A method for preparing egg yolk antibodies against the feline allergen Fel d1 using a DNA primary immunization and protein enhancement strategy.

CN122832084APending Publication Date: 2026-09-29NANJING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202611234153.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-08-14
Publication Date
2026-09-29

AI Technical Summary

Technical Problem

[0004]然而,现有技术存在以下问题与缺陷:(1)成本与工艺限制:重组蛋白表达工艺复杂;(2)免疫原性的改变:重组蛋白体外表达和纯化可能影响抗原的免疫原性;(3)免疫原组分单一:主要靶向的免疫原是Fel d1,不能有效覆盖其他猫毛过敏原,如Fel d4等过敏原

Benefits of technology

[0025]本发明提供的一种应用DNA初免和蛋白加强策略制备猫过敏原Fel d1的卵黄抗体的方法,与现有技术相比,具有以下有益效果:

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122832084A_ABST
    Figure CN122832084A_ABST
Patent Text Reader

Abstract

This invention discloses a method for preparing egg yolk antibodies against the feline allergen Fel d1 using a DNA primary immunization and protein booster strategy. The method includes: constructing a recombinant DNA vaccine plasmid expressing the feline allergen Fel d1, the plasmid containing Fel d1 chain 1 and chain 2 encoding genes linked by a T2A peptide encoding sequence; extracting a mixture of feline allergen proteins containing Fel d1, Fel d4, and Fel d7 from cat skin dander; primary immunizing laying hens with the recombinant DNA vaccine plasmid, followed by booster immunization with the feline allergen protein mixture; collecting eggs and isolating and purifying the egg yolk antibody IgY. The obtained IgY specifically binds to the feline allergen and significantly inhibits the feline allergen-induced airway epithelial cell inflammatory response. This invention features a simple process, low cost, and good safety profile. The obtained IgY has broad coverage and high specificity, and can be used to prepare products for the prevention and / or relief of feline allergies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and genetic engineering, and specifically relates to a method for preparing egg yolk antibodies against the feline allergen Fel d1 using a DNA primary immunization and protein enhancement strategy. Background Technology

[0002] Fel d1, a feline allergen, is the main causative agent of feline allergies in humans. Secreted by the salivary and sebaceous glands of cats, it spreads into the environment through grooming and triggers allergic reactions including rhinitis and asthma. Approximately 10% to 20% of the global population is allergic to cats. Traditional treatments primarily focus on avoiding the allergen, but this is insufficient to meet the long-term needs of cat lovers.

[0003] In recent years, intervention technologies targeting Fel d1 have gradually developed, primarily by adding anti-Fel d1 antibodies (IgY) to cat food to neutralize allergens in cat saliva. For example, Purina's dry cat food containing anti-Fel d1 antibodies can reduce the level of active Fel d1 in the environment by approximately 47%, improving allergy symptoms. Currently, the preparation of anti-Fel d1 antibodies (IgY) mainly involves immunizing laying hens with recombinant Fel d1 protein.

[0004] However, the existing technology has the following problems and defects: (1) Cost and process limitations: the recombinant protein expression process is complex; (2) Changes in immunogenicity: the in vitro expression and purification of recombinant proteins may affect the immunogenicity of the antigen; (3) Single immunogenic component: the main target immunogenicity is Fel d1, which cannot effectively cover other cat hair allergens, such as Fel d4.

[0005] Therefore, developing a simple, low-cost method for preparing egg yolk antibodies that can induce the production of broad-spectrum anti-cat allergen antibodies is of significant application value. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a method for preparing yolk antibodies against the feline allergen Fel d1 using a DNA primary immunization and protein booster strategy. The DNA nucleic acid vaccine prepared by this invention directly encodes the target antigen, enabling sustained expression of the antigen with its natural conformation within the host. The feline allergens extracted from cat dander include multiple allergens such as Fel d1, Fel d4, and Fel d7, providing broad coverage. This invention employs an immunization strategy combining DNA nucleic acid vaccine primary immunization with protein vaccine booster, avoiding the complex purification process of traditional recombinant protein vaccines and inducing highly efficient, broad-spectrum anti-feline allergen IgY antibodies.

[0007] The technical solution adopted by this invention to solve its technical problem is:

[0008] In a first aspect, the present invention provides a method for preparing anti-cat allergen egg yolk antibodies using a DNA primary immunization and protein enhancement strategy, the method comprising the following steps:

[0009] (1) Construct a recombinant DNA vaccine plasmid expressing the feline allergen Fel d1, wherein the recombinant DNA vaccine plasmid contains a Feld1 chain 1 encoding gene and a Feld1 chain 2 encoding gene, wherein the chain 1 encoding gene and the chain 2 encoding gene are linked by a 2A peptide encoding sequence;

[0010] (2) Extraction of cat allergen protein mixture: Cat dander and / or hair were collected, extracted with water, and the resulting extract was precipitated with acetone to obtain cat allergen protein precipitate. After redissolving, cat allergen protein mixture was obtained.

[0011] (3) The birds are immunized for the first time with the recombinant DNA vaccine plasmid described in step (1), and then at least one booster immunization is performed with the cat allergen protein mixture described in step (2);

[0012] (4) Collect eggs produced by immunized poultry and isolate and purify egg yolk antibody IgY from the egg yolk.

[0013] In a specific implementation, the nucleotide sequence of the Fel d1 chain 1 encoding gene is shown in SEQ ID NO:1, the nucleotide sequence of the Fel d1 chain 2 encoding gene is shown in SEQ ID NO:3, and the 2A peptide is a T2A peptide, the coding sequence of which is shown in SEQ ID NO:2.

[0014] In a specific implementation, the starting vector of the recombinant DNA vaccine plasmid is pCAGGS; the recombinant DNA vaccine plasmid also contains a Kozak sequence and a tag protein coding sequence, wherein the tag protein is a 3×Flag tag.

[0015] In the specific implementation plan, step (2) is as follows: use a vacuum cleaner to collect the dander and / or hair from the cat's body surface; place the collected material in sterile distilled water and extract overnight at 4°C with shaking; add acetone pre-cooled at -20°C to the extract at a volume ratio of acetone:extract = 1:4, mix well, and let stand overnight at -20°C; centrifuge at 4°C and 10,000-12,000 rpm for 15-30 min, discard the supernatant, evaporate the acetone, and obtain the cat allergen protein precipitate; redissolve with physiological saline to obtain the cat allergen protein mixture.

[0016] In a specific implementation, the cat allergen protein mixture contains Fel d1, Fel d4 and Fel d7.

[0017] In the specific implementation plan, the poultry is a laying hen; the initial immunization is performed by injecting the recombinant DNA vaccine plasmid into the leg muscles at multiple sites, with a dose of 20 μg / bird.

[0018] In a specific implementation plan, the booster immunization is performed once each in the 2nd, 4th and 6th weeks after the initial immunization, with each dose of immunogen being 1 mg / animal, and the immunogen is mixed with an adjuvant before inoculation; the adjuvant is colloidal manganese adjuvant.

[0019] Secondly, the present invention protects a recombinant DNA vaccine plasmid expressing the feline allergen Fel d1, wherein the recombinant DNA vaccine plasmid contains a Fel d1 chain 1 coding gene, a 2A peptide coding sequence, and a Fel d1 chain 2 coding gene connected in sequence; the nucleotide sequence of the Fel d1 chain 1 coding gene is shown in SEQ ID NO:1, the 2A peptide coding sequence is shown in SEQ ID NO:2, and the nucleotide sequence of the Fel d1 chain 2 coding gene is shown in SEQ ID NO:3.

[0020] In a specific implementation, the recombinant DNA vaccine plasmid contains a nucleotide sequence as shown in SEQ ID NO:4; the starting vector is pCAGGS.

[0021] Thirdly, the present invention provides an anti-cat allergen egg yolk antibody IgY, which is prepared by the method described in any of the preceding descriptions.

[0022] Fourthly, the present invention also protects the use of the aforementioned anti-cat allergen egg yolk antibody IgY in the preparation of products for the prevention and / or relief of cat allergies.

[0023] In a specific implementation plan, the product is cat food, feed additive, or anti-allergy spray.

[0024] Beneficial effects

[0025] The present invention provides a method for preparing egg yolk antibodies against the feline allergen Fel d1 using a DNA primary immunization and protein enhancement strategy, which has the following advantages compared with the prior art:

[0026] (1) The extraction process of cat allergens is simple and low in cost. This invention can directly extract and wash dander from cats using a vacuum cleaner, resulting in high dander extraction efficiency. Mass spectrometry analysis shows that the extract contains multiple allergen components such as Fel d1, Fel d4, and Fel d7, with clearly defined allergen components and low interference from impurities. The extraction materials only require sterile distilled water and a vacuum cleaner, and the operation only requires one centrifugation. The materials are simple, the operation is convenient, and the cost is low.

[0027] (2) DNA vaccines have good safety and natural antigen conformation. The DNA vaccine in this invention can directly induce host cells to express antigens. The antigen expression level and spatial conformation are stable, which is conducive to enhancing the immune response. There is no need to use live virus vectors, which reduces potential safety risks. The plasmids can be stored at room temperature, which is convenient for transportation and storage. The production process is relatively simple and the cost is low, making it suitable for large-scale production.

[0028] (3) The immunization strategy is highly efficient and has broad antibody coverage. Compared with other immunization strategies, DNA vaccines express antigens in vivo, which can better maintain the spatial conformation of protein antigens. In this invention, the primary immunization with a DNA vaccine combined with a mixture of feline allergen proteins is enhanced. The induced IgY not only targets Fel d1 but also covers multiple feline allergens such as Fel d4 and Fel d7. The results of the examples show that the obtained IgY can specifically bind to Fel d1 and can dose-dependently inhibit the expression of inflammatory factors IL-6 and IL-8 in BEAS-2B cells induced by feline dander allergens (p<0.0001). The inhibitory effect is significantly better than that of non-specific IgY, and it has good application prospects in the fight against feline allergies. Attached Figure Description

[0029] Figure 1 Mass spectrometry identified the extract as containing peptides (ALPVVLENAR) and (ILKNCVDAK) of the first chain of the feline allergen Fel d1. The example in the figure is peptide (ILKNCVDAK).

[0030] Figure 2 Mass spectrometry identified the extract as containing peptides (IQDCYVENGLISR), (KIQDCYVENGLISR), and (VLDGLVMTTISSSK) of the second chain of the feline allergen Fel d1. The example in the figure is peptide (IQDCYVENGLISR).

[0031] Figure 3 Mass spectrometry identified the extract as containing the feline allergen Fel d4 peptide (CTEIFLVADKTK) and peptide (GSEVAQDSSVE). The example in the figure is peptide (CTEIFLVADKTK).

[0032] Figure 4 Mass spectrometry identified the extract as containing the feline allergen Fel d7 peptide (AETTLLTNGQCK), peptide (EVELILEK), and peptide (EVELILEKTSEPK). The example in the figure is peptide (AETTLLTNGQCK).

[0033] Figure 5 Plasmid map of the feline d1 allergen nucleic acid vaccine.

[0034] Figure 6 The Western blot results of in vitro transfection and expression validation of the recombinant plasmid are shown in the figure.

[0035] Figure 7 ELISA was used to detect specific antibodies against the cat dander allergen Fel d1.

[0036] Figure 8 Western blot (WB) was used to detect specific antibodies against the cat hair allergen Fel d1.

[0037] Figure 9 Inhibitory effect of specific IgY pretreatment on inflammatory response of BEAS-2B cells induced by feline dander allergen.

[0038] Figure 10 Effects of IgY on inflammation of BEAS-2B cells induced by feline dander allergens. Detailed Implementation

[0039] The present invention will be further described in detail below with reference to the embodiments. Reagents or instruments used without a specified manufacturer are considered to be conventional products that can be purchased on the market.

[0040] Example 1: Construction and in vitro expression validation of a recombinant DNA vaccine plasmid expressing Fel d1

[0041] 1. Obtaining the Fel d1 gene

[0042] The gene sequence of cat major allergen 1 (Fel d1) was obtained from the NCBI database, including Fel d1 chain 1 (GenBank accession number: LOC677877) and Fel d1 chain 2 (GenBank accession number: M77341.1). The gene sequence was obtained through chemical synthesis. A T2A linker peptide coding sequence (SEQ ID NO:2) was added between chain 1 and chain 2, and restriction endonuclease EcoRI and Not I restriction sites were added to both ends of the gene fragment. Simultaneously, a Kozak sequence (GCCACC) was added to the 5' end, and a 3×Flag tag coding sequence and a stop codon were added to the 3' end. The full-length nucleotide sequence of the resulting DNA vaccine is shown in SEQ ID NO:4, where the gene sequence encoding chain 1 is shown in SEQ ID NO:1, and the gene sequence encoding chain 2 is shown in SEQ ID NO:3.

[0043] 2. Construction of expression vector

[0044] The empty vector plasmid pCAGGS was double-digested with restriction endonucleases EcoRI and NotI. The gene fragment containing the EcoRI and NotI restriction sites was then ligated with the linearized vector to construct the recombinant plasmid pCAGGS-Fel d1 (plasmid map shown). Figure 5 The expression cassette contains chain 1 and chain 2 reading frames of Fel d1, connected by a T2A linker (the FLAG tag is used for protein expression verification). The plasmid was transformed into *E. coli*, extracted, digested with enzymes for identification, and its correctness was confirmed by DNA sequencing.

[0045] 3. In vitro expression validation

[0046] The recombinant plasmid was transfected into HEK293T cells (transfection reagent: Lipofectamine 3000). Forty-eight hours post-transfection, cell supernatant and lysis buffer were collected and analyzed by Western blot. The results showed that Fel d1 protein was successfully expressed and secreted in the cell supernatant (see...). Figure 6 This indicates that the recombinant plasmid has good expression ability.

[0047] Example 2: Extraction and Mass Spectrometry Identification of a Mixture of Feline Allergen Proteins

[0048] The extraction steps for the feline allergen protein mixture are as follows:

[0049] (1) Clean a healthy cat with a vacuum cleaner to obtain dander from the cat's fur (cat breed: British Shorthair). Specific operation method: Hold the cat, stroke the fur, first put the vacuum cleaner head close to the skin, then turn on the vacuum cleaner, vacuum for 1 minute, and then change the position to vacuum;

[0050] (2) Place the collected material into a 50 mL centrifuge tube, add 40 mL of sterile distilled water, and shake overnight at 4°C to promote dissolution;

[0051] (3) Take 10 mL of acetone and pre-cool it at -20℃;

[0052] (4) Add pre-cooled acetone to the extract at a volume ratio of acetone:extract = 1:4, and mix thoroughly on ice;

[0053] (5) Place the cat allergen mixture in a -20°C refrigerator overnight;

[0054] (6) Pre-cool the centrifuge at 4°C, put in the mixture, and centrifuge at 10,000 to 12,000 rpm for 15 to 30 minutes;

[0055] (7) Remove the supernatant (i.e., acetone) and allow it to evaporate completely in a fume hood, leaving a protein precipitate;

[0056] (8) Add an appropriate amount of physiological saline to reconstitute, and then store in separate containers.

[0057] The extracts were subjected to mass spectrometry identification. The results showed that the peptides ALPVVLENAR (SEQ ID NO:5) and ILKNCVDAK (SEQ ID NO:6), the first chain of the feline allergen Fel d1, were identified in the extracts. Figure 1 ); Fel d1 second chain peptides IQDCYVENGLISR (SEQ ID NO:7), KIQDCYVENGLISR (SEQ ID NO:8) and VLDGLVMTTISSSK (SEQ ID NO:9) ( Figure 2 ); the peptides CTEIFLVADKTK (SEQ ID NO:10) and GSEVAQDSSVE (SEQ ID NO:11) of the feline allergen Fel d4 ( Figure 3 ); and the peptides AETTLLTNGQCK (SEQ ID NO:12), EVELILEK (SEQ ID NO:13), and EVELILEKTSEPK (SEQ ID NO:14) of the feline allergen Fel d7 ( Figure 4 This indicates that the cat allergen protein mixture extracted by this invention contains multiple allergen components such as Fel d1, Fel d4, and Fel d7, with a wide coverage.

[0058] Example 3: DNA primary immunization combined with protein-enhanced immunization strategy

[0059] (1) Initial immunization: Healthy Hy-Line Brown laying hens at peak egg production were selected. All hens were housed in isolation cages, fed standard feed, and provided with free access to water. The light cycle was 16 h light / 8 h dark. The pCAGGS-Fel d1 recombinant plasmid constructed in Example 1 was injected intramuscularly into the leg of the laying hens at a dose of 20 μg / hen (dissolved in 200 μL of physiological saline, injected at multiple points, two injection points on each leg, 50 μL injected at each point). pCAGGS is an expression plasmid suitable for avian DNA vaccines.

[0060] (2) Booster immunization: At weeks 2, 4 and 6 after the initial immunization with the DNA vaccine, booster immunizations were performed using a mixture of feline allergen proteins extracted from cat dander in Example 2. 1 mg (0.5 mL) of immunogen was mixed thoroughly with 0.8 mL (4 mg) of MnJβ colloidal manganese adjuvant (working adjuvant concentration 1 mg / mL) and injected into each chicken. A total of 4 mL was injected into each chicken at 4 injection sites.

[0061] Example 4: ELISA detection of Fel d1-specific IgY

[0062] Collect eggs after booster immunization, purify egg yolk antibody IgY, and perform ELISA testing according to the following steps:

[0063] (1) Coating: Dilute the cat hair extract antigen to 3 μg / mL with carbonate coating buffer and coat the microplate. Coat at 37℃ for 1 h and then coat at 4℃ overnight.

[0064] (2) Washing: TBS wash twice, 3 min / time, 300 μL / well, then pat dry the second time;

[0065] (3) Sealing: Add 300 μL of 10% skim milk powder solution to each well and incubate at 37℃ for 2 h to seal;

[0066] (4) Washing: Same as step (2);

[0067] (5) Incubation of primary antibody: The experimental group IgY was diluted with 1% skim milk powder at a ratio of 1:2000, 1:4000, 1:8000 and 1:16000 and added to the ELISA plate; the control group IgY (non-specific IgY from unimmunized chickens) was diluted at the same concentration gradient and added to the adjacent wells of the experimental group as a negative control. Each dilution was repeated in three wells, 100 μL per well, and incubated at 37℃ for 2 h.

[0068] (6) Washing: Wash 5 times with TBST, 3 min / time, 300 μL / well; wash 2 times with TBS, 3 min / time, 300 μL / well, and pat dry on the second wash;

[0069] (7) Incubation of secondary antibody: Add 100 μL of HRP-labeled goat anti-chicken IgY secondary antibody diluted with 1% skim milk powder at a ratio of 1:2000 to each well, and incubate at 37℃ for 1 h;

[0070] (8) Washing: Same as step (6);

[0071] (9) Color development: Add 100 μL / well ELISA color development solution (prepare fresh and protect from light), develop color for 5 min, and finally add 50 μL / well 2 mol / L H2SO4 to terminate the process;

[0072] (10) Reading value: Use an ELISA reader to read and record the OD value at a wavelength of 490 nm. According to P / N≥2.1, P = OD490 of the antibody to be tested - OD490 of the blank control, N = OD490 of the negative control antibody - OD490 of the blank control.

[0073] The results are as follows Figure 7As shown, the specific IgY purified from immunized chickens exhibited specific binding to the cat dander allergen antigen. The OD value decreased with increasing dilution factor of the specific IgY, and was significantly higher than the non-specific IgY control from unimmunized chickens at each dilution (n=3), indicating that the immunized chickens successfully produced Fel d1 specific IgY antibody.

[0074] Example 5: Western blot detection of Fel d1-specific IgY

[0075] Using cat dander allergen solutions (Fel d1, etc.) as samples, Western blot experiments were conducted using peripheral serum from immunized and normal chickens as primary antibodies and goat anti-chicken IgY as secondary antibodies to detect whether specific IgY was produced during the initial immunization with the cat dander allergen DNA combined with the booster protein vaccine. The steps are as follows:

[0076] (1) Take peripheral blood from normal chickens and immunized chickens, let stand, centrifuge, and take the supernatant for later use;

[0077] (2) Dilute the Fel d1 antigen sample with 1× loading buffer to prepare an appropriate concentration, add the sample to two SDS gels respectively, and perform SDS-PAGE polyacrylamide gel electrophoresis.

[0078] (3) After the desired molecular weight bands are separated, stop the electrophoresis and transfer the membrane at 250 mA for 90 min.

[0079] (4) Incubate with 5 mL of milk powder blocking solution at room temperature for 2 h;

[0080] (5) Add normal chicken serum (pre-immunization IgY) and immunized chicken serum (post-immunization IgY, diluted 1:1000) to the two membranes respectively, and let them sit overnight at 4°C with gentle shaking;

[0081] (6) Recover the primary antibody, wash the membrane three times with 10 mL TBST, 10 min each time;

[0082] (7) Add HRP-labeled goat anti-chicken IgY secondary antibody and gently shake at room temperature for 1 h;

[0083] (8) Wash the membrane three times with 10 mL TBST, 10 min each time;

[0084] (9) DAB color development, exposure.

[0085] The results are as follows Figure 8As shown (where E0 is pre-immunization IgY, E1 is post-immunization IgY, and the sample added is the supernatant of 293T cells transfected with pCAGGS-Fel d1 plasmid), the membrane incubated with post-immunization IgY showed a specific band at the molecular weight position of Fel d1, while the membrane incubated with pre-immunization IgY did not show a corresponding band. This indicates that the DNA primary immunization combined with protein-enhanced immunization successfully induced the production of Fel d1-specific IgY antibodies.

[0086] Example 6: Inhibitory effect of specific IgY on BEAS-2B cell inflammatory response induced by cat dander allergens.

[0087] 1. Cellular experiments

[0088] (1) After digesting BEAS-2B human bronchial epithelial cells in the logarithmic growth phase with trypsin and centrifuging according to the cell passage method, the concentration was adjusted to 2×10⁻⁶. 5 After gently pipetting and mixing evenly, the cells were spread into 24-well cell plates at a density of 500 μL per well and cultured under the original conditions for 12–24 h.

[0089] (2) Discard the original culture medium, add 500 μL of IgY adjusted to the required concentration with DMEM to the cells in the 24-well plate, culture under the original conditions for 1 h, and leave one group as a blank control; then add 500 μL of cat hair allergen extract (1 mg / mL) adjusted to the required concentration with DMEM, and culture under the original conditions for 3 h.

[0090] (3) Harvest cells according to the needs of downstream experiments.

[0091] 2. Quantitative Real-Time PCR Detection

[0092] Total RNA was extracted from cells and reverse transcribed into cDNA. The diluted cDNA was used for qPCR detection. Triple-well setup was used, with 10 μL of reaction volume per well. The reaction volume is shown in Table 1. Primers were designed based on PrimerBank (https: / / pga.mgh.harvard.edu / primerbank) and synthesized by Shanghai Sangon Biotech Co., Ltd. The primer sequences are shown in Table 2. The reaction procedure is shown in Table 3.

[0093] Table 1 qPCR reaction system

[0094]

[0095] Table 2 qPCR primer sequences

[0096]

[0097] Table 3 qPCR reaction procedure

[0098]

[0099] The relative expression level of the target gene was calculated using the 2^(-ΔΔCt) method, as follows: The arithmetic mean of the Ct values ​​of each group's replicates was taken as the final Ct value for that sample; ΔCt = Ct (target gene) - Ct (internal reference gene); The arithmetic mean of the ΔCt values ​​of the control group was taken as ΔCt (control group); ΔΔCt = ΔCt - ΔCt (control group); The relative expression level of the target gene in the sample = 2^(-ΔΔCt). Where Ct represents the cycle threshold, ΔCt represents the difference in Ct between the target gene and the internal reference gene, and ΔΔCt represents the difference in ΔCt between the experimental group and the control group.

[0100] Experimental results are as follows Figure 9 As shown, BEAS-2B cells pretreated with specific IgY (0.02, 0.1, 0.5 mg / mL) for 1 h, followed by stimulation with cat hair extract (1 mg / mL) for 3 h, showed significantly lower expression levels of IL-6 and IL-8 compared to the cat hair extract-only treatment group (****, p<0.0001), in a dose-dependent manner. Figure 10 As shown (Blank was the unstimulated control group, Fel d1 Alone was the stimulation-only group, n=3), the inhibitory effect of specific IgY on the upregulation of both cytokines was significantly better than that of non-specific IgY (non-immunized IgY) (****, p<0.0001; ns indicates no statistically significant difference). These results indicate that the specific IgY prepared in this invention can effectively neutralize cat dander allergens and inhibit their induced airway epithelial cell inflammatory response.

[0101] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

[0102] SEQ ID NO:1: Fel d1 chain 1 encoding nucleotide sequence (264 bp) ATGTTAGACGCAGCCCTCCCACCCTGCCCTACTGTTGCGGCCACAGCAGATTGTGAAATTTGCCCAGCCGTGAAGAGGGATGTTGACCTATTCCTGACGGGAACCCCCGACGAATATGTTGAGCAAGTGGCACAATACAAAGCACTACCTGTAGTATTGGAAAATGCCAGAATACTGAAGAACTGCGTTGATGCAAAAATGACAGAAGAGGATAAGGAGAATGCTCTCAGCTTGCTGGAC AAAATATACACAAGTCCTCTGTGT SEQ ID NO:2: T2A linker peptide encoding nucleotide sequence (54 bp) GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT SEQ ID NO:3: Fel d1 chain 2 encoding nucleotide sequence (327 bp) ATGAGGGGGCACTGCTTGTGCTGGCATTGCTGGTGACCCAAGCGCTGGGCGTCAAGATGGCGGAAACTTGCCCCATTTTTTATGACGTCTTTTTTGCGGTGGCCAATGGAAATGAATTACTGTTGGACTTGTCCCTCACAAAAGTCAAT GCTACTGAACCAGAGAGAACAGCCATGAAAAAAATCCAGGATTGCTACGTGGAGAACGGACTCATATCCAGGGTCTTGGATGGACTAGTCATGACAACCATCAGCTCCAGCAAAGATTGCATGGGTGAAGCAGTTCAGAACACCGTAGAA GATCTCAAGCTGAACACTTTGGGGAGA SEQ ID NO:4: Full-length nucleotide sequence of DNA vaccine (720 bp, containing Kozak sequence, chain 1 coding gene, T2A coding sequence, chain 2 coding gene, 3×Flag tag coding sequence and stop codon in sequence) GCCACCATGTTAGACGCAGCCCTCCCACCCTGCCCTACTGTTGCGGCCACAGCAGATTGTGAAATTTGCCCAGCCGTGAAGAGGGATGTTGACCTATTCCTGACGGGAACCCCCGACGAATATGTTGAGCAAGTGGCACAATACAAAGCACTACCTGTAGTATTGGAAAATGCCAGAATACTGAAGAACTGCGTTGATGCAAAAATGACAGAAGAGGATAAGGAGAATGCTCTCAGCTTGCTGGACAAAATATACACAAGTCCTCTGTGTGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTATGAGGGGGGCACTGCTTGTGCTGGCATTGCTGGTGACCCAAGCGCTGGGCGTCAAGATGGCGGAAACTTGCCCCATTTTTTATGACGTCTTTTTTGCGGTGGCCAATGGAAATGAATTACTGTTGGACTTGTCCCTCACAAAAGTCAATGCTACTGAACCAGAGAGAACAGCCATGAAAAAAATCCAGGATTGCTACGTGGAGAACGGACTCATATCCAGGGTCTTGGATGGACTAGTCATGACAACCATCAGCTCCAGCAAAGATTGCATGGGTGAAGCAGTTCAGAACACCGTAGAAGATCTCAAGCTGAACACTTTGGGGAGAGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGTGA。

Claims

1. A method for preparing anti-cat allergen egg yolk antibodies using a DNA primary immunization and protein enhancement strategy, characterized in that, The method includes the following steps: (1) Construct a recombinant DNA vaccine plasmid expressing the feline allergen Fel d1, wherein the recombinant DNA vaccine plasmid contains a Fel d1 chain 1 coding gene and a Fel d1 chain 2 coding gene, wherein the chain 1 coding gene and the chain 2 coding gene are linked by a 2A peptide coding sequence; (2) Extraction of cat allergen protein mixture: Cat dander and / or hair were collected, extracted with water, and the resulting extract was precipitated with acetone to obtain cat allergen protein precipitate. After redissolving, cat allergen protein mixture was obtained. (3) The birds are immunized for the first time with the recombinant DNA vaccine plasmid described in step (1), and then at least one booster immunization is performed with the cat allergen protein mixture described in step (2); (4) Collect eggs produced by immunized poultry and isolate and purify egg yolk antibody IgY from the egg yolk.

2. The method according to claim 1, characterized in that, The nucleotide sequence of the Fel d1 chain 1 encoding gene is shown in SEQ ID NO:1, and the nucleotide sequence of the Fel d1 chain 2 encoding gene is shown in SEQ ID NO:3; the 2A peptide is the T2A peptide, and its encoding sequence is shown in SEQ ID NO:

2.

3. The method according to claim 1 or 2, characterized in that, The recombinant DNA vaccine plasmid uses pCAGGS as its starting vector; the recombinant DNA vaccine plasmid also contains a Kozak sequence and a tag protein coding sequence, wherein the tag protein is a 3×Flag tag.

4. The method according to claim 1, characterized in that, Step (2) is as follows: use a vacuum cleaner to collect dander and / or hair from the cat's body surface; place the collected material in sterile distilled water and extract overnight at 4°C with shaking; add acetone pre-cooled at -20°C to the extract at a volume ratio of acetone:extract = 1:4, mix well, and let stand overnight at -20°C; centrifuge at 4°C and 10,000-12,000 rpm for 15-30 min, discard the supernatant, evaporate the acetone, and obtain the cat allergen protein precipitate; redissolve with physiological saline to obtain the cat allergen protein mixture; Preferably, the cat allergen protein mixture contains Fel d1, Fel d4 and Fel d7.

5. The method according to claim 1, characterized in that, The poultry are laying hens; the initial immunization is performed by injecting the recombinant DNA vaccine plasmid into the leg muscles at multiple sites, with a dose of 20 μg per bird; Preferably, the booster immunization is performed once each in the 2nd, 4th and 6th weeks after the initial immunization, with each dose of immunogen being 1 mg / animal, and the immunogen is mixed with an adjuvant before inoculation; the adjuvant is colloidal manganese adjuvant.

6. A recombinant DNA vaccine plasmid expressing the feline allergen Fel d1, characterized in that, It contains a Fel d1 chain 1 encoding gene, a 2A peptide encoding sequence, and a Fel d1 chain 2 encoding gene connected in sequence; the nucleotide sequence of the Fel d1 chain 1 encoding gene is shown in SEQ ID NO:1, the 2A peptide encoding sequence is shown in SEQ ID NO:2, and the nucleotide sequence of the Fel d1 chain 2 encoding gene is shown in SEQ ID NO:

3.

7. The recombinant DNA vaccine plasmid according to claim 6, characterized in that, The recombinant DNA vaccine plasmid contains the nucleotide sequence shown in SEQ ID NO:4; the starting vector is pCAGGS.

8. An anti-cat allergen egg yolk antibody IgY, characterized in that, It is prepared by the method described in any one of claims 1 to 5.

9. The use of the anti-cat allergen egg yolk antibody IgY according to claim 8 in the preparation of products for the prevention and / or relief of cat allergies.

10. The application according to claim 9, characterized in that, The product is cat food, feed additive, or anti-allergy spray.