3 hours and use a deep filtration membrane for clarification filtration.

[0026] 3.2) The sample obtained in step 3.1) was crudely purified using MMC chromatography;

[0027] 3.3) The sample obtained in step 3.2) was purified by hydrophobic chromatography;

[0028] 3.4) The sample obtained in step 3.3) was purified using Capto Core 400 flow-through mode;

[0029] 3.5) The sample obtained in step 3.5) is subjected to ultrafiltration replacement to obtain the target protein.

[0030] The purpose of introducing pepsin for enzymatic digestion in the separation and purification step of this invention is twofold: firstly, it can remove the original peptide sequence that affects collagen self-assembly; secondly, it can remove most of the erroneously expressed collagen and host cell proteins, thereby reducing the difficulty of separation and purification, increasing the yield, and reducing costs.

[0031] In a second aspect, the present invention provides a recombinant human type III collagen prepared by the method according to the first aspect of the present invention.

[0032] In some specific embodiments of the present invention, the amino acid sequences of recombinant human type III collagen obtained by using the nucleotide sequences shown in SEQ ID NO. 1, 2, 3 or 4 as coding sequences are shown in SEQ ID NO. 5, 6, 7 or 8, respectively.

[0033] In a preferred embodiment of the present invention, the amino acid sequence of the recombinant human type III collagen is shown in SEQ ID NO. 8.

[0034] AAGCTTGCCACCATGATGAGCTTTGTGCAGAAGGGCTCTTGGCTGCTCCTGGCCCTTCTGCATCCCACCATCATTCTCGCTGACGTCAAGAGCGGCGTGGCCGTCGGAGGGCTGGCTGGTTATCCCGGCCCTGCCGGACCACCCGGCCCTCCAGGTCCTCCCGGCACCTCTGGACACCCAGGGTCACCCGGTAGTCCTGGCTATCAGGGACCACCCGGCGAGCCTGGTCAGGCAGGCCCATCAGGACCTCCCGGACCACCCGGTGCCATCGGCCCTAGCGGACCAGCTGGGAAAGACGGTGAATCTGGCAGGCCCGGAAGACCTGGAGAGCGAGGTCTCCCAGGCCCTCCCGGAATTAAAGGGCCAGCCGGTATTCCCGGCTTCCCTGGAATGAAAGGGCATCGCGGTTTCGATGGCCGAAACGGAGAGAAGGGTGAGACAGGTGCACCAGGCCTGAAAGGAGAGAATGGGCTTCCCGGTGAGAACGGCGCACCTGGACCAATGGGTCCCAGAGGTGCTCCTGGCGAAAGAGGACGGCCAGGGCTGCCCGGTGCCGCAGGCGCCCGCGGAAATGACGGAGCCCGTGGTTCCGATGGCCAGCCTGGACCACCCGGTCCTCCAGGTACTGCCGGGTTTCCCGGAAGTCCTGGTGCAAAGGGTGAGGTGGGCCCAGCCGGATCACCTGGGAGCAACGGTGCTCCTGGCCAAAGAGGAGAACCAGGGCCTCAAGGTCACGCTGGCGCACAGGGACCTCCAGGGCCTCCCGGTATAAATGGCTCTCCAGGAGGGAAAGGTGAGATGGGCCCTGCCGGAATCCCTGGCGCTCCAGGTCTCATGGGCGCCAGAGGACCTCCAGGGCCAGCAGGTGCCAACGGCGCTCCCGGACTGCGTGGAGGTGCAGGCGAACCTGGAAAGAATGGTGCAAAGGGTGAGCCAGGCCCACGCGGAGAACGAGGCGAGGCCGGTATTCCTGGCGTTCCAGGAGCTAAGGGAGAAGACGGTAAAGATGGCTCTCCCGGAGAGCCTGGAGCCAACGGTTTGCCAGGCGCAGCCGGAGAAAGAGGCGCTCCCGGTTTCAGAGGCCCTGCCGGACCAAATGGGATACCCGGTGAGAAGGGCCCTGCAGGAGAACGCGGAGCTCCCGGCCCTGCCGGACCAAGAGGCGCTGCCGGTGAGCCCGGCAGAGACGGAGTGCCTGGTGGGCCAGGCATGCGTGGAATGCCTGGGAGCCCTGGTGGCCCAGGATCTGATGGGAAGCCCGGTCCTCCAGGCTCCCAGGGAGAAAGTGGGCGTCCCGGTCCTCCAGGCCCATCAGGACCTCGAGGGCAGCCAGGTGTCATGGGCTTTCCCGGACCTAAAGGGAACGACGGTGCACCAGGCAAGAATGGAGAGAGAGGTGGGCCCGGCGGACCTGGGCCACAGGGTCCTCCCGGCAAGAACGGAGAAACCGGGCCACAAGGTCCTCCCGGCCCAACAGGACCCGGTGGCGATAAGGGCGACACTGGACCTCCAGGGCCTCAGGGTCTGCAGGGCCTCCCTGGAACCGGTGGGCCACCCGGCGAGAATGGGAAACCTGGCGAACCAGGTCCCAAGGGCGATGCCGGAGCACCTGGAGCACCAGGTGGCAAAGGAGACGCAGGCGCACCCGGTGAGAGAGGCCCTCCAGGACTGGCTGGCGCTCCCGGTCTTCGCGGCGGAGCAGGGCCTCCAGGTCCCGAAGGCGGAAAGGGAGCCGCTGGTCCTCCAGGCCCTCCCGGAGCCGCAGGGACACCAGGTCTGCAGGGCATGCCCGGAGAGCGCGGTGGGCTCGGCAGCCCTGGACCCAAAGGTGATAAGGGTGAACCCGGCGGACCTGGCGCCGACGGTGTGCCAGGCAAAGATGGACCACGTGGGCCTACTGGTCCAATCGGCCCTCCCGGACCAGCTGGGCAACCCGGTGACAAGGGCGAGGGAGGAGCACCTGGTCTGCCAGGCATTGCAGGACCCAGAGGGTCTCCTGGTGAAAGAGGCGAGACCGGACCACCAGGGCCCGCCGGTTTCCCAGGCGCTCCCGGACAGAACGGTGAACCTGGTGGCAAAGGAGAGCGCGGTGCTCCAGGTGAGAAGGGCGAGGGAGGGCCTCCCGGTGTTGCAGGCCCACCCGGAGGGTCCGGTCCTGCTGGCCCACCCGGACCTCAAGGCGTGAAAGGTGAACGCGGCAGCCCGGGCGGACCCGGTGCCGCTGGTTTCCCTGGCGCCAGAGGACTGCCAGGGCCTCCCGGTAGCAACGGCAATCCAGGACCTCCTGGGCCATCTGGTTCACCCGGCAAGGACGGACCTCCAGGGCCCGCAGGTAACACCGGCGCACCCGGAAGTCCAGGCGTGTCAGGTCCCAAAGGCGATGCTGGACAGCCTGGTGAGAAGGGTAGCCCAGGCGCCCAAGGACCTCCCGGTGCACCAGGTCCCTTGGGCATCGCCGGAATTACAGGCGCTAGAGGTCTGGCTGGGCCTCCAGGAATGCCAGGGCCTCGCGGTTCTCCAGGCCCTCAGGGAGTCAAAGGTGAATCCGGTAAGCCTGGCGCAAATGGACTTAGTGGAGAGCGCGGTCCACCCGGCCCTCAAGGACTGCCAGGGCTCGCCGGTACTGCTGGCGAACCCGGACGAGACGGGAACCCTGGTTCAGATGGCCTGCCAGGAAGGGACGGGTCTCCCGGTGGCAAAGGAGATAGAGGCGAGAATGGTTCTCCTGGCGCTCCAGGAGCACCCGGCCACCCTGGTCCACCCGGCCCTGTGGGACCAGCCGGGAAGTCCGGTGACAGAGGCGAAAGTGGACCCGCTGGGCCTGCCGGTGCACCAGGCCCTGCCGGATCACGCGGCGCTCCTGGTCCACAGGGACCACGTGGAGATAAAGGTGAGACCGGTGAAAGAGGCGCCGCAGGAATCAAAGGGCATAGAGGTTTCCCTGGCAACCCAGGCGCTCCCGGAAGCCCTGGTCCAGCTGGCCAACAGGGAGCCATAGGGTCTCCCGGTCCTGCAGGCCCACGCGGACCCGTTGGGCCTTCCGGTCCACCCGGCAAAGACGGAACAAGTGGGCACCCTGGTCCAATCGGCCCTCCCGGACCACGCGGGAATCGAGGTGAGAGAGGCTCAGAAGGAAGTCCTGGCCATCCTGGTCAACCAGGCCCTCCCGGACCACCCGGAGCACCTGGTCCATGCTGTGGCGGAGTGGGAGCTGCCGCAATTGCCGGTATCGGCGGAGAGAAGGCCGGCGGCTTCGCTCCCTACTATGGAGACGAGCCTATGGATTTCAAGATCAACACCGACGAAATTATGACAAGCCTGAAATCTGTGAATGGGCAGATCGAGTCCCTCATAAGTCCAGATGGTTCAAGGAAGAATCCCGCTAGAAATTGCCGGGACCTGAAATTCTGTCACCCTGAACTTAAGAGCGGCGAGTACTGGGTCGATCCAAACCAGGGATGCAAACTGGACGCCATCAAGGTGTTCTGTAATATGGAAACTGGCGAGACCTGCATTTCTGCAAACCCTCTCAATGTTCCTCGCAAACATTGGTGGACAGATTCCAGTGCCGAGAAGAAACACGTGTGGTTCGGTGAGTCAATGGACGGCGGATTTCAGTTCAGCTATGGGAACCCAGAACTGCCCGAGGATGTCTTGGACGTGCATCTGGCCTTTCTCAGACTGCTTTCTTCCAGGGCCAGTCAGAATATCACTTACCACTGTAAGAACTCAATAGCATATATGGATCAGGCCAGCGGTAATGTAAAGAAAGCTCTGAAACTCATGGGCTCTAACGAAGGAGAGTTCAAGGCCGAAGGCAATTCCAAATTTACCTACACAGTGCTGGAGGACGGTTGCACTAAGCATACCGGCGAATGGAGTAAGACAGTCTTCGAGTATAGAACTCGGAAGGCAGTGCGCTTGCCTATCGTTGATATTGCACCATACGACATCGGAGGGCCCGATCAGGAATTTGGTGTGGACGTAGGCCCTGTGTGTTTCCTGTGATGAGCGGCCGC The amino acid sequence shown in SEQ ID NO.8: MMSFVQKGSWLLLALLHPTIILADVKSGVAVGGLAGYPGPAGPPGPPGPPGTSGHPGSPGSPGYQGPPGEPGQAGPSGPPGPPGAIGPSGPAGKDGESGRPGRPGERGLPGPPGIKGPAGIPGFPGMKGHRGFDGRNGEKGETGAPGLKGENGLPGENGAPGPMGPRGAPGERGRPGLPGAAGARGNDGARGSDGQPGPPGPPGTAGFPGSPGAKGEVGPAGSPGSNGAPGQRGEPGPQGHAGAQGPPGPPGINGSPGGKGEMGPAGIPGAPGLMGARGPPGPAGANGAPGLRGGAGEPGKNGAKGEPGPRGERGEAGIPGVPGAKGEDGKDGSPGEPGANGLPGAAGERGAPGFRGPAGPNGIPGEKGPAGERGAPGPAGPRGAAGEPGRDGVPGGPGMRGMPGSPGGPGSDGKPGPPGSQGESGRPGPPGPSGPRGQPGVMGFPGPKGNDGAPGKNGERGGPGGPGPQGPPGKNGETGPQGPPGPTGPGGDKGDTGPPGPQGLQGLPGTGGPPGENGKPGEPGPKGDAGAPGAPGGKGDAGAPGERGPPGLAGAPGLRGGAGPPGPEGGKGAAGPPGPPGAAGTPGLQGMPGERGGLGSPGPKGDKGEPGGPGADGVPGKDGPRGPTGPIGPPGPAGQPGDKGEGGAPGLPGIAGPRGSPGERGETGPPGPAGFPGAPGQNGEPGGKGERGAPGEKGEGGPPGVAGPPGGSGPAGPPGPQGVKGERGSPGGPGAAGFPGARGLPGPPGSNGNPGPPGPSGSPGKDGPPGPAGNTGAPGSPGVSGPKGDAGQPGEKGSPGAQGPPGAPGPLGIAGITGARGLAGPPGMPGPRGSPGPQGVKGESGKPGANGLSGERGPPGPQGLPGLAGTAGEPGRDGNPGSDGLPGRDGSPGGKGDRGENGSPGAPGAPGHPGPPGPVGPAGKSGDRGESGPAGPAGAPGPAGSRGAPGPQGPRGDKGETGERGAAGIKGHRGFPGNPGAPGSPGPAGQQGAIGSPGPAGPRGPVGPSGPPGKDGTSGHPGPIGPPGPRGNRGERGSEGSPGHPGQPGPPGPPGAPGPCCGGVGAAAIAGIGGEKAGGFAPYYGDEPMDFKINTDEIMTSLKSVNGQIESLISPDGSRKNPARNCRDLKFCHPELKSGEYWVDPNQGCKLDAIKVFCNMETGETCISANPLNVPRKHWWTDSSAEKKHVWFGESMDGGFQFSYGNPELPEDVLDVHLAFLRLLSSRASQNITYHCKNSIAYMDQASGNVKKALKLMGSNEGEFKAEGNSKFTYTVLEDGCTKHTGEWSKTVFEYRTRKAVRLPIVDIAPYDIGGPDQEFGVDVGPVCFL

[0035] Thirdly, the present invention provides a nucleotide that encodes recombinant human type III collagen and is selected from at least one of the following DNAs:

[0036] a) DNA containing any of the nucleotide sequences shown in SEQ ID NO. 1, 2, 3 or 4;

[0037] b) DNA that hybridizes under strict conditions with any DNA containing the nucleotide sequence shown in SEQ ID NO. 1, 2, 3 or 4.

[0038] Preferably, the DNA encoding type III collagen has the nucleotide sequence shown in SEQ ID NO.4.

[0039] Fourthly, the present invention provides an expression vector in which the nucleotide encoding recombinant human type III collagen as described in the third aspect of the present invention is introduced.

[0040] Fifthly, the present invention provides a recombinant cell comprising at least one of the following:

[0041] a) The nucleotides encoding recombinant human type III collagen as described in the third aspect of this invention;

[0042] b) The expression vector described in the fourth aspect of the present invention.

[0043] In some embodiments of the present invention, the host cell for forming the recombinant cells is a CHO cell or a HEK293 cell. Preferably, the host cell is a HEK293 cell.

[0044] In a sixth aspect, the present invention provides the use of the recombinant human type III collagen described in the second aspect of the present invention in the preparation of a product, wherein the product is selected from biomedical materials, tissue engineering products or cosmetics, and the product has a medical aesthetic effect.

[0045] The technical solution provided by this invention has the following advantages:

[0046] I. Accuracy of post-translation editing: Highly homologous to human natural collagen

[0047] The bioactivity of type III collagen depends on proline hydroxylation and lysine hydroxylation + glycosylation. The expression system for preparing type III collagen provided by this invention is currently the closest to the physiological state of the human body, mainly in the following two aspects: 1) Highly efficient hydroxylation modification and conforming to natural ratios: endogenous expression of P4H enzyme (P4H α2β2 tetramer) can achieve specific hydroxylation of proline at the Y position without the need for additional co-expression of heterologous hydroxylase, perfectly matching the stability requirements of the triple helix structure (Tm value 39-42℃); 2) Natural glycosylation mode without immunogenicity: the glycosyltransferase system in the Golgi apparatus is completely homologous to human cells, and the incidence of immune rejection of recombinant collagen is <0.1%, directly meeting the safety requirements of medical scenarios (skin repair, tissue engineering).

[0048] II. Triple Helix Structure Folding Integrity: The Core Guarantee of Functional Activity

[0049] The triple-helix folding of type III collagen depends on eukaryotic-specific molecular chaperones and secretion pathways. The expression system for preparing type III collagen provided by this invention is perfectly suited to this process:

[0050] Molecular chaperone system adapts to collagen folding: The endoplasmic reticulum naturally expresses the collagen-specific molecular chaperone Hsp47 (heat shock protein 47), which can bind to the unfolded α1(III) chain, prevent mis-aggregation, and guide the triple helix to fold gradually from the C-terminus to the N-terminus; Protein disulfide isomerase (PDI) efficiently catalyzes the formation of disulfide bonds in the C-terminal propeptide, providing a structural basis for the trimer assembly of the three α chains, with a folding accuracy of >90%, which is much higher than that of yeast cells (≈60%).

[0051] The secretion pathway ensures the integrity of the full-length molecule: the endoplasmic reticulum-Golgi apparatus secretion pathway can efficiently transport full-length type III collagen (molecular weight ≈390 kDa), avoiding the problems of "inclusion body formation" in prokaryotic cells and "blocked secretion of macromolecules" in yeast cells; during the secretion process, misfolded molecules are cleared by the endoplasmic reticulum-associated degradation (ERAD) system, ensuring that the extracellular secreted collagen is a complete triple helix structure without truncated or misfolded products.

[0052] III. High secretion efficiency and expression level: suitable for large-scale production

[0053] The preparation method provided by this invention can be adapted to high-density suspension culture, with cell density reaching 1×10⁻⁶. 7The cell / mL (serum-free medium) yield is 5-10 times higher than adherent culture; the doubling time is short (≈24 h), and high expression stability is maintained after 30 consecutive passages, with expression fluctuations ≤10%, solving the problem of "expression silencing after passage" in yeast cells. In suspension culture, the yield can reach 1-2 g / L in a large-scale bioreactor (200 L), meeting the needs of industrial production.

[0054] IV. Bioactivity indistinguishable from natural collagen: a core advantage in medical applications

[0055] The recombinant human type III collagen prepared by the method provided by the present invention is completely consistent with human natural collagen in terms of cell adhesion, fiber assembly, and tissue repair functions: Cell adhesion activity: It can specifically bind to integrin α2β1 on the surface of fibroblasts and vascular endothelial cells, with a cell adhesion rate ≥85% (natural collagen adhesion rate ≈88%), which can effectively promote cell proliferation and migration; Fiber assembly ability: The secreted procollagen (containing N / C-terminal propeptides) can be precisely cleaved by metalloproteinases in the extracellular environment and spontaneously assemble into a natural fiber network with a diameter of 50-100 nm.

[0056] V. Low cytotoxicity and no endotoxin risk: Ensuring the safety of medical products

[0057] Testing showed that the endotoxin content of the recombinant human type III collagen product prepared according to the method provided by this invention can be controlled at ≤0.5 EU / mg, which meets the standards for injectable products. Attached Figure Description

[0058] Figure 1 Structure diagram of the vector plasmid pCHO-GS.

[0059] Figure 2 Structure diagram of recombinant plasmid pCHO-COL3A1-GS.

[0060] Figure 3 SDS-PAGE (non-reducing) images of cell supernatant samples from the eight expression systems constructed in this invention.

[0061] Figure 4 SDS-PAGE (reduced form) of purified recombinant human type III collagen sample.

[0062] Figure 5 SDS-PAGE (non-reducing) image of purified recombinant human type III collagen sample.

[0063] Figure 6 CD scan of purified recombinant human type III collagen sample.

[0064] Figure 7(a) Analysis of the proline hydroxylation ratio in the purified recombinant human type III collagen sample; (b) A magnified view of part of Figure a. Detailed Implementation

[0065] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0066] 1. Isolation of cDNA from type III collagen α1 chain and construction of recombinant plasmid

[0067] The full-length gene for the human type III collagen α1 chain has been cloned, and the amino acid sequence it encodes can be found through uniprotentry P02461.

[0068] To improve the expression level of the target protein, this invention optimized and adjusted the full-length human type III collagen α1 chain gene and performed codon optimization for CHO cells, obtaining the nucleotide sequences shown in SEQ ID NO. 1-4. The target gene was synthesized by a third-party institution and named COL3A1-1, COL3A1-2, COL3A1-3, and COL3A1-4. These were then cloned between the Bam HI and Hind III sites in plasmid pCHO-GS, resulting in four recombinant plasmids named pCHO-COL3A1-GS, where COL3A1 represents the cloned target gene, specifically selected from COL3A1-1, COL3A1-2, COL3A1-3, and COL3A1-4. Figure 2 This is a schematic diagram of a recombinant plasmid after inserting the target gene COL3A1 (which can be COL3A1-1, COL3A1-2, COL3A1-3, or COL3A1-4).

[0069] 1.1) Composition of plasmid vector structure

[0070] The structure of the vector plasmid pCHO-GS used in this invention is as follows: Figure 1 As shown, it includes the following components:

[0071] 1. Prokaryotic framework elements (3)

[0072] pUC ori: Origin of high-copy replication in the proto-kernel;

[0073] Amp r Ampicillin resistance gene;

[0074] SV40 ori: Origin of free body replication.

[0075] 2. Eukaryotic expression system (6 key components)

[0076] CMV enhancers: improve transcription efficiency;

[0077] CMV starter: High-efficiency driver;

[0078] Kozak sequences: translation optimization (GCCACC);

[0079] BGH terminator: transcription termination (containing poly(A));

[0080] SV40 promoter: drives GS gene expression;

[0081] SV40 terminator: Terminates transcription of the GS gene.

[0082] 1.2) Plasmid extraction

[0083] Bacterial culture: Add 200 ml of LB liquid medium to a 1 L Erlenmeyer flask; simultaneously add 200 μl of 100 mg / ml ampicillin antibiotic; inoculate *E. coli* DH5α containing the four recombinant plasmids into LB medium; incubate at 37°C and 250 rpm for 14 hours to harvest the bacterial cells. Extract plasmids using the endotoxin-free plasmid extraction kit (Macherey Nagel) according to the prescribed procedure.

[0084] 2. Transient transfection was performed using CHO-S and HEK293 as host cells, respectively.

[0085] 2.1) Transient expression of CHO-S cells

[0086] Using CHO-S cells as host cells, the four recombinant plasmids (pCHO-COL3A1-1-GS, pCHO-COL3A1-2-GS, pCHO-COL3A1-3-GS, and pCHO-COL3A1-4-GS) prepared in step 1.2) were transiently transfected. The specific procedures were as follows: CHO-S cells were centrifuged to remove the passage medium; the cell density was adjusted to 6 × 10⁶ cells / year using transient transfection medium. 6Cells / ml, add 200 μl EnhancerA (QuaCell, catalog number QRD010) to every 10 ml of cell suspension, incubate at 37°C for 1 hour, then transiently transfect. Add the transient transfection reagent dropwise to the cell suspension, without adding glutamine on the same day, to a final concentration of 4 mM. After 4 hours of transient transfection, add 100 μl EnhancerB (QuaCell, catalog number QRD010) to every 10 ml, and incubate at 37°C. Count cells on D1, D3, and D5-D13. Feed the cells on D1, D5, and D10 with 10% feed 03A (QuaCell, catalog number A11903) + 1% feed B02 (QuaCell, catalog number A11952) and 4 mM glutamine, transiently transfect for 22-24 hours, then cool to 32°C for further incubation. For cell slurries with a cell viability ≤70%, centrifugation was performed at 10,000 rpm for 10 min. After centrifugation, the supernatant was collected and the product expression was analyzed by SDS-PAGE electrophoresis.

[0087] 2.2) Transient transexpression in HEK293 cells

[0088] HEK293 cells were used as host cells for transient transfection with the four recombinant plasmids (pCHO-COL3A1-1-GS, pCHO-COL3A1-2-GS, pCHO-COL3A1-3-GS, and pCHO-COL3A1-4-GS) prepared in step 1.2). The specific procedure was as follows: HEK293 cells were transfected at 7.50 × 10⁻⁶ cells / cells. 5 Seeds were generated at a density of 1.40-1.60 × 10⁶ cells / ml and cultured for 24 hours. 6 At cell counts / ml, PEI liposome transfection was performed. Transfection solutions were prepared (Solution A: 50 μg plasmid + 1500 μl PBS solution, mix and let stand for 5 min; Solution B: 200 μl PEI + 1500 μl PBS solution, mix and let stand for 5 min). Solution B was added to Solution A, mixed well, and let stand for 10 min. The mixture was then added dropwise to the cell culture medium, gently shaken, and 1000 μl of 200 mM glutamine solution was added. After transfection, cells were cultured in a CO2 shaking incubator (temperature: 37.0℃, CO2 concentration: 5%, rotation speed: 125 rpm). Cell counts were performed on days 1, 3, and 5-13. Feeding was performed on days 1, 5, and 10: 9% volume of Le TransFeed feed and 4 mM glutamine were added each time. For cell slurries with a cell viability ≤70%, centrifugation was performed at 10,000 rpm for 10 min. After centrifugation, the supernatant was collected and the product expression was analyzed by SDS-PAGE electrophoresis.

[0089] 2.3) SDS-PAGE analysis of the expression product

[0090] The cell culture supernatants harvested in 2.1 and 2.2 were used to prepare SDS-PAGE samples for electrophoretic analysis. The SDS-PAGE (non-reducing) results of the samples to be tested are as follows: Figure 3 As shown in the figure, 1, 2, 3, and 4 represent the recombinant expression plasmids constructed using SEQ ID NO. 1-4 as the target gene, specifically pCHO-COL3A1-1-GS, pCHO-COL3A1-2-GS, pCHO-COL3A1-3-GS, and pCHO-COL3A1-4-GS. The left side of the figure shows the recombinant protein expression using CHO-S cells as the host cell, and the right side shows the recombinant protein expression using HEK293 cells as the host cell. It can be seen from the figure that the recombinant protein expression level using HEK293 cells as the host cell is significantly higher than that using CHO-S cells, and the expression level is highest when using the expression vector constructed with SEQ ID NO. 4 as the target gene.

[0091] 3. Screening and culture of stable cell lines

[0092] 3.1) Plasmid extraction

[0093] Using the optimal combination of conditions obtained in step 2, namely pCHO-COL3A1-4-GS as the expression plasmid and HEK293 cells as the host cells, a cell line that can stably and efficiently express recombinant proteins was established.

[0094] Bacterial culture: Add 200 ml of LB liquid medium to a 1 L Erlenmeyer flask; simultaneously add 200 μl of 100 mg / ml ampicillin antibiotic; inoculate Escherichia coli DH5α containing pCHO-COL3A1-4-GS plasmid into LB medium; after culturing at 37℃ and 250 rpm for 14 hours, harvest the bacterial cells and extract the plasmid using the endotoxin-free plasmid extraction kit (Macherey Nagel) according to the procedure.

[0095] 3.2) Transfection and Monoclonal Cell Screening

[0096] Phase 1: Electroporation transfection

[0097] Short-duration high-voltage pulses create micropores in the cell membrane, allowing plasmids to enter the cells, achieving a transfection efficiency of over 80%. Key operational points: ① Prepare cells in the logarithmic growth phase, collect them by centrifugation, resuspend them in electroporation buffer, and adjust the density to 1×10⁻⁶. 7① Add 2-5 μg of plasmid to 100 μL of cell suspension and add to an electroporation cup; ② Set parameters for HEK293 cells: voltage 150-200V, capacitance 1000μF (suspension cells); ③ Add pre-warmed culture medium immediately after electroporation and incubate for 24-48h to express the exogenous GS gene.

[0098] Phase 2: GS System Screening and Pressurization

[0099] By utilizing the glutamine synthesis function of the GS gene, untransfected / low-expression cells were eliminated through glutamine-free medium and MSX pressurization.

[0100] Initial screening (day 3): 48 h post-transfection, cell density was adjusted to 5 × 10⁶ cells / day. 5 The cells / mL were transferred to a 250mL shake flask, and glutamine-free medium was added to a final volume of 50mL. The flask was then incubated at 37°C with shaking.

[0101] Untransfected cells: unable to synthesize glutamine, they gradually die in glutamine-free culture medium.

[0102] Transfected cells: The exogenous GS gene is expressed, which can synthesize glutamine, survive and proliferate.

[0103] Pressure screening (day 7): Four days after the initial screening, the cell density decreased to 1×10⁻⁶. 5 Add MSX to approximately cells / mL to the screening concentration determined in the preliminary experiment (e.g., 75 μM), and continue culturing for 14 days.

[0104] Mechanism of action: MSX inhibits endogenous GS activity, and only cells that highly express exogenous GS (in conjunction with high expression of COL3A1) can survive, thus achieving "enrichment of high expression lines".

[0105] During this period, glutamine-free medium was added every 3 days to maintain a cell density of 5 × 10⁶ cells / day. 4 -1×10 6 cells / mL, to avoid nutritional deficiencies.

[0106] Screening endpoint: After 14 days of pressure culture, cell viability recovered to ≥80%, forming a stable positive cell pool (polyclonal cell population), which can be used for monoclonal isolation.

[0107] Phase 3: Monoclonal Isolation

[0108] Collect the positive cell pool, centrifuge at 800 rpm for 5 min, resuspend in glutamine-free medium + 75 μM MSX, and count the viable cells.

[0109] Serial dilution: Dilute the cells sequentially to 10 cells / mL, 1 cell / mL, and 0.5 cells / mL (ensuring ≤1 cell per well).

[0110] Seeding in 96-well plates: Take 0.5 cells / mL of cell suspension and seed 200 μL into each well (theoretically 0.1 cells per well), seeding a total of 6 96-well plates (to improve the recovery rate of positive clones);

[0111] Culture and observation: Cultured at 37℃ and 5% CO2. Observe on day 3 using an inverted microscope and mark wells containing "single cell only". Observe cell colony formation on days 7-10 (avoid multicellular clones). On day 14, when the colony size reaches 1 / 3 of the bottom of the well, transfer to 24-well plates for expansion culture. Detect expression levels and select the TOP25 single-clone cells based on expression levels for expansion and seeding.

[0112] Phase 4: Secondary screening of monoclonal cell lines

[0113] The obtained Top25 monoclonal cell lines were evaluated in a round of Fed-Batch experiments. After the culture was completed, the Top5 cell lines were determined based on cell growth (such as maximum density, viability, and particle size change) and the yield of the target protein.

[0114] The products from the Top 5 cell lines were purified, and the purified products were subjected to SDS-PAGE, SEC-HPLC (size exclusion high performance liquid chromatography), PI (propidium iodide fluorescent dyes that can be used for cell cycle detection), post-translational modification, and molecular weight analysis. Finally, based on cell growth, target protein yield, and target protein quantity, 2-3 high-expression cell lines were selected for subsequent monoclonal cell line PCB library construction.

[0115] 3.3) Cell Culture

[0116] Take one cell line from the liquid nitrogen tank and thaw it rapidly in a 37°C water bath for 2-3 minutes. Once completely thawed, quickly transfer the frozen cell solution to a 15 mL centrifuge tube containing 5 mL of CD04 basal medium. Centrifuge at 1000 rpm for 5 minutes until a pellet is formed. Discard the supernatant and resuspend the cells in 5 mL of CD04 basal medium (containing 25 μM MSX). Then transfer the cells to a 125 mL Erlenmeyer flask containing 15 mL of CD04 basal medium (containing 25 μM MSX). The initial culture volume after inoculation is 20 mL.

[0117] When the density of revived cultured cells reaches (2.0-5.0)×10⁻⁶ 6When the cell density is 0.5 × 10⁶ cells / mL and the cell viability is >90%, add CD04 solution to a 500 mL shake flask, then seed the cell suspension into the 500 mL shake flask, mix well, and bring the cell density to 0.5 × 10⁶ cells / mL. 6 The cell density was 100 cells / mL, and the culture volume after inoculation was 100 mL. Subculturing and amplification were performed every 3 days, based on the required seed cell solution at the time of inoculation.

[0118] The experimental protocol was followed for shake-flask Fed-Batch culture. 1L baffled shake flasks were used, with LeGend Medium as the basal medium. The initial culture volume was 200 mL, and the inoculation density was 0.5 × 10⁻⁶. 6 cells / mL; 4.5% Spring 007A and 0.45% Cell Best 007B of the initial culture volume were added on days 3, 5, 7, 9, 11 and 13. Starting on day 2 of culture, if the glucose concentration was lower than 4 g / L, it was increased to 6 g / L (including glucose from the feed). Starting on day 5 of culture, if the glucose concentration was lower than 4 g / L, it was increased to 8 g / L (including glucose from the feed). The supernatant was harvested on day 14 or when the cell viability was lower than 90%.

[0119] All shake flask cultures were conducted in a shaker at a temperature of 37.0℃, a carbon dioxide concentration of 5.0%, and a shaking frequency of 130 rpm.

[0120] Cell culture medium harvesting: Aliquot the cell culture medium into 50ml centrifuge cups and balance them; centrifuge at 4000rpm for 30min at 4℃ using a low-temperature refrigerated centrifuge, collect the supernatant after centrifugation and discard the precipitated cells; filter the supernatant using a 0.22μm filter.

[0121] The present invention stabilizes the cell clones with the highest production efficiency obtained through screening using the above passage and culture methods, and its production level is 625 μg / mL culture medium.

[0122] 4. Chromatographic purification of recombinant proteins

[0123] 4.1) Sample Concentration

[0124] The harvested solution was concentrated to half its volume using a 100 kDa hollow fiber ultrafiltration membrane. After concentration, the sample was digested with pepsin at a concentration of 10 μg / ml. The reaction was carried out at room temperature for at least 3 hours. After the reaction was completed, the pH was adjusted to 7.0-8.0 or higher using Tris to terminate the digestion. Clarification filtration was then performed using a deep filtration membrane pack (Merck X0HC).

[0125] 4.2) Crude and pure

[0126] Capture was performed using Borglon diamond MMC mustang packing material; equilibration buffer (20 mM phosphate, 100 mM sodium chloride, pH 7.5), elution buffer (20 mM phosphate, 1 M sodium chloride, pH 7.5), elution was performed using a 10 CV gradient from 100 mM sodium chloride to 1 M sodium chloride, and the target protein was collected in segments during the gradient elution.

[0127] 4.3) Pure

[0128] Medium purification was performed using Tosoh phenyl650M hydrophobic packing material; 50 mM Tris + 1 M ammonium sulfate (pH 8.0) was used as equilibration and rinsing buffer, and 50 mM Tris (pH 8.0) was used as elution buffer; the target protein was eluted using a gradient of decreasing ammonium sulfate concentration (1 M ammonium sulfate to 0 M ammonium sulfate, 10 CV), and the target protein was collected in segments during the gradient elution process;

[0129] 4.4) Purity

[0130] The sample was purified using the Capto Core 400 flow-through mode, and the flow was collected. The buffer system was 20 mM phosphate + 150 mM sodium chloride, pH 7.2.

[0131] 4.5) Ultrafiltration

[0132] The purified sample was replaced by ultrafiltration using 20 mM PPB + 150 mM sodium chloride membrane with a 100 kDa pore size. SDS-PAGE electrophoresis was then performed on the sample, and the results are as follows: Figure 4 and Figure 5 As shown, the molecular weights of both reduced and non-reduced SDS-PAGE molecules are at their theoretical positions.

[0133] Example 1: Circular dichroism Detection of Recombinant Human Type III Collagen Molecules

[0134] Circular dichroism (CD) spectroscopy is a commonly used method for characterizing the secondary and tertiary structures of biological macromolecules such as proteins. The CD spectrum of collagen shows a negative peak at a wavelength near 195 nm and a positive peak at a wavelength near 221 nm, which suggests that collagen has a triple helix structure.

[0135] Recombinant human type III collagen molecules obtained by transient transfection expression in HEK293 cells using SEQ ID NO.4 as the target gene expression vector were analyzed and identified by circular dichroism spectroscopy (CDI) using an Applied Photophysics (Chirascan V100) spectrometer. The results are as follows: Figure 6 As shown, the circular dichroism chromatographic peaks conform to the triple helix characteristic peaks, that is, a negative peak appears at 198 nm and a positive peak appears near 222 nm.

[0136] Example 2: Detection of hydroxyproline content in recombinant human type III collagen molecules

[0137] The hydroxyproline (HYP) content of the recombinant type III humanized collagen molecules prepared in this invention was detected using a hydroxyproline (HYP) content detection reagent (Solepro, BC0255).

[0138] Specific implementation methods:

[0139] 1) Dilute 0.5 mg / ml of hydroxyproline standard with ultrapure water to prepare standard curve solutions containing 30 μg / ml, 20 μg / ml, 15 μg / ml, 10 μg / ml, and 2 μg / ml of hydroxyproline;

[0140] 2) Place the recombinant protein sample in a 10ml glass digestion tube, add an equal volume of concentrated hydrochloric acid, tighten the cap, and place it in a 110℃ oven for high-temperature digestion for 6 hours. Then remove it and let it cool to room temperature. Add 2ml of ultrapure water. Adjust the pH to 6-8 using 5M sodium hydroxide under pH meter. Transfer the solution to a 5ml volumetric flask, add 500μl of water to rinse the digestion tube twice, and transfer the rinse water to the 5ml volumetric flask as well. Finally, dilute to the mark with water.

[0141] 3) Transfer 60 μl each of the blank solution, linear solutions of hydroxyproline standards at various concentrations, and recombinant protein sample solution into separate 2 ml EP tubes. Add 60 μl of chloramine-T solution to each tube, mix well, and let stand for 20 minutes. Then add 60 μl of p-dimethylbenzaldehyde solution and 120 μl of water, mix well, and heat at 60 °C for 15 minutes. After cooling for 15 minutes, take 200 μl and place it in a 96-well plate. Measure the absorbance at 560 nm using a UV spectrophotometer, and calculate the concentration of hydroxyproline based on the standard curve. The results are as follows: Figure 7 As shown in Table 1, the proline hydroxylation rate was 53.9%. According to calculations from the uniprot database, the hydroxylation rate in human type III collagen is 60.4% when all hydroxylable prolines are hydroxylated. In the human body, the hydroxylation rate is also heterogeneous. We achieved a hydroxylation rate of 53.9 / 60.4 = 89.2% for hydroxylable prolines, which is significantly better than the existing level.

[0142] Table 1. Detection data of hydroxyproline content in recombinant human type III collagen.

[0143]

[0144] The experimental results of this invention show that optimizing the target gene in the recombinant expression system significantly improves the expression of recombinant proteins. Furthermore, even with the same target gene configuration, selecting different cell types as host cells significantly affects the protein expression efficiency of the recombinant cells. According to the inventors' preliminary research, existing technologies all use CHO cells as host cells for recombinant expression, with no precedent for HEK293 cells. However, this invention unexpectedly found that HEK293 cells are more advantageous as host cells for improving the recombinant protein expression rate. Initially, codon optimization of the target gene was performed using CHO cells. During transient transfection expression, HEK293 cell expression experiments were also conducted, and the results unexpectedly showed that the recombinant protein expression rate was higher when HEK293 cells were used as the host cell. The inventors believe that HEK293 cells possess human expression, secretion, and post-translational modification systems, hence the choice of HEK293 cells for expression. Eukaryotic cells possess an endoplasmic reticulum-Golgi apparatus secretion pathway, which guides collagen into the secretory pathway via signal peptides. Simultaneously, endoplasmic reticulum-associated degradation (ERAD) of misfolded molecules ensures the integrity of the secreted product. After secretion into the extracellular space, the protease environment of the eukaryotic cell expression system is similar to that of the human body, allowing for precise cleavage of propeptides of procollagen to form mature collagen and preventing excessive degradation. HEK293 cells exhibit particularly high secretion efficiency, possessing a sophisticated signal peptide recognition and processing mechanism that efficiently guides full-length type III collagen into the secretory pathway, significantly increasing the yield per unit volume. Based on this, the recombinant human type III collagen prepared in this invention possesses structural characteristics and functional activities similar to natural collagen, and further exhibits the applicable effects of natural collagen.

[0145] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing recombinant human type III collagen, comprising: 1) DNA encoding type III collagen was introduced into a vector to construct a recombinant expression vector; 2) Transform or transfect host cells to obtain recombinant cells; 3) Culture or cultivate the recombinant cells, and isolate and purify type III collagen with a triple helix structure from the cells or culture supernatant; The DNA encoding type III collagen is selected from at least one of the following DNA types: a) Any DNA in the nucleotide sequence shown in SEQ ID NO. 1, 2, 3 or 4; b) DNA that hybridizes under strict conditions with any of the nucleotide sequences shown in SEQ ID NO. 1, 2, 3 or 4.

2. The preparation method according to claim 1, characterized in that, The DNA encoding type III collagen has the nucleotide sequence shown in SEQ ID NO.4; the vector for introducing the DNA encoding type III collagen is pCHO-GS.

3. The preparation method according to claim 1, characterized in that, In step 2), the host cell is selected from eukaryotic cells or prokaryotic cells. The eukaryotic cells are CHO cells, yeast cells, HEK293, BHK-21, C127, MDCK, NAMALWA, SP2 / 0, or COS. The prokaryotic cells are Escherichia coli cells.

4. The preparation method according to claim 3, characterized in that, The host cell is a CHO cell or a HEK293 cell; preferably a HEK293 cell.

5. The preparation method according to claim 1, characterized in that, The separation and purification described in step 3) includes the following steps: 3.1) Use an ultrafiltration membrane to concentrate the sample to 1 / 2-1 / 3 of its original volume. At room temperature, use pepsin to digest the concentrated sample. Stop the digestion after 2-3 hours and use a deep filtration membrane for clarification filtration. 3.2) The sample obtained in step 3.1) was crudely purified using MMC chromatography; 3.3) The sample obtained in step 3.2) was purified by hydrophobic chromatography; 3.4) The sample obtained in step 3.3) was purified using Capto Core 400 flow-through mode; 3.5) The sample obtained in step 3.5) is subjected to ultrafiltration replacement to obtain the target protein.

6. Recombinant human type III collagen prepared by the method according to any one of claims 1-5.

7. A nucleotide, said nucleotide being a nucleotide encoding recombinant human type III collagen, selected from at least one of the following DNAs: a) DNA containing any of the nucleotide sequences shown in SEQ ID NO. 1, 2, 3 or 4; b) DNA that hybridizes under strict conditions with any DNA containing the nucleotide sequence shown in SEQ ID NO. 1, 2, 3 or 4.

8. An expression vector wherein the nucleotide encoding recombinant human type III collagen as described in claim 7 is introduced into the expression vector.

9. A recombinant cell, said cell comprising at least one of the following: a) The nucleotide encoding recombinant human type III collagen as described in claim 7; b) The expression vector as described in claim 8.

10. Use of the recombinant human type III collagen of claim 6 in the preparation of a product, wherein the product is selected from biomedical materials, tissue engineering products, or cosmetics.

Images