Monoclonal antibody against g3 gene group porcine bocavirus vp2 protein and hybridoma cell strain and application thereof

CN122832085APending Publication Date: 2026-09-29HENAN UNIV OF URBAN CONSTR
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610558680.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-09-09
Publication Date
2026-09-29

AI Technical Summary

Technical Problem

[0004]目前,实验室检测PBoV的常用方法包括酶联免疫吸附试验(ELISA)、免疫印迹法(Western blot)、免疫荧光法(IFA)等血清学检测技术,由于缺乏高效的特异性抗体,制约了PBoV检测技术的发展

Benefits of technology

[0023]本发明筛选获得了一株能够稳定分泌特异性单克隆抗体的杂交瘤细胞株,该单克隆抗体不仅能够特异性识别G3基因群猪博卡病毒VP2蛋白,与G1、G2基因群无交叉反应,在IPMA、IFA检测中显示出良好的特异性和灵敏度,更重要的是,该抗体还具备体外中和活性,可有效抑制病毒感染细胞。本发明为G3基因群猪博卡病毒的早期诊断、流行病学监测、病原学研究及治疗药物开发提供了关键的核心原材料,具有重要的应用价值。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122832085A_ABST
    Figure CN122832085A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology, specifically relating to a monoclonal antibody targeting the VP2 protein of porcine bocavirus (G3 genogroup), its hybridoma cell line, and its applications. This invention screened and obtained a hybridoma cell line capable of stably secreting a specific monoclonal antibody. This monoclonal antibody not only specifically recognizes the VP2 protein of porcine bocavirus (G3 genogroup) and shows no cross-reactivity with G1 and G2 genogroups, but also exhibits good specificity and sensitivity in IPMA and IFA assays. More importantly, this antibody also possesses in vitro neutralizing activity, effectively inhibiting viral infection of cells. This invention provides key raw materials for the early diagnosis, epidemiological monitoring, etiological research, and therapeutic drug development of porcine bocavirus (G3 genogroup), and has significant application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a monoclonal antibody targeting the VP2 protein of porcine bocavirus in the G3 genotype, its hybridoma cell line, and its applications. Background Technology

[0002] Porcine bocavirus (PBoV) belongs to the genus *Bocavirus* of the subfamily Parvovirinae within the family Parvoviridae. Porcine bocavirus disease does not exhibit a clear seasonality and can occur year-round, with relatively higher morbidity rates in winter and early spring. All breeds and age groups of pigs are susceptible. Furthermore, porcine bocavirus often co-infects with porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV), and porcine reproductive and respiratory syndrome virus (PRRSV). Currently, there are no specific antiviral drugs or commercially available vaccines for PBoV infection; therefore, early and accurate laboratory diagnosis is crucial for the monitoring and control of this disease.

[0003] PBoV is a non-enveloped, single-stranded DNA virus with a genome size of approximately 5.2 kb. It encodes the non-structural proteins NS1 and NP1, and the structural capsid proteins VP1 and VP2. Based on differences in the VP1 gene, PBoV is divided into three gene groups: G1, G2, and G3. Among them, the G3 gene group is widespread in pig herds in my country, causing diarrhea and respiratory diseases, and has become one of the key targets for the prevention and control of viral diseases in pigs.

[0004] Currently, common laboratory methods for detecting PBoV include serological detection techniques such as enzyme-linked immunosorbent assay (ELISA), Western blot, and immunofluorescence assay (IFA). However, the lack of highly efficient specific antibodies has hindered the development of PBoV detection technology.

[0005] Therefore, developing a monoclonal antibody targeting the key antigenic epitopes of the G3 gene cluster PBoV with high specificity and sensitivity is an urgent need to overcome the bottlenecks of existing detection technologies, improve the diagnostic capabilities of PBoV, and promote related research. Summary of the Invention

[0006] The purpose of this invention is to overcome the lack of monoclonal antibodies in the prior art that can specifically recognize the VP2 protein of porcine bocavirus (G3 genogroup) and possess neutralizing activity. Based on this, this invention has obtained a hybridoma cell line that stably secretes a specific monoclonal antibody through screening. This monoclonal antibody not only specifically recognizes the VP2 protein of porcine bocavirus (G3 genogroup) and shows no cross-reactivity with G1 and G2 genogroups, but also exhibits good specificity and sensitivity in IPMA and IFA tests (IFA titer reaches 1:4096). More importantly, this antibody also possesses in vitro neutralizing activity (neutralizing titer reaches 1:32), effectively inhibiting viral infection of cells. This invention provides key raw materials for the early diagnosis, epidemiological surveillance, etiological research, and therapeutic drug development of porcine bocavirus (G3 genogroup).

[0007] The first aspect of the present invention provides a hybridoma cell line 9G6A3, with accession number CCTCC NO:C2025333.

[0008] A second aspect of the present invention provides a monoclonal antibody against the VP2 protein of porcine bocavirus with the G3 genotype, secreted by the hybridoma cell line 9G6A3 described above. It exhibits no cross-reactivity with the VP2 proteins of porcine bocavirus with the G1 and G2 genotypes.

[0009] Furthermore, the monoclonal antibody is of the IgG1 subtype and has a κ light chain.

[0010] A third aspect of the present invention provides a monoclonal antibody that specifically binds to porcine bocavirus of the G3 genotype, wherein the heavy chain variable region of the monoclonal antibody comprises CDR-H1 shown in SEQ ID NO.9, CDR-H2 shown in SEQ ID NO.10, and CDR-H3 shown in SEQ ID NO.11; and the light chain variable region comprises CDR-L1 shown in SEQ ID NO.12, CDR-L2 shown in SEQ ID NO.13, and CDR-L3 shown in SEQ ID NO.14.

[0011] Furthermore, the gene sequence encoding the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.1, and the gene sequence encoding the light chain variable region is shown in SEQ ID NO.2.

[0012] A fourth aspect of the present invention provides a gene encoding the above-mentioned monoclonal antibody, the gene comprising a nucleotide sequence encoding a heavy chain variable region and a nucleotide sequence encoding a light chain variable region;

[0013] The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.1, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.2.

[0014] Furthermore, the gene contains nucleotide sequences encoding heavy chains CDR-H1, CDR-H2, and CDR-H3 as shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively, and nucleotide sequences encoding light chains CDR-L1, CDR-L2, and CDR-L3 as shown in SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively.

[0015] A fifth aspect of the present invention provides a biomaterial selected from any of the following:

[0016] (A) Nucleic acid molecules containing the above-mentioned genes;

[0017] (B) An expression cassette, recombinant vector, host cell, or engineered bacteria containing the nucleic acid molecule described in (A).

[0018] A sixth aspect of the present invention provides an antigen-binding fragment obtained by modifying the above-described monoclonal antibody, wherein the antigen-binding fragment is selected from single-chain antibodies, Fab fragments, F(ab')2 fragments, or single-domain antibodies.

[0019] A seventh aspect of the present invention provides a reagent or kit for detecting or diagnosing porcine bocavirus of the G3 genotype, comprising the above-described monoclonal antibody or the above-described antigen-binding fragment.

[0020] The eighth aspect of the present invention provides the use of the above-described monoclonal antibody, the above-described antigen-binding fragment, or the above-described biological material in the preparation of products for detecting G3 genogroup porcine bocavirus.

[0021] The ninth aspect of the present invention provides the use of the above-described monoclonal antibody, the above-described antigen-binding fragment, or the above-described biological material in the preparation of a medicament for porcine bocavirus of the G3 genotype.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0023] This invention has screened and obtained a hybridoma cell line capable of stably secreting a specific monoclonal antibody. This monoclonal antibody not only specifically recognizes the VP2 protein of porcine bocavirus (G3 genotype) and shows no cross-reactivity with G1 and G2 genotypes, but also exhibits good specificity and sensitivity in IPMA and IFA assays. More importantly, this antibody also possesses in vitro neutralizing activity, effectively inhibiting viral infection of cells. This invention provides key raw materials for the early diagnosis, epidemiological surveillance, etiological research, and therapeutic drug development of porcine bocavirus (G3 genotype), and has significant application value. Attached Figure Description

[0024] Figure 1This is an electrophoresis diagram of purified monoclonal antibody obtained by SDS-PAGE detection according to the present invention.

[0025] Figure 2 The results of IPMA detection of the monoclonal antibody of the present invention and porcine bocavirus of the G3 genotype infected LLC-PK1 cells.

[0026] Figure 3 The results of IFA detection of the monoclonal antibody of the present invention and the porcine bocavirus of the G3 genotype infected LLC-PK1 cells.

[0027] Figure 4 This is a graph showing the IFA titer detection results of the monoclonal antibody of this invention. Detailed Implementation

[0028] The present invention will now be described in further detail with reference to specific embodiments. However, this should not be construed as limiting the scope of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0029] Existing technologies lack monoclonal antibodies that specifically recognize the VP2 protein of porcine bocavirus (G3 genotype) and possess neutralizing activity. Based on this, this invention has obtained a hybridoma cell line that stably secretes a specific monoclonal antibody through screening. This monoclonal antibody not only specifically recognizes the VP2 protein of porcine bocavirus (G3 genotype) and shows no cross-reactivity with G1 and G2 genotypes, but also exhibits good specificity and sensitivity in IPMA and IFA tests (IFA titer reaching 1:4096). More importantly, this antibody also possesses in vitro neutralizing activity (neutralizing titer reaching 1:32), effectively inhibiting viral infection of cells. This invention provides a key raw material for the early diagnosis, epidemiological surveillance, etiological research, and therapeutic drug development of porcine bocavirus (G3 genotype).

[0030] The first aspect of this embodiment provides a hybridoma cell line, Hybridoma cell line 9G6A3, with accession number CCTCC NO:C2025333 and named 9G6A3. This cell line was deposited at the China Center for Type Culture Collection (address: Wuhan University, Wuchang District, Wuhan City, Hubei Province, China) on October 30, 2025.

[0031] This hybridoma cell line uses the G3 genotype porcine bocavirus VP2 protein expressed and purified in *E. coli* as an immunogen (its encoding gene is derived from PBoV G3 216 strain, GenBank accession number PZ244983). Through animal immunization, cell fusion, and subclonal selection using limiting dilution, it was obtained and can stably secrete monoclonal antibodies specifically recognizing the G3 genotype porcine bocavirus VP2 protein. Validation through continuous in vitro passage and cryopreservation-resuscitation showed that the antibody secretion performance of this hybridoma cell line is stable, providing a reliable cell source for the large-scale preparation and widespread application of subsequent monoclonal antibodies. This solves the technical problem of the lack of efficient and stable hybridoma cell lines that secrete monoclonal antibodies against the G3 genotype porcine bocavirus VP2 protein in existing technologies.

[0032] The second aspect of this embodiment provides a monoclonal antibody against the VP2 protein of porcine bocavirus of the G3 genotype, secreted by the hybridoma cell line 9G6A3 described above.

[0033] This monoclonal antibody can specifically recognize the VP2 protein of porcine bocavirus in the G3 genotype, and has no cross-reactivity with the VP2 proteins of porcine bocavirus in the G1 and G2 genotypes. In IPMA and IFA detection, it can specifically bind to the natural viral antigen in virus-infected cells, providing a key antibody tool for antigen detection, infection mechanism research and diagnostic reagent development of porcine bocavirus.

[0034] In some embodiments, the monoclonal antibody subtype is IgG1, and the light chain is a κ chain.

[0035] The third aspect of this embodiment provides a monoclonal antibody that specifically binds to porcine bocavirus of the G3 genotype. The heavy chain variable region of the monoclonal antibody includes CDR-H1 shown in SEQ ID NO.9, CDR-H2 shown in SEQ ID NO.10, and CDR-H3 shown in SEQ ID NO.11; the light chain variable region includes CDR-L1 shown in SEQ ID NO.12, CDR-L2 shown in SEQ ID NO.13, and CDR-L3 shown in SEQ ID NO.14.

[0036] By precisely defining the CDR sequence, this antibody not only exhibits excellent G3 genotype specificity (no cross-reactivity with G1 and G2), but also achieves a high titer of 1:4096 in IFA assays. In in vitro neutralization assays, it effectively inhibits the infection of LLC-PK1 cells by G3 genotype porcine bocavirus, with a neutralization titer of 1:32. This antibody combines high-sensitivity detection activity with virus-neutralizing activity, making it a dual-function anti-G3 genotype porcine bocavirus monoclonal antibody.

[0037] In some embodiments, the gene sequence encoding the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.1, and the gene sequence encoding the light chain variable region is shown in SEQ ID NO.2.

[0038] The fourth aspect of this embodiment provides a gene encoding the above-mentioned monoclonal antibody, the gene comprising a nucleotide sequence encoding a heavy chain variable region and a nucleotide sequence encoding a light chain variable region;

[0039] The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.1, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.2.

[0040] The disclosure of this gene enables those skilled in the art to recombine and express the monoclonal antibody or its derivatives through genetic engineering, achieving large-scale antibody production without relying on hybridoma cell lines. It also provides a molecular basis for further humanization, affinity maturation, and functional optimization of the antibody, expanding its application prospects in the fields of diagnosis and treatment.

[0041] In some embodiments, the gene comprises nucleotide sequences encoding heavy chains CDR-H1, CDR-H2, and CDR-H3 as shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively, and nucleotide sequences encoding light chains CDR-L1, CDR-L2, and CDR-L3 as shown in SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively.

[0042] The fifth aspect of this embodiment provides a biomaterial, the biomaterial being selected from any of the following:

[0043] (A) Nucleic acid molecules containing the above-mentioned genes;

[0044] (B) An expression cassette, recombinant vector, host cell, or engineered bacteria containing the nucleic acid molecule described in (A).

[0045] This biomaterial constitutes a complete technological chain from gene to protein expression, enabling monoclonal antibodies to be produced efficiently through recombinant expression systems (such as CHO cells, HEK293 cells, or E. coli). It provides multiple alternatives for industrial preparation, reduces production costs, improves production flexibility, and meets the needs of different application scenarios for antibody raw materials.

[0046] The sixth aspect of this embodiment provides an antigen-binding fragment obtained by modifying the above-mentioned monoclonal antibody. The antigen-binding fragment is selected from single-chain antibodies, Fab fragments, F(ab')2 fragments, or single-domain antibodies. This antigen-binding fragment retains the antigen-binding specificity of the original monoclonal antibody while possessing advantages such as small molecular weight, strong tissue penetration, and low immunogenicity, making it suitable for specific applications such as immunoassay, in vivo imaging, and targeted therapy.

[0047] The seventh aspect of this embodiment provides a reagent or kit for detecting or diagnosing porcine bocavirus of the G3 genotype, comprising the aforementioned monoclonal antibody or the aforementioned antigen-binding fragment. Based on the high specificity and high sensitivity (IFA titer 1:4096, no cross-reactivity with G1 and G2) of the monoclonal antibody of this invention, this reagent or kit can be used on various detection platforms such as immunoperoxidase monolayer assay, indirect immunofluorescence assay, or enzyme-linked immunosorbent assay, enabling early, rapid, and accurate detection of porcine bocavirus of the G3 genotype. This provides a reliable tool for epidemiological monitoring, epidemic early warning, and evaluation of control effectiveness of porcine bocavirus, and has good prospects for commercial application.

[0048] The eighth aspect of this embodiment provides the application of the aforementioned monoclonal antibody, antigen-binding fragment, or biological material in the preparation of products for detecting G3 genogroup porcine bocavirus. This application covers the direct detection of viral antigens, including but not limited to the preparation of ELISA kits, immunofluorescence kits, and immunochromatographic test strips. Compared with existing indirect detection methods based on VP1 peptide detection of serum antibodies, the detection product of this invention can directly detect viral antigens, resulting in more accurate and reliable results. Furthermore, it can distinguish between G3 genogroup infections and infections of other genogroups, providing a powerful tool for the accurate diagnosis and epidemiological investigation of G3 genogroup porcine bocavirus in swine herds.

[0049] The ninth aspect of this embodiment provides the application of the aforementioned monoclonal antibody, antigen-binding fragment, or biological material in the preparation of a drug for neutralizing G3 genotype porcine bocavirus. This monoclonal antibody exhibits a neutralizing titer of 1:32 in an in vitro neutralization assay, effectively inhibiting G3 genotype porcine bocavirus infection of LLC-PK1 cells. Therefore, this antibody can be used not only for diagnosis but also as an active ingredient in therapeutic or prophylactic drugs for the preparation of antiviral drugs that neutralize G3 genotype porcine bocavirus, providing a novel technology for the prevention and treatment of porcine bocavirus disease.

[0050] To provide a clearer understanding of the above technical solutions, the following more detailed implementation examples are provided for further explanation.

[0051] Example 1

[0052] Obtaining hybridoma cells that secrete monoclonal antibodies against porcine bocavirus

[0053] 1.1 Animal Immunization

[0054] Healthy female BALB / c mice aged 6-8 weeks were selected. The VP2 protein of porcine bocavirus (PBoV) of the G3 genotype, expressed and purified using an E. coli expression system, was used as the immunogen. The VP2 protein sequence was derived from the reference strain PBoV G3 216 of PBoV, with GenBank accession number PZ244983. The immunogen was thoroughly mixed with an equal volume of Quick Antibody-Mouse 5W adjuvant and administered via intramuscular injection in the leg at a dose of 100 μL per mouse. A second immunization was administered 21 days after the first immunization, using the same dose and method. Fourteen days after the second immunization, peripheral blood was collected via the tail vein, serum was separated, and serum antibody titers were determined using an indirect ELISA method. Mice with the highest antibody titers were selected and given a shock immunization 3 days before cell fusion via intraperitoneal injection of 100 μL of inactivated PBoV of the G3 genotype.

[0055] 1.2 Cell Fusion and Culture

[0056] Before performing cell fusion, BALB / c mice with the highest serum antibody levels after immunization were selected. The mice were euthanized by cervical dislocation, soaked in 75% alcohol for 5 min, and their abdomens were cut open to remove the spleen. The spleen was placed on a cell sieve and then ground with the core of a sterile syringe. An appropriate amount of preheated, FBS-free DMEM cell culture medium was added, and the mixture was filtered through the cell sieve to obtain a spleen cell suspension. This suspension was centrifuged at 1200 rpm for 10 min, the supernatant was discarded, and the bottom of the test tube was gently tapped. SP2 / 0 cell suspension (spleen cells to myeloma cells ratio 10:1) was added, mixed, and centrifuged at 1200 rpm for 10 min. The supernatant was discarded, and the tube was placed in a 37°C water bath. 1 mL of preheated PEG-1450 was added along the tube wall. Then, preheated, FBS-free DMEM cell culture medium was added to bring the volume to 15 mL, and the tube was incubated at 37°C for 5 min. Finally, 25 mL of preheated, FBS-free DMEM cell culture medium at 37°C was added. Centrifuge at 1000 rpm for 10 min, discard the supernatant, add preheated serum-free culture medium containing HAT for HybGro hybridoma cells, resuspend the cells and seed them into 96-well cell culture plates at a rate of 200 μL / well, and incubate at 37°C in a 5% CO2 incubator.

[0057] 1.3 Screening and subcloning of hybridoma cells secreting porcine bocavirus monoclonal antibodies

[0058] On day 4 after cell fusion, half of the pre-warmed serum-free medium containing HAT for HybGro hybridoma cells was replaced. This process was repeated 7–8 days later. When cell clones grew to 1 / 3–1 / 2 of the well bottom area, the supernatant was collected and coated with an ELISA plate containing purified G3 genotype porcine bocavirus VP2 protein expressed in *E. coli*. Wells showing positive antibodies were detected using a standard ELISA method. Further limiting dilution was used to perform three subclonal cultures of the cells in each well to ensure 100% positivity for porcine bocavirus monoclonal antibodies.

[0059] A hybridoma cell line that stably secretes porcine bocavirus-specific monoclonal antibodies was obtained through screening and named 9G6A3. This cell line was deposited at the China Center for Type Culture Collection (CCTCC) on October 30, 2025 (address: Wuhan University, Wuchang District, Wuhan, Hubei Province, China), with accession number CCTCC NO:C2025333.

[0060] Example 2

[0061] Preparation and purification of mouse ascites antibodies

[0062] 2.1 Preparation of mouse ascites antibodies

[0063] Female BALB / c mice weighing over 20 g and aged 8-10 weeks were selected and injected intraperitoneally with 0.5 mL of ascites adjuvant. After sensitization for 15 days, the selected hybridoma cell line 9G6A3 was expanded and cultured, followed by culturing at a rate of 1×10⁻⁶ cells / mL. 6 Inject 1000 cells / mouse into the peritoneal cavity of BALB / c mice. The specific procedure is as follows: First, collect cells in the logarithmic growth phase, centrifuge at 1000 rpm for 5 min, wash repeatedly with PBS 2-3 times, discard the supernatant, and then resuspend the monoclonal hybridoma cells in sterile PBS buffer. Adjust the cell concentration to 500 μL (1×10⁻⁶ cells / mouse) per mouse. 6 The mice were injected intraperitoneally with a cell quantity of (number of cells). About 7 days after the injection, the mice's abdomen began to swell, and they needed to be observed daily. When the mice showed obvious abdominal distension and difficulty walking, the ascites fluid was collected. The collected ascites fluid was centrifuged at 10,000 rpm for 10 min at 4°C. The lower sediment and the surface oil were discarded, and the clear middle layer of ascites fluid was retained and frozen at -80°C for later use.

[0064] 2.2 Purification of mouse ascites antibodies

[0065] Select a dialysis bag with a molecular weight cutoff of 14 kDa, cut it into small segments of about 10 cm, and boil it in a 1 mM EDTA solution (pH=8.0) containing 2% NaHCO3 for 10 min. Then rinse it thoroughly with distilled water, cool it and soak it in distilled water for later use.

[0066] Add 1 mL of ascites fluid to a beaker, then add 2 mL of PBS for dilution. Place the beaker on ice. Slowly add 3 mL of saturated ammonium sulfate solution dropwise while stirring until the ammonium sulfate concentration reaches 50%. Continue stirring at 4°C for 2 h. Then centrifuge at 10,000 rpm for 10 min, discard the supernatant, resuspend the precipitate in 2 mL of PBS, and place it in a dialysis bag. Seal both ends of the dialysis bag, and then dialyze the antibody sample overnight at 4°C with PBS, changing the PBS 1-2 times during the process.

[0067] Centrifuge the crude antibody extract after dialysis at 10,000 rpm for 5 min and collect the supernatant; mix Protein A and GGAgarose thoroughly, add 2 mL to the purification column, and then wash the column with PBS until the absorbance of the eluent at OD 280 nm (OD) is [value missing]. 280 The concentration of the crude antibody extract after dialysis is close to 0. The crude antibody sample is added to the column, the flow rate is controlled slowly, and the eluent is collected. This process is repeated 5 times. Then, impurities are eluted with PBS, followed by the target antibody with glycine solution. The eluent is collected in a sterile centrifuge tube and immediately neutralized to pH 7-8 with Tris-HCl. Finally, the sample is dialyzed overnight with PBS at 4°C, changing the PBS 1-2 times. The purified target antibody is then collected, and an appropriate amount of glycerol is added to bring the final concentration to 50%. The mixture is thoroughly and gently mixed, then aliquoted and stored at -80°C.

[0068] SDS-PAGE analysis of the purified antibody sample revealed two clear bands at approximately 55 kDa and 25 kDa after Coomassie brilliant blue staining (see [link to analysis]). Figure 1 ), which correspond to the heavy chain and light chain of the antibody, respectively. Figure 1 In the diagram, lane 1 represents the protein molecular weight marker; lane 2 represents the ascites fluid sample before purification; and lane 3 represents the monoclonal antibody sample purified by Protein G affinity. The results showed that only two clear bands appeared in lane 3, corresponding to the antibody heavy chain (approximately 55 kDa) and light chain (approximately 25 kDa), respectively, indicating good antibody purity after purification.

[0069] The concentration of purified antibody protein was determined using an extreme ultraviolet spectrophotometer, and the concentration of the purified protein was 0.5 mg / mL.

[0070] Example 3

[0071] Identification of monoclonal antibody subtypes and determination of variable region gene sequences

[0072] 3.1 Monoclonal antibody subtype identification

[0073] The purified monoclonal antibody Ig subtypes were identified according to the instructions of the mouse monoclonal antibody subtype identification kit (purchased from Bio-Rad Laboratories, catalog number BF16001). The identification results are shown in Table 1. The heavy chain of the purified monoclonal antibody was IgG1, and the light chain was κ chain.

[0074] Table 1. Subtype identification results of monoclonal antibodies

[0075]

[0076] 3.2 Determination of the variable region sequence of monoclonal antibodies

[0077] mRNA was extracted from hybridoma cell line 9G6A3, reverse transcribed into cDNA, and then amplified by high-fidelity PCR using universal primers for the variable region. The PCR product was then sequenced. DNA sequencing results (verified by Sanger bidirectional sequencing): The gene sequence encoding the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.1, and the gene sequence encoding the light chain variable region is shown in SEQ ID NO.2.

[0078] SEQ ID NO.1: CAGGTCCAACTGCAGCAACCTGGGTCTGAACTGGTGAGGCCTGGAACTTCAGTGAACCTGTCCTGCAAGGCTTCTGGCTACACATTCACCAACTACTGGATGCACTGGGTGAAACAGAGGCATGGACAAGGCCTTGAATGGATTGGAAATATTTATCCTGGTAGTGGTTATACTAACTA CGATGAGAAGTTCAAGAACAAGGGCACACTGACTGTAGACACATCCTCCAGCACAGCCTACTTGCACCTCAGCAGCCTGACATCTGAAGACTCTGCGATCTATTACTGTACAAGACTGGATGGTCACACTAGGGCTTACTACTTTGACTCCTGGGGCCAAGGCACCACTCTCAAAGTCTCCTCA.

[0079] SEQ ID NO.2: CAAATTGTTCTCACCCAGTCTCCAGCTATCATGTCTGCATCTCTTGGGGAACGGGTCACCATGACCTGCACTGCCAGCTCAAGTGTAAGTTCCAGTTACTTCCACTGGTACCAGCAGAAGCCAGGATCCTCCCCCAAACTCTGGATTTATAGCACATCCA ACCTGGCTTCTGGAGTCCCATCTCGCTTCAGTGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAACAGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCACCAGTATCATCGTTCCCCACTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAA.

[0080] in,

[0081] The monoclonal antibody recognizes the major structural protein VP2 of porcine bocavirus (PBoV) of the G3 genotype; the nucleotide sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region VH of the monoclonal antibody are SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively, and the nucleotide sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region VL of the monoclonal antibody are SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, respectively.

[0082] SEQ ID NO.3: GGCTACACATTCACCAACTACTGG;

[0083] SEQ ID NO.4: ATTTATCCTGGTAGTGGTTATACT;

[0084] SEQ ID NO.5: ACAAGACTGGATGGTCACACTAGGGCTTACTACTTTGACTCC;

[0085] SEQ ID NO.6: TCAAGTGTAAGTTCCAGTTAC;

[0086] SEQ ID NO.7: AGCACATCC;

[0087] SEQ ID NO. 8: CACCAGTATCATCGTTCCCCACTCACG.

[0088] The amino acid sequences of CDR-H1, CDR-H2, and CDR-H3 of the heavy chain variable region VH of the monoclonal antibody are SEQ ID NO.9, SEQ ID NO.10, and SEQ ID NO.11, respectively, and the amino acid sequences of CDR-L1, CDR-L2, and CDR-L3 of the light chain variable region VL of the monoclonal antibody are SEQ ID NO.12, SEQ ID NO.13, and SEQ ID NO.14, respectively, and the light chain of the antibody is a κ chain.

[0089] SEQ ID NO.9: GYTFTNYW;

[0090] SEQ ID NO.10: IYPGSGYT;

[0091] SEQ ID NO.11: TRLDGHTRAYYFDS;

[0092] SEQ ID NO.12: SVSSSY;

[0093] SEQ ID NO.13: STS;

[0094] SEQ ID NO.14: HQYHRSPLT.

[0095] Example 4

[0096] 4.1 Immunoperoxidase monolayer assay (IPMA) detection

[0097] LLC-PK1 cells in good growth condition were seeded into 24-well plates containing cell spreaders and cultured to approximately 70%–80% confluence. Then, they were inoculated with the porcine bocavirus strain PBoV G3 216 (GenBank accession number for its VP2 gene sequence: PZ244983) isolated in our laboratory (GenBank accession number for this strain). Uninfected cells served as a negative control. After virus adsorption for 2 hours, the maintenance medium was replaced, and the cells were cultured for another 24 hours. Cell spreaders were removed after infection, washed three times with PBS, and fixed for 10 minutes with methanol containing 3% H2O2 pre-cooled at 4°C. Then, appropriately diluted monoclonal antibody of this invention was added, and the cells were incubated at 37°C for 1 hour. After washing with PBS, HRP-labeled goat anti-mouse IgG secondary antibody diluted 1:1000 was added, and the cells were incubated at 37°C for 30 minutes. After washing, AEC staining was performed, and the results were observed under a light microscope. The results are as follows: Figure 2 show, Figure 2 In the diagram, A represents the positive control group. Specific staining signals were present in virus-infected cells, indicating that the antibody could bind to natural viral particles. Figure 2B in the diagram represents the negative control group, which was not infected with the virus and showed no specific staining. This indicates that the antibody has good binding specificity to the natural viral antigens in virus-infected cells. The virus-infected group cells showed obvious red specific staining, while the negative control group cells showed no specific staining, indicating that the monoclonal antibody of this invention can specifically recognize the natural viral antigens in cells infected with G3 genotype porcine bocavirus.

[0098] 4.2 Indirect Immunofluorescence Assay (IFA)

[0099] Infected and control LLC-PK1 cell slides were collected. After 24 h of infection, the cells were removed, washed three times with PBS, fixed with 4% paraformaldehyde for 15 min, washed again with PBS, permeabilized with 0.1% Triton X-100 for 10 min, and then blocked with 5% BSA at room temperature for 30 min. Appropriately diluted monoclonal antibody of this invention was added, and the slides were incubated at 37°C for 1 h. After washing three times with PBS, Alexa Fluor488-labeled Goat Anti-Mouse IgG (H) fluorescent secondary antibody was added, and the slides were incubated at 37°C for 45 min in the dark. After washing, the slides were mounted with anti-fluorescence quenching mounting medium and observed under a fluorescence microscope. The results are as follows: Figure 3 The display shows that, Figure 3 In the diagram, A represents the positive control group, where a specific green fluorescent signal distribution is visible in virus-infected cells. Figure 3 In Figure B, the negative control group shows no fluorescence signal in uninfected negative control cells. Figure A shows the positive control group, where specific green fluorescence signals are visible in virus-infected cells; Figure B shows the negative control group, where no fluorescence signal is visible in uninfected negative control cells. Clear and specific green fluorescence signals are visible in virus-infected cells, while no fluorescence signals are observed in negative control cells. This demonstrates that the monoclonal antibody of this invention can specifically detect viral antigens in cells infected with G3 genotype porcine bocavirus. It further indicates that the monoclonal antibody of this invention can specifically recognize natural antigens in virus-infected cells.

[0100] In summary, the monoclonal antibody of this invention exhibits good specificity and sensitivity in both IPMA and IFA detection, and can be used for laboratory detection, infection monitoring, etiological research, and preparation of related detection reagents or kits for G3 genogroup porcine bocavirus.

[0101] Example 5

[0102] Validation of the specificity of monoclonal antibodies against VP2 protein of porcine bocavirus from different genotypes

[0103] The VP2 proteins of porcine bocavirus (Porcine Bocavirus) of the G1, G2, and G3 genera groups, expressed and purified using an E. coli expression system, were diluted at a concentration of 0.5 μg / mL with carbonate coating buffer (0.05 M, pH 9.6) and added to 96-well high-binding ELISA plates, 100 μL per well, with 3 replicates per group. The plates were incubated overnight at 4°C. A negative control well was included (containing only the coating buffer, without the antigen). All other procedures and conditions were the same as the experimental group. After discarding the coating buffer, the plates were washed three times with PBST and blocked with 5% skim milk at 37°C for 2 h.

[0104] After blocking, the blocking solution was discarded, and the monoclonal antibody of this invention was added as the primary antibody. The plate was incubated at 37°C for 1 h. After washing three times with PBST, 100 μL of HRP-labeled goat anti-mouse IgG secondary antibody (1:8000 dilution) was added to each well, and the plate was incubated at 37°C for 1 h. The plate was washed four times again with PBST, dried, and 100 μL of TMB chromogenic solution was added to each well. The plate was incubated at room temperature in the dark for 10 min, and then 50 μL of stop solution was added to each well to terminate the reaction. The absorbance (OD450) of each well was measured at 450 nm using a microplate reader. Referring to the generally accepted ELISA standards, 2.1 times the average OD450 value of the negative control wells was used as the positive threshold. A sample well with an average OD450 value ≥ the threshold was considered positive, and a sample well with an average OD450 value < the threshold was considered negative. This method was used to determine the reactivity of the monoclonal antibody of this invention to the VP2 protein of porcine bocavirus in different gene groups.

[0105] The results are shown in Table 2. The average OD450 value of the monoclonal antibody of this invention applied to wells coated with the VP2 protein of porcine bocavirus in the G3 genogroup was significantly higher than the positive threshold, indicating a clear specific binding reaction. However, the average OD450 value of the wells coated with the VP2 protein of porcine bocavirus in the G1 and G2 genogroups was lower than the positive threshold, and there was no significant difference in absorbance between the wells and the negative control wells, indicating no significant binding reaction. These results demonstrate that the monoclonal antibody of this invention can specifically recognize the VP2 protein of porcine bocavirus in the G3 genogroup, while showing no cross-reactivity with the VP2 protein of porcine bocavirus in the G1 and G2 genogroups, exhibiting good G3 genogroup specificity.

[0106] Table 2. ELISA detection results of the monoclonal antibody of the present invention against VP2 protein of porcine bocavirus from different gene groups.

[0107]

[0108] Note: The threshold for positive results was 2.1 times the average OD450 value of the negative control (0.23 in this experiment).

[0109] Example 6

[0110] IFA titer assay for monoclonal antibodies

[0111] LLC-PK1 cells in good growth condition were seeded into 24-well plates containing cell spreaders and cultured to approximately 70%–80% confluence. Then, they were inoculated with porcine bocavirus (G3 genotype) solution, with uninfected cells serving as a negative control. After virus adsorption for 2 hours, the maintenance medium was replaced, and the cells were cultured for another 24 hours. Cell spreaders were removed after infection, washed three times with PBS, fixed with 4% paraformaldehyde for 15 minutes, washed with PBS, permeabilized with 0.1% Triton X-100 for 10 minutes, and then blocked with 5% BSA at room temperature for 30 minutes. The ascites monoclonal antibody prepared and purified in Example 2 was serially diluted with PBS (1:128–1:8192) and added to the infected cell spreaders. The cells were incubated at 37°C for 1 hour. The negative control cells were also incubated with a 1:128 diluted primary antibody. After washing three times with PBS, Alexa Fluor 488-labeled Goat Anti-Mouse IgG (H) fluorescent secondary antibody was added, and the cells were incubated at 37°C for 45 minutes in the dark. After washing, the slides were mounted using an anti-fluorescence quenching mounting medium, and the results were observed under a fluorescence microscope.

[0112] The results are as follows Figure 4 As shown, Figure 4 The figures below represent the IFA detection results at antibody dilutions of 1:128, 1:256, 1:512, 1:1024, 1:2048, 1:4096, and 1:8192, respectively. The last figure shows the negative control in uninfected cells. The results show that a distinct specific green fluorescent signal was still observed at a dilution of 1:4096, while the fluorescence signal disappeared at a dilution of 1:8192. No specific fluorescent signal was observed in the negative control group. This indicates that the IFA detection titer of the monoclonal antibody of this invention is 1:4096, exhibiting good detection sensitivity and suitable for the specific detection of viral antigens in G3 genogroup porcine bocavirus-infected cells.

[0113] Example 7

[0114] Detection of neutralizing activity of monoclonal antibodies against porcine bocavirus of the G3 genotype.

[0115] LLC-PK1 cells in good growth condition were seeded into 96-well plates and cultured until a monolayer formed. The ascites monoclonal antibody (concentration 0.5 mg / mL) prepared and purified in Example 2 was serially diluted 2-fold with serum-free DMEM and mixed with an equal volume of a fixed dose of G3 genotype porcine bocavirus solution. The mixture was incubated at 37°C for 2 h to allow for sufficient antibody-virus reaction. The antibody-virus mixture was then seeded into the LLC-PK1 cell monolayer for adsorption for 2 h. After discarding the inoculum, serum-free DMEM containing 0.3–0.5 μg / mL trypsin was added for maintenance culture. Cell control, virus control, and antibody control groups were also included in the experiment.

[0116] Table 3. Results of in vitro neutralizing activity of the monoclonal antibody of this invention against porcine bocavirus of the G3 genotype.

[0117]

[0118] Note: Cell protection rate = number of wells without CPE / total number of wells × 100%.

[0119] Cells were cultured for 5–7 days after inoculation, and cytopathic effect (CPE) was observed daily. Cell protection at various antibody dilutions is shown in Table 3. At dilutions of 1:4–1:16, no obvious cytopathic effect was observed, with a protection rate of 100%. At a dilution of 1:32, approximately 50% of the cell wells showed no cytopathic effect. At dilutions of 1:64 and above, the cell protection rate further decreased, until all cells showed cytopathic effect at a dilution of 1:128. The antibody control group (1:4 dilution) showed normal cell morphology and no obvious cytopathic effect, indicating that the monoclonal antibody has no significant toxicity to cells at higher concentrations. The neutralizing titer of the monoclonal antibody of this invention, calculated using the Reed-Muench method, was 1:32, indicating that the monoclonal antibody of this invention has good in vitro neutralizing activity against G3 genogroup porcine bocavirus.

[0120] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A hybridoma cell line, characterized in that, The accession number is CCTCC NO:C2025333.

2. A monoclonal antibody secreted by the hybridoma cell line of claim 1, characterized in that, The monoclonal antibody specifically binds to the VP2 protein of porcine bocavirus in the G3 genotype.

3. The monoclonal antibody according to claim 2, characterized in that, The monoclonal antibody is of the IgG1 subtype and has a κ light chain.

4. A monoclonal antibody that specifically binds to porcine bocavirus of the G3 genotype, characterized in that, The heavy chain variable region of the monoclonal antibody includes CDR-H1 shown in SEQ ID NO.9, CDR-H2 shown in SEQ ID NO.10, and CDR-H3 shown in SEQ ID NO.11; the light chain variable region includes CDR-L1 shown in SEQ ID NO.12, CDR-L2 shown in SEQ ID NO.13, and CDR-L3 shown in SEQ ID NO.

14.

5. The monoclonal antibody according to claim 4, characterized in that, The gene sequence encoding the heavy chain variable region of the monoclonal antibody is shown in SEQ ID NO.1, and the gene sequence encoding the light chain variable region is shown in SEQ ID NO.

2.

6. A gene encoding the monoclonal antibody according to any one of claims 2-5, characterized in that, The gene contains a nucleotide sequence encoding the heavy chain variable region and a nucleotide sequence encoding the light chain variable region; The nucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.1, and the nucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.

2.

7. A biomaterial, characterized in that, The biomaterial is selected from any one of the following: (A) A nucleic acid molecule containing the gene of claim 6; (B) An expression cassette, recombinant vector, host cell, or engineered bacteria containing the nucleic acid molecule described in (A).

8. An antigen-binding fragment obtained by modifying the monoclonal antibody according to any one of claims 2-5, characterized in that, The antigen-binding fragment is selected from single-chain antibodies, Fab fragments, F(ab')2 fragments, or single-domain antibodies.

9. A reagent or kit for detecting or diagnosing porcine bocavirus of the G3 genotype, characterized in that, It comprises the monoclonal antibody according to any one of claims 2-5 or the antigen-binding fragment according to claim 8.

10. The use of the monoclonal antibody of any one of claims 2-5, the antigen-binding fragment of claim 8, or the biological material of claim 7 in the preparation of products for detecting G3 genotype porcine bocavirus, and / or in the preparation of medicaments for detecting G3 genotype porcine bocavirus.