A recombinant pichia pastoris strain with high lactoferrin production and a construction method and application thereof

Abstract

The application discloses a recombinant Pichia pastoris strain with high human lactoferrin yield and a construction method and application thereof. A human lactoferrin expression frame is integrated into the genome of the recombinant Pichia pastoris strain, the expression frame is driven by an AOX1 promoter, and at least one of SP25, alphaOPT, W1 or SP16 is used to replace the original alpha-factor signal peptide to drive efficient secretion of human lactoferrin; and the protein secretion auxiliary factor GCN4 and / or SSA4 can be further co-expressed to assist correct folding of proteins. It is verified that the synergistic combination of SP25 and GCN4 is optimal, the yield of shake flask fermentation reaches 164.8 mg / L, which is about 20 times higher than that of the strain containing only the original signal peptide; and the yield of a 10 L fermenter reaches 1.5 g / L. The application provides an efficient platform for industrial production of recombinant human lactoferrin.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and fermentation engineering technology, specifically relating to a recombinant Pichia pastoris strain that produces high levels of human lactoferrin, its construction method, and its application. Background Technology

[0002] Human lactoferrin (hLTF) is an iron-binding glycoprotein belonging to the transferrin family. Composed of 703 amino acids with a molecular weight of approximately 80 kDa, its protein structure includes two globular domains, N-lobes and C-lobes, with its secondary structure primarily composed of alternating α-helices and β-sheets. HLTF possesses broad-spectrum antibacterial, antiviral, immunomodulatory, iron absorption-promoting, and antioxidant activities. Due to its excellent functional properties, it is widely used in infant formula, functional beverages, fermented foods, cosmetics, and medical excipients, with a promising market prospect.

[0003] Currently, commercially available human lactoferrin is mainly produced through extraction from bovine milk. However, the natural lactoferrin content in bovine milk is only 0.03 g / L to 0.49 g / L, resulting in low raw material utilization, complex extraction processes, and high production costs. Furthermore, bovine milk-derived lactoferrin is a heterologous protein, posing potential immunogenicity risks when applied to human health, significantly limiting its widespread application in high-tech fields such as food and medicine.

[0004] Heterologous expression by microorganisms is a core technological approach to replace natural extraction and achieve large-scale production of human lactoferrin. E. coli expression systems lack post-translational modification capabilities, resulting in expression products that cannot fold correctly, making it difficult to obtain bioactive, soluble human lactoferrin. Mammalian and plant cell expression systems have long culture cycles, stringent culture conditions, and extremely high industrialization costs, making them unsuitable for large-scale production.

[0005] Pichia pastoris is currently the preferred host for recombinant eukaryotic protein expression, possessing advantages such as rapid growth, low culture cost, and simple operation. It can perform post-translational modifications such as protein glycosylation and folding, ensuring the biological activity of recombinant proteins. Existing technologies have improved human lactoferrin expression levels through codon optimization, single signal peptide modification, single-type molecular chaperone overexpression, multi-copy gene integration, and promoter optimization. For example, the CN119776401B heterozygous signal peptide can increase fermentation yield by 1.2 g / L.

[0006] However, the existing approaches still have shortcomings in the following aspects: First, the existing signal peptide replacement strategies mainly focus on the hybridization of α-factor leader peptides, and the systematic evaluation and screening of non-hybrid heterologous signal peptides for hLTF secretion efficiency is incomplete; Second, the reported folding accessory proteins are classic molecular chaperones in the ER lumen, and the potential of functional proteins such as GCN4, which regulate protein translation and metabolic stress response, in promoting efficient hLTF secretion has not been fully explored; Third, the existing research on the synergistic combination optimization of signal peptides and protein secretion cofactors is not systematic, and the optimal synergistic strategy is not yet clear, which limits the further improvement of hLTF production.

[0007] Based on the above problems, it is still necessary to develop new Pichia pastoris engineered strains that have undergone systematic screening and optimization in order to achieve gram-level high-efficiency secretion expression of hLTF. Summary of the Invention

[0008] The technical problem to be solved by this invention is: how to systematically screen the optimal signal peptide adapted to the extracellular secretion of human lactoferrin in Pichia pastoris, and how to screen protein secretion cofactors that can effectively assist human lactoferrin in correct folding and efficient secretion, and further determine the optimal combination of synergistic effect of signal peptide and protein secretion cofactors, so as to construct a genetically engineered Pichia pastoris strain that can efficiently and stably express and secrete human lactoferrin, laying the foundation for the gram-level industrial production of human lactoferrin.

[0009] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0010] In a first aspect, the present invention provides a recombinant Pichia pastoris strain that produces high levels of human lactoferrin, wherein the genome of the recombinant Pichia pastoris strain integrates a human lactoferrin expression cassette, the human lactoferrin expression cassette comprising, in sequence, an AOX1 promoter, a signal peptide coding sequence, and a human lactoferrin coding gene; wherein the signal peptide is selected from at least one of SP25, αOPT, W1, and SP16.

[0011] The amino acid sequence of SP25 is shown in SEQ ID NO.3, and the nucleic acid sequence is shown in SEQ ID NO.4; the amino acid sequence of αOPT is shown in SEQ ID NO.5, and the nucleic acid sequence is shown in SEQ ID NO.6; the amino acid sequence of W1 is shown in SEQ ID NO.7, and the nucleic acid sequence is shown in SEQ ID NO.8; the amino acid sequence of SP16 is shown in SEQ ID NO.9, and the nucleic acid sequence is shown in SEQ ID NO.10.

[0012] As a preferred embodiment of the present invention, the genome of the recombinant Pichia pastoris strain further integrates a protein secretion cofactor gene, wherein the protein secretion cofactor gene is selected from at least one of GCN4, SSA4, UBC1, SEC53 and SSO1.

[0013] As a preferred embodiment of the present invention, the protein secretion cofactor gene is GCN4 and / or SSA4; the amino acid sequence of GCN4 is shown in SEQ ID NO.17, and the nucleic acid sequence is shown in SEQ ID NO.18; the amino acid sequence of SSA4 is shown in SEQ ID NO.19, and the nucleic acid sequence is shown in SEQ ID NO.20.

[0014] As a preferred embodiment of the present invention, the signal peptide is SP25 and the protein secretion cofactor gene is GCN4.

[0015] As a preferred technical solution of the present invention, the Pichia pastoris strain is Pichia pastoris X-33.

[0016] As a preferred embodiment of the present invention, the human lactoferrin encoding gene is a nucleic acid sequence optimized by Pichia pastoris codons, and the nucleic acid sequence is shown in SEQ ID NO.2, encoding the human lactoferrin amino acid sequence shown in SEQ ID NO.1.

[0017] As a preferred embodiment of the present invention, the protein secretion cofactor gene driver promoter is the GAP promoter.

[0018] In a second aspect, the present invention provides a recombinant expression vector, which further comprises the encoding genes of protein secretion cofactors GCN4 and / or SSA4, the amino acid sequences of GCN4 and SSA4 being shown in SEQ ID NO.17 and SEQ ID NO.19, respectively.

[0019] Thirdly, the present invention provides a method for constructing the above-mentioned recombinant Pichia pastoris strain that produces high levels of human lactoferrin, comprising the following steps:

[0020] (1) Using pPICZαA as the vector backbone, the signal peptide coding sequence was linked to the 5' end of the human lactoferrin coding gene optimized by Pichia pastoris codons to construct a human lactoferrin recombinant expression vector containing the AOX1 promoter; the signal peptide was selected from at least one of SP25, αOPT, W1 and SP16;

[0021] (2) The recombinant expression vector obtained in step (1) was linearized with restriction endonuclease and introduced into Pichia pastoris X-33 competent cells by electroporation.

[0022] (3) The transformed cells were spread on YPDS solid medium containing bleomycin and cultured at 30°C for 5 days. Positive transformants were screened and activated by rescreening to obtain the recombinant Pichia pastoris strain.

[0023] As a preferred technical solution of the present invention, in step (1), the encoding genes of protein secretion cofactors GCN4 and / or SSA4 are also integrated into the recombinant expression vector.

[0024] As a preferred embodiment of the present invention, the signal peptide is SP25 and the protein secretion cofactor gene is GCN4.

[0025] Fourthly, the present invention provides the application of the above-mentioned recombinant Pichia pastoris strain that produces high levels of human lactoferrin in the production of human lactoferrin.

[0026] As a preferred technical solution of the present invention, the specific steps include:

[0027] S1 Seed Culture: The recombinant Pichia pastoris strain was inoculated into YPD medium and cultured at 30°C for 12 h. Then, it was transferred to BMGY medium and cultured at 30°C and 250 rmin. -1 Incubate for 16 hours to OD 600 It is 4~6;

[0028] S2 induction expression: Bacterial cells were collected by centrifugation, washed, and resuspended in BMMY induction medium, incubated at 28℃ for 250 rpm. -1 The mixture was cultured with shaking, and methanol was added every 24 hours to a final concentration of 0.5% (v / v) for 120 hours.

[0029] S3 Separation and Collection: Centrifuge the fermentation broth, collect the supernatant, and obtain the fermentation supernatant containing recombinant human lactoferrin.

[0030] As a preferred technical solution of the present invention, the following steps are included:

[0031] S1 Seed Culture: The recombinant Pichia pastoris strain was streaked onto YPD solid plates and incubated at 30℃ for 72 h for activation; single colonies were picked and inoculated into YPD liquid medium, incubated at 30℃ and 250 rpm. -1 After culturing for 12 h, a primary seed culture was obtained; this culture was then transferred to BMGY fermentation medium and incubated at 30°C and 250 rpm. -1 Incubate for 16 hours to OD 600 A score of 4-6 was obtained to obtain secondary seed solution;

[0032] S2 induction expression: Centrifuge the secondary seed culture at 4000×g and 4℃ for 5 min, and discard the supernatant; resuspend the bacterial cells in pre-cooled washing medium, wash three times, and collect the clean bacterial cells; resuspend the clean bacterial cells in BMMY induction medium and incubate at 28℃ for 250 rpm. -1 Shaking culture; methanol was added every 24 h to a final concentration of 0.5% (v / v) for 120 h of continuous induction;

[0033] S3 Product Collection: 12000 rpm after induction ends -1 Centrifuge at 4℃ for 10 min, collect the supernatant, which is the fermentation broth containing the target protein; confirm the protein expression level by SDS-PAGE and ImageJ quantitative analysis.

[0034] As a preferred technical solution of the present invention, the method is scaled up in a fermenter of 10 L or larger, and the fermentation sequentially goes through a glycerol batch fermentation stage, a glycerol fed fermentation stage, and a methanol induction stage, with a human lactoferrin yield of not less than 1.0 g / L.

[0035] The beneficial effects of adopting the above technical solution are as follows:

[0036] 1. The four advantageous signal peptides SP25, αOPT, W1, and SP16 obtained by screening in this invention can significantly improve the extracellular secretion efficiency of human lactoferrin.

[0037] 2. The two advantageous molecular chaperones, GCN4 and SSA4, screened by this invention can efficiently assist in the expression of human lactoferrin.

[0038] 3. This invention is the first to achieve a synergistic combination of the SP25 signal peptide and the GCN4 molecular chaperone, resulting in a significant synergistic effect and overcoming the bottleneck of single-modification technology. The modified strain achieves a stable yield of 164.8 mg / L in shake-flask fermentation, and an industrial-scale yield of up to 1.5 g / L in a 10L fermenter, which is one of the highest yield levels reported to date.

[0039] 4. The engineered strain constructed by this invention has good genetic stability, simple fermentation process, and low culture cost, and can be adapted to large-scale industrial production. It solves the problems of high cost, low activity, and immune risk of traditional extraction processes, and provides an efficient and reliable technical platform for the industrial application of recombinant human lactoferrin. Attached Figure Description

[0040] Figure 1 The pPICZαA-hLTF plasmid map;

[0041] Figure 2 The pPICZαA-SP25-hLTF plasmid map;

[0042] Figure 3 Figure 1 shows the SDS-PAGE results of human lactoferrin supernatant after 120 h fermentation mediated by different signal peptides; where M: 10-180 kDa Protein Marker; 1: α-factor; 2: 23P; 3: W1; 4: SP10; 5: SP16; 6: SP25; 7: SP30; 8: αOPT; 9: Positive control (hLTF purified sample).

[0043] Figure 4 The pGAPZαhA-GCN4 plasmid map;

[0044] Figure 5 Image showing SDS-PAGE analysis results of human lactoferrin supernatant after 120 h fermentation mediated by co-expression of different molecular chaperones; where M: 10-180 kDa Protein Marker; 1: Negative control; 2: GCN4; 3: SEC53; 4: UBC1; 5: SSA4; 6: SSO1; 7: Positive control (hLTF purified sample);

[0045] Figure 6 Figure 1 shows the SDS-PAGE results of human lactoferrin fermentation supernatant after 120 h mediated by different signal peptides and molecular chaperones; where M: 10-180 kDa Protein Marker; 1: Negative control; 2: Combination type 1; 3: Combination type 2; 4: Combination type 3; 5: Combination type 4; 6: Combination type 5; 7: Combination type 6; 8: Combination type 7; 9: Combination type 8; 10: Positive control (hLTF purified sample).

[0046] Figure 7 The results of SDS-PAGE analysis of fermentation supernatant diluted 20-fold at different induction time periods were obtained for scale-up validation in a 10L fermenter. M: 10-180 kDa Protein Marker; 1: 48 h; 2: 72 h; 3: 96 h; 4: 120 h; 5: Positive control (hLTF purified sample).

[0047] Figure 8 The expression levels of human lactoferrin at different induction times in a 10 L fermenter. Detailed Implementation

[0048] To make the objectives, technical solutions, and advantages of the present invention clearer, the invention will be described clearly and completely below in conjunction with specific embodiments.

[0049] The partial sequence information and Tm temperature of this embodiment are as follows:

[0050] SEQ ID NO.1 Human lactoferrin amino acid sequence;

[0051] The optimized human lactoferrin nucleic acid sequence with SEQ ID NO.2 codon;

[0052] SEQ ID NO.3 signal peptide SP25 amino acid sequence;

[0053] SEQ ID NO.4 signal peptide SP25 nucleic acid sequence;

[0054] SEQ ID NO.5 Amino acid sequence of signal peptide αOPT;

[0055] SEQ ID NO.6 Signal peptide αOPT nucleic acid sequence;

[0056] SEQ ID NO.7 Amino acid sequence of signal peptide W1;

[0057] SEQ ID NO.8 Signal peptide W1 nucleic acid sequence;

[0058] SEQ ID NO.9 signal peptide SP16 amino acid sequence;

[0059] SEQ ID NO.10 Signal peptide SP16 nucleic acid sequence;

[0060] SEQ ID NO.11 signal peptide 23P amino acid sequence;

[0061] SEQ ID NO.12 Signal peptide 23P nucleic acid sequence;

[0062] SEQ ID NO.13 Amino acid sequence of signal peptide SP10;

[0063] SEQ ID NO.14 Signal peptide SP10 nucleic acid sequence;

[0064] SEQ ID NO.15 Amino acid sequence of signal peptide SP30;

[0065] SEQ ID NO.16 Signal peptide SP30 nucleic acid sequence;

[0066] SEQ ID NO.17 Amino acid sequence of molecular chaperone GCN4;

[0067] SEQ ID NO.18 Molecular chaperone GCN4 nucleic acid sequence;

[0068] SEQ ID NO.19 Amino acid sequence of molecular chaperone SSA4;

[0069] SEQ ID NO.20 Molecular chaperone SSA4 nucleic acid sequence;

[0070] SEQ ID NO.21 Amino acid sequence of molecular chaperone UBC1;

[0071] SEQ ID NO.22 Molecular chaperone UBC1 nucleic acid sequence;

[0072] SEQ ID NO.23 Molecular chaperone SEC53 amino acid sequence;

[0073] SEQ ID NO.24 Molecular chaperone SEC53 nucleic acid sequence;

[0074] SEQ ID NO.25 Amino acid sequence of molecular chaperone SSO1;

[0075] SEQ ID NO.26 Molecular chaperone SSO1 nucleic acid sequence;

[0076] SEQ ID NO.27 Primer pPICZαA-hLTF-F sequence;

[0077] SEQ ID NO.28 Primer pPICZαA-hLTF-R sequence;

[0078] SEQ ID NO.29 primer pPICZαA-25P-F sequence (Tm value: 64.2℃);

[0079] SEQ ID NO.30 Primer pPICZαA-25P-R sequence (Tm value: 62.8℃);

[0080] SEQ ID NO.31 Primer pPICZαA-αOPT-F sequence (Tm value: 63.7℃);

[0081] SEQ ID NO.32 primer pPICZαA-αOPT-R sequence (Tm value: 64.2℃);

[0082] SEQ ID NO.33 primer pPICZαA-W1-F sequence (Tm value: 64.5℃);

[0083] SEQ ID NO.34 primer pPICZαA-W1-R sequence (Tm value: 67.5℃);

[0084] SEQ ID NO.35 Primer pPICZαA-SP16-F sequence (Tm value: 66.8℃);

[0085] SEQ ID NO.36 Primer pPICZαA-SP16-R sequence (Tm value: 64.5℃);

[0086] SEQ ID NO.37 primer pPICZαA-23P-F sequence (Tm value: 63.8℃);

[0087] SEQ ID NO.38 Primer pPICZαA-23P-R sequence (Tm value: 67.2℃);

[0088] SEQ ID NO.39 Primer pPICZαA-SP10-F sequence (Tm value: 62.4℃);

[0089] SEQ ID NO.40 Primer pPICZαA-SP10-R sequence (Tm value: 64.8℃);

[0090] SEQ ID NO.41 primer pPICZαA-SP30-F sequence (Tm value: 63.9℃);

[0091] SEQ ID NO.42 primer pPICZαA-SP30-R sequence (Tm value: 63.5℃);

[0092] SEQ ID NO.43 primer pGAPZαhA-GCN4-F sequence (Tm value: 67.2℃);

[0093] SEQ ID NO.44 primer pGAPZαhA-GCN4-R sequence (Tm value: 64.6℃);

[0094] SEQ ID NO.45 primer pGAPZαhA-SSA4-F sequence (Tm value: 66.5℃);

[0095] SEQ ID NO.46 Primer pGAPZαhA-SSA4-R sequence (Tm value: 62.8℃);

[0096] SEQ ID NO.47 Primer pGAPZαhA-UBC1-F sequence (Tm value: 65.8℃);

[0097] SEQ ID NO.48 Primer pGAPZαhA-UBC1-R sequence (Tm value: 63.7℃);

[0098] SEQ ID NO.49 primer pGAPZαhA-SEC53-F sequence (Tm value: 64.0℃);

[0099] SEQ ID NO.50 Primer pGAPZαhA-SEC53-R sequence (Tm value: 62.2℃);

[0100] SEQ ID NO.51 Primer pGAPZαhA-SSO1-F sequence (Tm value: 63.0℃);

[0101] SEQ ID NO.52 primer pGAPZαhA-SSO1-R sequence (Tm value: 62.5℃).

[0102] Example 1 Construction of basic recombinant Pichia pastoris strain

[0103] 1.1 Acquisition of the human lactoferrin encoding gene and construction of recombinant plasmids

[0104] The natural amino acid sequence of human lactoferrin was selected, as shown in SEQ ID NO.1. Based on the codon preference of Pichia pastoris, the coding DNA was synthesized and optimized to obtain the codon-optimized recombinant human lactoferrin coding gene shown in SEQ ID NO.2. The stop codon TAA and the EcoRI restriction site of the adapted clone were added to the 3' end and synthesized by Genewiz Ltd.

[0105] Using pPICZαA plasmid as a backbone, carrying the AOX1 promoter and α-factor signal peptide leader peptide, the recombinant plasmid pPICZαA-hLTF was constructed by homologous recombination or enzyme digestion ligation. The plasmid map is shown below. Figure 1 A basic expression vector containing the AOX1 promoter-α-factor signal peptide-hLTF expression cassette was obtained and synthesized by Genewiz Ltd.

[0106] The primer pPICZαA-hLTF-F sequence is as follows:

[0107] GAGAAAAGAGAGGCTGAAGCTGGTAGAAGGAGATCTGTTCAATGG

[0108] The primer pPICZαA-hLTF-R sequence is as follows:

[0109] TGGGCCACGTGAATTCTTAATGATGGTGATGGTGATGTTTTCTCAA.

[0110] 1.2 Preparation and electroconversion of Pichia pastoris competent cells

[0111] The recombinant plasmid was extracted and linearized by single digestion with restriction endonuclease SacⅠ. After successful linearization was confirmed by agarose gel electrophoresis, it was purified using a Qiagen gel extraction kit, dissolved in 20 μL of sterile water, and stored at -20℃ for later use.

[0112] Pichia pastoris X-33 competent cells were prepared according to the Invitrogen Pichia pastoris expression manual. 20 μg of linearized recombinant plasmid was mixed with 100 μL of competent cells and transferred to a pre-chilled 0.2 cm electroporation cuvette. The cells were incubated on ice for 5 min, and the electroporation instrument parameters were set as follows: voltage 1500 V, capacitance 25 μF, resistance 200 Ω, and pulse duration approximately 2 ms. Electroporation transformation was performed immediately after electroporation. Immediately after electroporation, 1 mL of 1 M sorbitol solution (on ice) was added, and the cells were incubated at 30°C for 1.5 h to recover. The cells were then plated on YPDS agar plates containing 100 μg / mL Zeocin and incubated at 30°C for 5 days for initial screening. Single colonies from the initial screening were picked and plated on YPDS agar plates containing 100 μg / mL Zeocin and incubated at 30°C for 5 days for secondary screening. Single colonies from the secondary screening were picked and plated on YPDS agar plates and incubated at 30°C for 3 days for activation.

[0113] 1.3 Shake-flask fermentation and expression detection

[0114] (1) The preserved strain was streaked onto YPD solid plates and incubated upside down at 30°C for 72 h to activate it;

[0115] (2) Select large, round single colonies after activation, inoculate them into YPD seed culture medium, and incubate at 30℃ and 250 rpm for 12 h until OD. 600 ≈4, to obtain primary seed liquid;

[0116] (3) The primary seed culture was transferred to BMGY fermentation medium and cultured at 30°C and 250 rpm for 16 h with shaking until OD. 600 ≈5, complete the secondary seed propagation;

[0117] (4) Collect the bacterial cells by centrifugation at 4000×g and 4℃ for 5 min, and discard the supernatant; resuspend the bacterial cells in pre-cooled washing medium at 4℃, centrifuge at 4000×g and 4℃ for 5 min, discard the supernatant, and wash 3 times in the same way;

[0118] (5) The clean bacterial body was suspended in BMMY induction medium and cultured at 28℃ and 250 rpm with shaking. Methanol was added every 24 h to a final concentration of 0.5% (v / v) and induced continuously for 120 h. During this period, the supernatant was collected by centrifugation at 12000 rpm and 4℃ for 10 min every time, which is the fermentation broth containing the target protein.

[0119] (6) Mix the fermentation supernatant with 5× protein loading buffer in equal proportion, heat in a metal bath at 100℃ for 5 min, cool and centrifuge at 12000 rpm for 5 min, take the supernatant for SDS-PAGE analysis, and use ImageJ software to perform grayscale analysis and quantification of the target band.

[0120] Example 2: Screening of signal peptides

[0121] 2.1 Screening Scope of Candidate Signal Peptides and Construction of Recombinant Vectors

[0122] Literature review confirmed that human lactoferrin itself does not contain a secretion signal peptide sequence; therefore, an exogenous signal peptide needs to be introduced to drive its extracellular secretion. In this embodiment, seven candidate signal peptides were screened to replace the original α-factor signal peptide in pPICZαA. The seven candidate signal peptides and their sequence information are as follows:

[0123]

[0124] Using pPICZαA-hLTF from Example 1 as the starting plasmid, the coding sequences of each signal peptide were amplified by PCR using the systems and procedures in Tables 1 and 2.

[0125] Table 1

[0126]

[0127] Table 2

[0128]

[0129] This embodiment uses the restriction endonuclease Sac I, with the restriction site selected immediately upstream of the α-factor signal peptide coding region to disrupt the original α-factor sequence. The linearized vectors were then mixed with purified signal peptide PCR fragments and ligated using homologous recombination cloning technology. During this process, the signal peptide fragment to be replaced precisely replaces the linearized original α-factor signal peptide coding region through its homologous arms at both ends, thereby directly fusing with the downstream human lactoferrin coding gene. Each signal peptide coding sequence replaces the original α-factor signal peptide coding region, constructing recombinant vectors pPICZαA-SP25-hLTF, pPICZαA-αOPT-hLTF, pPICZαA-W1-hLTF, pPICZαA-SP16-hLTF, pPICZαA-23P-hLTF, pPICZαA-SP10-hLTF, and pPICZαA-SP30-hLTF. Taking pPICZαA-SP25-hLTF as an example, the plasmid map is shown below. Figure 2 The vectors were linearized and electrotransformed into Pichia pastoris X-33 according to the method described in Example 1, and positive transformants were screened.

[0130] 2.2 Signal peptide strain shake-flask fermentation and detection

[0131] Shake-flask fermentation was performed according to the method in Example 1. Samples were taken after 120 h of induction at 12000 rpm. -1 Centrifuge for 10 min and collect the fermentation supernatant; take an appropriate amount of supernatant and mix it with 5×SDS-PAGE protein loading buffer, heat in a 100℃ metal bath for 5 min, at 12000 rpm. -1 After centrifugation, the supernatant was collected for SDS-PAGE analysis. ImageJ software was used to perform gray-scale quantitative analysis of the target band. The relative secretion amount was calculated using the original α-factor signal peptide strain as a control, and the absolute yield was converted by standard curve.

[0132] 2.3 Results of Signal Peptide Screening

[0133] The SDS-PAGE results are shown in Figure 3. The Pichia pastoris engineered strains transformed with the seven candidate signal peptides all showed clearly identifiable target protein bands at a molecular weight of approximately 80 kDa, indicating that the seven candidate signal peptides can mediate the secretion of human lactoferrin into the extracellular space of Pichia pastoris. ImageJ software was used for grayscale quantitative analysis of the electrophoretic bands. The extracellular human lactoferrin production of the SP30, SP10, 23P, SP16, W1, and αOPT groups was measured to be 26.1 mg / L, 31.1 mg / L, 38.8 mg / L, 68.9 mg / L, 73.2 mg / L, and 76.8 mg / L, respectively. The extracellular secretion of human lactoferrin mediated by the SP25 signal peptide reached 90.2 mg / L, while the secretion production of the original α-factor signal peptide (as a control) was 4.5 mg / L. SP25 increased the extracellular secretion level of human lactoferrin by approximately 20 times compared to the original α-factor signal peptide, exhibiting the best secretory expression ability among the seven candidate signal peptides. Based on the above electrophoretic qualitative results and band quantitative detection data, SP25 and αOPT were identified as the signal peptides with the best secretory expression efficiency of human lactoferrin in Pichia pastoris in this embodiment, and both were selected for subsequent signal peptide combination modification experiments.

[0134] Example 3 Screening of protein secretion cofactors

[0135] 3.1 Selection of candidate protein secretion cofactors and construction of recombinant vectors

[0136] Five candidate proteins were screened for secretion cofactor genes, and their sequence information is as follows:

[0137]

[0138] GCN4 is a protein that regulates translation and metabolic stress response in yeast cells. It can alleviate intracellular protein synthesis stress by regulating translation efficiency and amino acid metabolic stress response, thereby assisting in the correct folding and secretion of target proteins. SSA4 belongs to the HSP70 family of heat shock proteins and is a classic cytoplasmic molecular chaperone. It can recognize and bind to folded protein substrates and promote their folding. UBC1 is involved in ubiquitin-mediated protein quality control. SEC53 is involved in the N-glycosylation initiation step and affects protein folding modification in the ER. SSO1 is a SNARE family protein and is involved in vesicle fusion and secretion pathways.

[0139] Using pGAPZαhA as the backbone (containing the GAP constitutive promoter), the encoding genes of the above five protein secretion cofactors were cloned using the PCR amplification systems and programs shown in Tables 3 and 4, respectively. Corresponding helper expression vectors were constructed. Taking GCN4 as an example, the pGAPZαhA-GCN4 plasmid map is shown below. Figure 4 .

[0140] Table 3

[0141]

[0142] Table 4

[0143]

[0144] After linearizing each auxiliary expression vector, they were sequentially introduced into the basic recombinant Pichia pastoris strain obtained in Example 1. Positive clones were screened, and Pichia pastoris X-33 competent cells were prepared according to the Invitrogen Pichia pastoris expression manual. 20 μg of linearized recombinant plasmid was mixed with 100 μL of competent cells and transferred into a 0.2 cm pre-cooled electroporation cuvette. The mixture was incubated on ice for 5 min, and the electroporation instrument parameters were set as follows: voltage 1500 V, capacitance 25 μF, resistance 200 Ω, and pulse time approximately 2 ms for electroporation transformation. Immediately after electroporation, 1 mL of 1 M sorbitol solution (on ice) was added, and the mixture was incubated at 30°C for 1.5 h to recover. The recovered strain was then plated onto YPDS agar plates containing 250 μg / mL hygromycin and incubated at 30°C for 5 days for initial screening. Single colonies from the initial screening were picked, plated onto YPDS agar plates containing 250 μg / mL hygromycin, and incubated at 30°C for 5 days for secondary screening. Single colonies from the secondary screening were picked, plated onto YPDS agar plates, and incubated at 30°C for 3 days for activation. Recombinant strains co-expressing the secretion cofactors of each protein were obtained.

[0145] 3.2 Shake-flask fermentation and detection

[0146] The samples were induced and cultured in shake flasks for 120 h according to the method in Example 1. Sampling was then performed for SDS-PAGE and ImageJ quantitative analysis, with a basic recombinant strain that does not contain protein secretion cofactors as a control.

[0147] 3.3 Screening results of protein secretion cofactors

[0148] SDS-PAGE test results are as follows: Figure 5 As shown, strains overexpressing SSO1 did not significantly increase human lactoferrin secretion; strains overexpressing UBC1 and SEC53 showed some improvement, but the effect was limited; strains overexpressing SSA4 and GCN4 increased secretion by 3.9 times and 4.1 times compared to the control, respectively. Among them, strains overexpressing GCN4 had the highest human lactoferrin secretion, reaching 18.5 mg / L, confirming GCN4 as the optimal protein secretion cofactor, and SSA4 as the second best choice.

[0149] Example 4: Synergistic combination of signal peptide and protein secretion cofactor

[0150] 4.1 Combination Type Design

[0151] Based on the screening results of Examples 2 and 3, and using the four signal peptides SP25, αOPT, W1, and SP16, which significantly improve secretion efficiency, and the two protein secretion cofactors GCN4 and SSA4, synergistic combinations were designed, resulting in a total of 8 combination types, as shown in Table 5:

[0152] Table 5. Synergistic Combination Types of Signal Peptides and Protein Secretion Cofactors

[0153]

[0154] 4.2 Construction of Recombinant Strains

[0155] Following the method described in Example 1, human lactoferrin expression vectors containing each signal peptide were constructed. Specifically, the signal peptide expression vectors were first constructed and transformed into host bacteria, and bleomycin resistance genes were used as selection markers to obtain signal peptide transformants. Subsequently, corresponding protein secretion cofactors were introduced into the signal peptide transformants, and the vectors for these protein secretion cofactors used hygromycin resistance genes as selection markers. Resistance screening was performed in a hygromycin-containing culture medium, and positive clones were selected, thereby obtaining recombinant strains with combinations of eight signal peptides and protein secretion cofactors.

[0156] 4.3 Shake-flask fermentation and results

[0157] After 120 h of shake-flask induction culture according to the method in Example 1, samples were taken for SDS-PAGE analysis.

[0158] Dilute the fermentation supernatant 5 times and mix it with 5× protein loading buffer in an equal ratio. The SDS-PAGE results are as follows. Figure 6As shown, the human lactoferrin yields of the eight synergistic bacterial strains, calculated by Image J, were as follows: Combination type 1 (W1+GCN4) 145.6 mg / L, Combination type 2 (W1+SSA4) 138.8 mg / L, Combination type 3 (SP25+GCN4) 164.8 mg / L, Combination type 4 (SP25+SSA4) 122.5 mg / L, Combination type 5 (αOPT+GCN4) 159.0 mg / L, Combination type 6 (αOPT+SSA4) 108.9 mg / L, Combination type 7 (SP16+GCN4) 103.3 mg / L, and Combination type 8 (SP16+SSA4) 98.7 mg / L.

[0159] Combination type 3 (SP25+GCN4) yielded the highest output and was identified as the optimal mutant Pichia pastoris strain for producing human lactoferrin.

[0160] Example 5: Scale-up verification of recombinant human lactoferrin in a 10 L fermenter

[0161] 5.1 Seed liquid preparation

[0162] A single colony of the optimal mutant strain of combination type 3 in Example 4 was selected and inoculated into 5 mL of YPD liquid medium, incubated at 30°C and 250 rpm. -1 After culturing for 12 h, a primary seed culture was obtained; this was then transferred to a 1 L shake flask containing 400 mL of BMGY medium and incubated at 30 °C and 250 rpm. -1 Incubate for 16 hours to OD 600 ≥4.0, obtain secondary seed liquid.

[0163] 5.2 High-density fermentation in a 10 L fermenter

[0164] 7.6 L of FM21 basal medium (KH2PO4, 7 g / L; CaSO4, 0.2 g / L; K2SO4, 3 g / L; MgSO4-7H2O, 1.5 g / L; glycerol 40 g / L) was placed in a 10 L fermenter and autoclaved at 121 °C for 20 min. 400 mL of secondary seed culture was pumped into the fermenter, and the glycerol batch fermentation stage was initiated at 30 °C. When the dissolved oxygen (DO) rebounded to above 80%, the glycerol feeding stage was initiated by pumping a 50% glycerol solution containing 12 mL / L PTM1 trace elements at a rate of 2.42 mL / min. Samples were taken to determine the cell concentration. The samples were diluted 300 times before measurement, and the OD was converted to the original culture solution. 600 Glycerol feeding was stopped at approximately 220°C; the plant was starved for 1 hour; then, the methanol induction phase began, with the temperature lowered to 28°C. The methanol concentration was maintained at 1.0% by offline methanol measurement, and the specific growth rate μ = 0.015 h was followed. -1Control the methanol feed rate; record the wet weight from the start of methanol induction, and at 0.01 h intervals. -1 0.015 h -1 0.02h -1 Growth curves were plotted for 120 hours based on the specific growth rate. When the specific growth rate was below 0.015 h⁻¹, the growth curve was lower. -1 At the same time, increase the feeding rate by 0.5 mL / h·L, maintain the pH at around 5.5 by adding ammonia water throughout the fermentation process, control the aeration rate at 2~20 vvm, and control the stirring speed at 200~800 rmin. -1 This keeps DO above 20.0%.

[0165] 5.3 Analysis and Testing

[0166] Fermentation samples were collected at 48 h, 72 h, 96 h, and 120 h after methanol induction; the fermentation samples were then subjected to a reaction at 12000 rpm. -1 The fermentation supernatant was collected after centrifugation under the specified conditions. The supernatant was diluted 20-fold and then analyzed by SDS-PAGE electrophoresis. The results are shown in Figure 7; the signal intensity of the electrophoretic band corresponding to the target protein gradually increased with increasing methanol induction time. Quantitative analysis of the electrophoretic bands was performed using ImageJ software combined with a protein standard curve, and the results are as follows: Figure 8 The results showed that under methanol induction for 120 h, the extracellular human lactoferrin yield of this engineered strain reached 1.5 g / L. These experimental results indicate that the Pichia pastoris engineered strain carrying the SP25-GCN4 conjugate element has the potential for industrial-scale production of human lactoferrin.

[0167] Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant Pichia pastoris strain that produces high levels of human lactoferrin, characterized in that, The genome of the recombinant Pichia pastoris strain integrates a human lactoferrin expression cassette, which sequentially includes the AOX1 promoter, a signal peptide coding sequence, and a human lactoferrin coding gene; the signal peptide is selected from at least one of SP25, αOPT, W1, and SP16. The amino acid sequence of SP25 is shown in SEQ ID NO.3; the amino acid sequence of αOPT is shown in SEQ ID NO.5; the amino acid sequence of W1 is shown in SEQ ID NO.7; and the amino acid sequence of SP16 is shown in SEQ ID NO.

9.

2. The recombinant Pichia pastoris strain with high human lactoferrin production according to claim 1, characterized in that, The genome of the recombinant Pichia pastoris strain also integrates a protein secretion cofactor gene, which is selected from at least one of GCN4, SSA4, UBC1, SEC53 and SSO1.

3. The recombinant Pichia pastoris strain with high human lactoferrin production according to claim 1, characterized in that, The protein secretion cofactor genes are GCN4 and / or SSA4; wherein the amino acid sequence of GCN4 is shown in SEQ ID NO.17 and the amino acid sequence of SSA4 is shown in SEQ ID NO.

19.

4. The recombinant Pichia pastoris strain with high human lactoferrin production according to claim 1, characterized in that, The signal peptide is SP25, and the protein secretion cofactor gene is GCN4.

5. The recombinant Pichia pastoris strain with high human lactoferrin production according to claim 1, characterized in that, The human lactoferrin encoding gene is a nucleic acid sequence optimized by Pichia pastoris codons, and the nucleic acid sequence is shown in SEQ ID NO.2, encoding the human lactoferrin amino acid sequence shown in SEQ ID NO.

1.

6. A recombinant expression vector, characterized in that, The recombinant expression vector contains an AOX1 promoter, a signal peptide coding sequence, a human lactoferrin coding gene, and coding genes for protein secretion cofactors GCN4 and / or SSA4; the signal peptide is selected from at least one of SP25, αOPT, W1, and SP16; the amino acid sequences of GCN4 and SSA4 are shown in SEQ ID NO.17 and SEQ ID NO.19, respectively.

7. A method for constructing a recombinant Pichia pastoris strain that produces high levels of human lactoferrin as described in any one of claims 1-5, characterized in that, It includes the following steps: (1) Using pPICZαA as the vector backbone, the signal peptide coding sequence was linked to the 5' end of the human lactoferrin coding gene optimized by Pichia pastoris codons to construct a human lactoferrin recombinant expression vector containing the AOX1 promoter; the signal peptide was selected from at least one of SP25, αOPT, W1 and SP16; (2) The recombinant expression vector obtained in step (1) was linearized with restriction endonuclease and introduced into Pichia pastoris X-33 competent cells by electroporation. (3) The transformed cells were spread on YPDS solid medium containing bleomycin and cultured at 30°C for 5 days. Positive transformants were screened and activated by rescreening to obtain the recombinant Pichia pastoris strain.

8. The construction method according to claim 7, characterized in that, In step (1), the encoding genes of protein secretion cofactors GCN4 and / or SSA4 are also integrated into the recombinant expression vector.

9. The application of the recombinant Pichia pastoris strain with high human lactoferrin production according to any one of claims 1-5 in the production of human lactoferrin.

10. The application according to claim 9, characterized in that, Specifically, the steps include the following: S1 Seed Culture: The recombinant Pichia pastoris strain was inoculated into YPD medium and cultured at 28-30℃ for 12 h. Then, it was transferred to BMGY medium and cultured at 30℃ and 250 rpm. -1 Incubate for 16 hours to OD 600 It is 4~6; S2 induction expression: Bacterial cells were collected by centrifugation, washed, and resuspended in BMMY induction medium, incubated at 28℃ and 250 rmin. -1 The mixture was cultured with shaking, and methanol was added every 24 h to a final concentration of 0.5% (v / v) for 120 h of continuous induction. S3 Separation and Collection: Centrifuge the fermentation broth, collect the supernatant, and obtain the fermentation supernatant containing recombinant human lactoferrin. As a preferred technical solution of the present invention, the method is scaled up in a fermenter of 10 L or larger, and the fermentation sequentially goes through a glycerol batch fermentation stage, a glycerol fed fermentation stage, and a methanol induction stage, with a human lactoferrin yield of not less than 1.0 g / L.

Images