Probiotic yoghurt with hypoglycemic function and preparation method thereof

Abstract

Diabetes can cause a series of complications, which seriously threaten human health. Traditional hypoglycemic drugs have certain side effects, and safe and effective probiotics for assisting blood glucose reduction have important clinical significance and market value. The present application discloses two strains with excellent hypoglycemic effect. Among them, Lactococcus can effectively inhibit alpha-amylase activity, and Lactobacillus plantarum can effectively inhibit alpha-glucosidase activity. The two strains were preserved in the China General Microbiological Culture Collection Center on November 7, 2025 and March 9, 2026, and the preservation numbers are CGMCC No. 36526 and CGMCC No. 37876, respectively. Animal tests prove that the two strains can slow down the weight gain of mice, significantly reduce the fasting blood glucose level of mice, and significantly improve the oral glucose tolerance of mice. The yogurt prepared by the two strains of probiotics in the present application has moderate sweetness and smooth and mellow taste, and can be used for assisting the regulation of blood glucose, and can also supplement calcium.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a probiotic yogurt with blood sugar lowering function and its preparation method. Background Technology

[0002] A lifestyle characterized by increased consumption of high-fat and high-sugar foods and decreased physical activity has led to a rise in obesity, which in turn increases the incidence of hyperglycemia. Uncontrolled hyperglycemia can cause serious complications such as retinopathy, nephropathy, and peripheral neuropathy. Currently, medications for treating hyperglycemia mainly include metformin, insulin, and dapagliflozin. While these are effective, they all have drawbacks. Metformin may cause gastrointestinal reactions such as nausea and diarrhea; high doses of insulin carry the risk of impaired pancreatic function and hypoglycemia; and dapagliflozin may cause genital fungal infections. All existing blood sugar control medications on the market have certain side effects and require long-term use. Therefore, society urgently needs safer and more convenient methods for lowering blood sugar.

[0003] In the field of functional yogurt research and development, the traditional approach to developing low-sugar yogurt often focuses on adding plant extracts (such as white kidney bean extract, kudzu root extract, and dragon fruit juice) to achieve its blood sugar-lowering function. However, plant extracts present three major problems: first, functional plant extracts are consumables that require long-term intake to be effective; second, some people may be allergic to certain plant components, limiting their applicability; and third, the addition of plant extracts can easily alter the original flavor and texture of yogurt, affecting the sensory experience and failing to meet the public's basic requirements for yogurt taste. Therefore, finding a safe, efficient, non-allergenic, and palatable blood sugar-lowering solution has become the core breakthrough point in the research and development of low-sugar yogurt.

[0004] One important advantage of probiotics is their ability to colonize and proliferate in the gut, altering the composition of the gut microbiota and improving glucose and lipid metabolism, thus potentially addressing the root causes of high blood sugar and high cholesterol. Currently, there are some reports on hypoglycemic yogurts. Patent CN120536282A discloses a strain of *Lactococcus lactis* and a strain of *Lactobacillus plantarum*, with a compound probiotic agent containing these bacteria used to make cheese that has hypoglycemic effects. This patent primarily utilizes *Lactobacillus plantarum* for its hypoglycemic effect, without in-depth research on the efficacy of *Lactococcus lactis*, and the safety assessment of the used strains is insufficient. Patents CN113462613A and CN117126762A only evaluated the glycosidase inhibitory activity of the used strains; the former did not use acarbose as a control, and the latter's results were inferior to acarbose. Patent CN115838661 discloses a strain of *Lactobacillus plantarum*, Bianquejun 18, whose inhibition rates against amylase and glycosidase were not compared to acarbose, and animal test results were inferior to metformin. Although the strains in patents CN 109810912 A and CN112852662A showed no worse results than metformin in animal experiments, the former only evaluated glycosidase inhibitory activity and did not compare it with acarbose, while the latter did not evaluate glycosidase inhibitory activity. Neither of them conducted a systematic evaluation of the strains' tolerability and safety, nor did they conduct cell experiments or optimize the yogurt preparation process.

[0005] The *Lactobacillus plantarum* and *Lactococcus lactis* strains provided in this patent exhibit good glycosidase inhibitory activity and excellent amylase inhibitory activity, respectively, with both showing superior effects compared to acarbose. The complex of these two strains is more effective than metformin in lowering fasting blood glucose in mice. This patent provides a systematic evaluation of the tolerability and safety of these two strains. Cell experiments (results not listed in the examples) and animal tissue section experiments demonstrate the good hypoglycemic effects and tissue protection of these two strains. Furthermore, a probiotic yogurt with hypoglycemic function was prepared by co-fermentation of the two strains. This yogurt does not contain plant extracts, making it better suited to the needs of the general public and providing a safe and effective option for blood glucose control in daily life. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a strain of *Lactococcus lactis* that can lower blood sugar and a strain of *Lactobacillus plantarum* that can lower blood sugar. These two strains were deposited on November 7, 2025, and March 9, 2026, respectively, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession numbers CGMCC No. 36526 and CGMCC No. 37876.

[0007] Both *Lactobacillus plantarum* B2Z2 and *Lactococcus lactis* RS exhibited higher inhibition rates against glycosidase and amylase than the positive control group (acarbose). *Lactobacillus plantarum* B2Z2 showed the most significant inhibitory activity against glycosidase, while *Lactococcus lactis* RS demonstrated the best inhibitory effect against amylase. The 1:1 complex of *Lactobacillus plantarum* B2Z2 and *Lactococcus lactis* RS cultures showed superior hypoglycemic effects compared to metformin in type 2 diabetic mice (C57BL / 6J), and also reduced the rate of weight gain and improved oral glucose tolerance.

[0008] In another aspect, this invention provides a functional yogurt with blood sugar lowering function and a method for preparing the same. To achieve the above objectives, this invention employs the following technical solution:

[0009] The yogurt preparation includes the following steps:

[0010] The sterilized milk is cooled to room temperature, then inoculated with bacterial culture at an appropriate ratio, fermented in a fermentation tank for a certain period of time, and then refrigerated overnight before being packaged.

[0011] Preferably, the ratio of Lactococcus lactis to Lactobacillus plantarum is 1:2 to 2:1, and the inoculation rate is 1% to 11%.

[0012] Preferably, the fermentation temperature is 30℃~40℃.

[0013] Preferably, the fermentation time is 2~15 h.

[0014] Beneficial effects:

[0015] Both *Lactococcus lactis* and *Lactobacillus plantarum* belong to the lactic acid bacteria family. Both have the effects of regulating intestinal flora balance, improving the intestinal environment, aiding nutrient absorption, and enhancing the body's immunity. *Lactococcus lactis*, in particular, grows rapidly and has a relatively simple metabolism, producing no endotoxins or toxic substances. The *Lactococcus lactis* and *Lactobacillus plantarum* provided in this patent can also produce hypoglycemic metabolites that can effectively inhibit the activity of glycosidases and amylases, slow the weight gain rate of type 2 diabetic mice, reduce their fasting blood glucose, and improve their oral glucose tolerance.

[0016] This yogurt, made through co-fermentation of Lactococcus lactis and Lactobacillus plantarum, boasts the advantages of being sugar-free, gut-friendly, and suitable for all ages. It can regulate the balance of intestinal flora, inhibit the growth of harmful bacteria, and protect the health of the gut microbiota; it effectively alleviates lactose intolerance, has a smooth and rich taste, and also provides calcium supplementation. Attached Figure Description

[0017] Figure 1. Phylogenetic tree of Lactobacillus plantarum

[0018] Figure 2. Phylogenetic tree of Lactococcus lactis

[0019] Figure 3. Survival status of different strains on blood agar plates.

[0020] Figure 4. Screening by strain combination ratio

[0021] Figure 5. Changes in mouse body weight

[0022] Figure 6. Changes in fasting blood glucose in mice

[0023] Figure 7. Oral glucose tolerance test in mice, where:

[0024] (A) Blood glucose changes during oral glucose tolerance test; (B) Area under the blood glucose curve (in mmol·min / L)

[0025] Figure 8 Mouse liver tissue slices

[0026] Figure 9 Mouse pancreas tissue section

[0027] Figure 10 Mouse kidney tissue section

[0028] Figure 11 Sensory evaluation of probiotic yogurt with different fermentation times stored at room temperature

[0029] Figure 12 Sensory evaluation of probiotic yogurt stored in the refrigerator at different fermentation times

[0030] Figure 13. Room temperature storage stability of probiotic yogurt

[0031] Figure 14. Refrigerator storage stability of probiotic yogurt Detailed Implementation Plan

[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the raw materials, reagents, instruments, equipment, etc. used in the following embodiments can be commonly used products on the market, and the methods used are consistent with conventional methods unless otherwise specified. The technical solutions of the present invention will be further described below in conjunction with specific embodiments.

[0033] The method of using culture medium in this invention is as follows:

[0034] MRS medium: peptone 10.0 g / L, beef extract 5.0 g / L, yeast extract 4.0 g / L, glucose 20.0 g / L, Tween-80 1.0 mL / L, dipotassium hydrogen phosphate 2.0 g / L, sodium acetate 5.0 g / L, triammonium citrate 2.0 g / L, magnesium sulfate heptahydrate (MgSO4·7H2O) 0.2 g / L, manganese sulfate tetrahydrate (MnSO4·4H2O) 0.05 g / L. Adding 20.0 g / L agar to the above medium formulation yields solid MRS medium.

[0035] Bovine bile salt MRS medium: Based on the above MRS medium, 1.5 g / L and 3.0 g / L of bovine bile salt were added respectively, and the medium was sterilized at 121℃ for 20 min to prepare bovine bile salt MRS medium with different concentrations.

[0036] Artificial gastric juice: Pepsin 3.5 g / L, sodium chloride 3.0 g / L, pH adjusted to 3 with 0.1 M hydrochloric acid, fully dissolved and then filtered through a 0.22 μm microporous membrane for sterilization to obtain artificial gastric juice.

[0037] Artificial intestinal fluid: trypsin 1.0 g / L, sodium chloride 3.0 g / L, sodium bicarbonate 11.0 g / L, pH adjusted to 8 with 0.1 M sodium hydroxide, fully dissolved and then filtered through a 0.22 μm microporous membrane for sterilization to obtain artificial intestinal fluid.

[0038] Example 1: Screening of Probiotics

[0039] 1. Isolation and purification of bacterial strains

[0040] Sample sources: Yogurt, kimchi, cheese, barley wine, soybean paste, and homemade spicy cabbage from large supermarkets.

[0041] Take 5 g or 5 mL of each sample, add 50 mL of sterile water, and incubate overnight at 37°C and 180 rpm with shaking. Perform 10-fold serial dilutions of the culture medium (10...). -1 ~10 -6 Take 0.1 mL of each culture and spread it onto screening solid agar medium, then incubate at 37°C for 48 h. Based on colony morphology differences, select different single colonies and number them. Perform three streak plate purifications until the colony morphology is consistent to obtain pure strains. Inoculate the obtained pure strains onto screening solid agar medium containing 0.5% calcium carbonate and incubate at 37°C for 48 h. Select colonies that produce obvious calcium dissolution zones and perform three more streak plate purifications to finally obtain pure strains.

[0042] 2. Initial screening of blood sugar-lowering bacteria

[0043] Preparation of fermentation supernatant: The activated bacterial culture of the isolated strain was inoculated into MRS liquid medium (inoculation amount 4%), incubated at 37℃ for 24 h, centrifuged at 8000 rpm for 10 min, filtered through a 0.22 μm sterile filter membrane, aliquoted and stored at -20℃.

[0044] 2.1 Glycosidase inhibition rate

[0045] 50 μL of α-glucosidase and 25 μL of sample (fermentation supernatant) were pipetted into 96-well plates and reacted at 37℃ for 10 min. Then, 25 μL of 20 mmol / mL p-nitrophenyl-β-D-galactoside solution was added, and the reaction was continued at 37℃ for 20 min. After the reaction was complete, 100 μL of 0.1 mol / L Na₂CO₃ was added to terminate the reaction. Finally, the absorbance at 405 nm was measured using a microplate reader. Acarbose at 5 mg / mL was used as a positive control group. Each experiment was conducted in triplicate. The inhibition rate of α-glucosidase for each sample was calculated according to Formula 1. The results are shown in Table 1.

[0046] α-glucosidase inhibition rate = 1 - (AB) / (CD) × 100% (Formula 1);

[0047] (Note: A contains α-glucosidase and sample; B contains sample but no α-glucosidase; C contains α-glucosidase but no sample; D contains neither α-glucosidase nor sample)

[0048] Table 1 Glycosidase Inhibition Rate

[0049] As shown in Table 1, strains B2Z2 and RS exhibited better glycosidase inhibition than acarbose, with strain B2Z2 showing the most significant inhibitory activity.

[0050] 2.2 Amylase Inhibition Rate

[0051] Mix 50 μL of 2.0% α-amylase solution with 50 μL of sample and react at 37℃ for 10 min. Then add 100 μL of 1% soluble starch solution and react at 37℃ for 10 min. Add 200 μL of DNS chromogenic reagent and boil in a water bath for 5 min. After cooling to room temperature, dilute 5 times with PBS and measure the absorbance at 540 nm using a microplate reader. Each experiment was conducted in triplicate. The inhibition rate of the sample against α-amylase was calculated according to Formula 2. The results are shown in Table 2.

[0052] α-Amylase inhibition rate = 1 - (AB) / (CD) × 100% (Formula 2);

[0053] (Note: A contains α-amylase and sample; B contains sample but no α-amylase; C contains α-amylase but no sample; D contains neither α-amylase nor sample)

[0054] Table 2 Amylase Inhibition Rate

[0055] As shown in Table 2, the amylase inhibition effects of strains numbered B2Z2, HRP, SC, ZW-2, YS, and RS far exceeded those of acarbose, with RS exhibiting the best amylase activity.

[0056] Based on the combined results of the inhibition tests on the two enzymes, strains B2Z2 and RS showed superior inhibitory activity against both enzymes compared to acarbose. Strain B2Z2 exhibited outstanding inhibitory activity against glycosidases, while strain RS demonstrated excellent inhibitory activity against amylases. Further in-depth studies on these two strains are expected.

[0057] 3. Identification of fungal strains

[0058] 16S rRNA identification procedure: Single colonies of the isolated pure strain were picked, and template DNA was obtained using a bacterial genomic DNA extraction kit; the 16S rRNA gene fragment was amplified using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') (PCR program: 94℃ pre-denaturation for 5 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 90 s, 30 cycles; 72℃ extension for 10 min); after verification by agarose gel electrophoresis, the amplified product was sent to a sequencing company for bidirectional sequencing; the final sequence was compared for homology in the NCBI database using BLAST to determine the taxonomic position of the strain.

[0059] PCR amplification primers: 27F: 5'– AGAGTTTGATCCTGGCTCAG –3'

[0060] 1429R:5'-GGTTACCTTGTTACGACTT-3'

[0061] Amplification system:

[0062] Table 3 PCR amplification system

[0063]

[0064] Amplification conditions: (1) 94℃ pre-denaturation for 5 min; (2) 94℃ for 30 s, 55℃ for 30 s, 72℃ for 2 min, 30 cycles; (3) 72℃ extension for 7 min.

[0065] Depend on Figure 1and Figure 2 The results show that B2Z2 is Lactobacillus plantarum and RS is Lactococcus lactis.

[0066] Example 2: Evaluation of the strain's tolerance and safety

[0067] 1. Tolerance

[0068] 1.1 Acid tolerance test

[0069] The pH of the MRS liquid culture medium was adjusted to 2.5 and 3.5 using 0.1 mol / L hydrochloric acid, and sterilized at 121℃ for 20 min, then cooled for later use. Activated *Lactobacillus plantarum* B2Z2 and *Lactococcus lactis* RS were inoculated at 10% in MRS liquid culture media at pH 2.5 and 3.5, respectively, and incubated statically at 37℃. Samples were taken at 0 h and 2 h, and the viable cell count was determined using the plate count method at different time points. The survival rate was calculated according to Formula 3. The results are shown in Table 4.

[0070] The survival rate is calculated using the following formula: Survival rate (%) = Nt / N0 × 100% (Formula 3);

[0071] Nt: viable bacteria count at time th; N0: viable bacteria count at time 0 h.

[0072] Table 4 Survival rate under acidic environment

[0073] As shown in Table 4, Lactobacillus plantarum B2Z2 and Lactococcus lactis RS exhibit significant acid resistance.

[0074] 1.2 Bile salt tolerance test

[0075] Activated Lactobacillus plantarum B2Z2 and Lactobacillus lactis RS were inoculated into the culture medium treated above at an inoculation rate of 10% and incubated at 37°C. Samples were taken at 0 h and 3 h, and the viable counts at different time points were determined by plate count method. The survival rate was calculated, and the results are shown in Table 5.

[0076] Table 5 Survival rate in the presence of bile salts

[0077] As shown in Table 5, both strains exhibit good bile salt tolerance.

[0078] 1.3 Gastrointestinal Fluid Tolerance Test

[0079] Preparation of probiotic culture: Centrifuge the activated probiotic culture at 6000 rpm for 10 min, wash 2-3 times with sterile physiological saline, and then resuspend in sterile physiological saline.

[0080] 100 μL of the above probiotic culture was added to 900 μL of preheated artificial gastric fluid and incubated at 37°C for 3 h. Simultaneously, 100 μL of the above probiotic culture was added to 900 μL of preheated artificial intestinal fluid and incubated at 37°C for 4 h. The bacterial cultures treated in the artificial gastric and intestinal fluids were diluted and plated, and the plates were incubated statically at 37°C for 24 h. The survival rates of the strains in gastric and intestinal fluids are shown in Tables 6 and 7, respectively.

[0081] Table 6 Survival rate in the presence of gastric juice

[0082] Table 7 Survival rate in the presence of intestinal fluid

[0083] The results in Tables 6 and 7 show that both strains have good resistance to gastric and intestinal fluids.

[0084] 2. Hemolytic activity

[0085] Cultures of *Lactobacillus plantarum* B2Z2, *Lactococcus lactis* RS, and *Staphylococcus aureus* were streaked onto blood agar plates using disposable inoculation loops. The blood agar plates were incubated upside down at 37°C for 24–48 h, and the presence or absence of hemolytic zones was observed. A greenish-yellow ring around the colony indicated α-hemolysis; a clear area around the colony indicated β-hemolysis; and no change around the colony indicated γ-hemolysis (non-hemolysis). Each group was tested in triplicate.

[0086] Depend on Figure 3 It is evident that neither strain of bacteria is hemolytic and exhibits good safety.

[0087] Example 3: Animal Experiment

[0088] 1. Strain combination test

[0089] Lactobacillus plantarum B2Z2 exhibits significant inhibitory activity against α-glucosidase, while Lactococcus lactis RS demonstrates excellent inhibitory activity against α-amylase. The two have complementary effects. To achieve the best hypoglycemic effect, antagonistic and compound experiments were conducted to determine the compound effect.

[0090] The antagonistic effect of the strains was determined using the spot inoculation method: each indicator bacterium was evenly spread on an MRS agar plate, and after the bacterial solution was absorbed, single colonies of other strains were inoculated and incubated at 37℃ for 24-48 hours. The presence or absence of inhibition zones was observed; the absence of inhibition zones indicated strain compatibility, allowing for compound use. The results demonstrated no antagonistic effect between the two strains.

[0091] Compound bacterial solutions were prepared by mixing the culture media of the two strains at ratios of 3:1, 2:1, 1:1, 1:2, and 1:3. The inhibitory activities of each group on α-glucosidase and amylase were measured, the synergistic ratio was calculated, and the combination and ratio with the optimal synergistic effect were screened. Figure 4 The results showed that the 1:1 ratio of the two strains was the most effective.

[0092] 2. Preparation of probiotic cultures

[0093] Lactobacillus plantarum B2Z2 and Lactococcus lactis strains were inoculated into MRS liquid medium and activated by anaerobic culture at 37°C for 18 h. After activation, they were transferred to fresh MRS liquid medium at a 1% inoculum and cultured for another 12 h until the logarithmic growth phase. Both cultures were collected, centrifuged at 4°C and 6000 rpm for 10 min, the supernatant was discarded, and the bacterial pellets were collected. Each pellet was washed twice with sterile physiological saline and resuspended in sterile physiological saline. The culture concentration was adjusted to 5 × 10⁻⁶. 9 CFU / mL. Mix the two single bacterial cultures at a volume ratio of 1:1 to obtain the compound probiotic culture.

[0094] 3. Establishment of a type 2 diabetes mouse model and evaluation of its intervention effects.

[0095] Several 4-6 week old, 18-22 g SPF-grade male C57BL / 6J mice were selected and acclimatized for one week under alternating light and dark conditions (22℃-26℃, relative humidity (50±10)%), and 12 h / 12 ​​h light-dark conditions. Mice had free access to food and water. After acclimatization, the mice were randomly divided into a normal control group and a model group. The normal control group received a standard maintenance diet, while the model group received a high-fat diet for four weeks. At the end of the acclimatization period, the model group mice were fasted for 12 h but allowed free water. They were then intraperitoneally injected with freshly prepared streptozotocin solution (dissolved in 0.1 mol / L sodium citrate buffer, pH 4.5) at a dose of 40 mg / kg body weight for 5 consecutive days. The normal control group received an equal volume of sodium citrate buffer intraperitoneally. Fasting blood glucose was measured every 7 days via tail vein sampling. Before fasting blood glucose measurement, the mice were fasted for 12 h but allowed free water. Mice with fasting blood glucose (FBG) ≥11.1 mmol / L were selected as type 2 diabetic model mice.

[0096] Type 2 diabetic mice that had successfully developed the model were randomly divided into a model group, a metformin group, and a probiotic group based on their blood glucose and body weight. The intervention methods for each group were as follows:

[0097] Normal group: fed regular maintenance feed and administered an equal volume of physiological saline by gavage daily;

[0098] Model group: fed a high-fat diet and administered an equal volume of physiological saline by gavage daily;

[0099] Metformin group: given a high-fat diet and administered metformin 200 mg / kg body weight by gavage daily;

[0100] Probiotic group: fed a high-fat diet and administered probiotic culture daily by gavage at a dose of 1×10⁻⁶. 9 CFU / only / day.

[0101] Each group was administered the drug or an equal volume of physiological saline by gavage at regular intervals daily for 8 consecutive weeks. Mouse body weight and fasting blood glucose were monitored throughout the intervention. In the last week, oral glucose tolerance was measured as follows: all mice were fasted for 8 hours, and fasting blood glucose at 0 min was used as the baseline. Subsequently, 20% glucose solution was administered by gavage at a dose of 2.0 g / kg body weight. Blood glucose levels were measured by tail blood sampling at 30 min, 60 min, 90 min, and 120 min after gavage. Blood glucose data at each time point were recorded, and the area under the blood glucose curve from 0 to 120 min was calculated using the trapezoidal method. Histological sections were prepared after the experiment, and the results are as follows.

[0102] 3.1 Changes in mouse body weight

[0103] Experimental results are as follows Figure 5 As shown, the normal group mice showed a steady increase in body weight. The model group mice had a higher body weight than the normal group. Compared with the model group, the metformin group and the probiotic group mice showed a slower rate of body weight gain, and their body weight growth rate after 8 weeks of intervention was lower than that of the model group.

[0104] 3.2 Changes in fasting blood glucose in mice

[0105] Depend on Figure 6 It can be seen that after 8 weeks of intervention, the fasting blood glucose level in the model group remained high; the fasting blood glucose levels in both the metformin group and the probiotic group decreased compared to before the intervention and were lower than those in the model group; the decrease in blood glucose in the probiotic group was more significant than that in the metformin group.

[0106] 3.3 Oral glucose tolerance test in mice

[0107] Depend on Figure 7 The results showed that the blood glucose levels in the model group mice rose rapidly after glucose loading, reaching a peak at 60 min. Blood glucose levels at all time points were higher than those in the normal group, and the decline in blood glucose was slow. The AUC (autocorrelation coefficient) was also high. 0-120min Compared with the model group, the blood glucose levels of mice in both the metformin group and the probiotic group decreased at 30 min, 60 min, 90 min and 120 min after gavage with glucose, and the area under the blood glucose curve also decreased. The blood glucose level of mice in the probiotic group recovered faster than that in the metformin group.

[0108] 3.4 Histological sections of mouse organ tissues stained with hematoxylin and eosin (HE)

[0109] Liver HE staining results as follows Figure 8 As shown, hepatocytes in the NC (normal control) group were neatly arranged with no lipid droplets or vacuoles in the cytoplasm. Hepatocytes in the compound probiotic group were neatly arranged with very few or scattered lipid droplets or vacuoles in the cytoplasm, suggesting very mild to mild steatosis. Hepatocytes in the MC (model) group and the Met (metformin) group were slightly disordered, with numerous lipid droplets or vacuoles in the cytoplasm, suggesting mild to moderate steatosis. Some hepatocytes in the Met group showed mild edema. No obvious inflammatory cell infiltration, necrosis, or fibrosis was observed in the liver interstitium of any group.

[0110] pancreatic HE staining results as follows Figure 9 As shown, in the NC group, the pancreatic acini, islets, and ducts were structurally intact, with only a very small amount of cytoplasmic vacuolation. In the MC group, acinar cells showed extensive cytoplasmic vacuolation, slightly loose acinar structure, mild interstitial edema, vascular congestion, and localized erythrocyte exudation; the islet structure was intact. In the Met group, the acinar and islet structures were basically intact, with mild interstitial edema and mild vascular congestion. In the compound probiotic group, the pancreatic structure was intact, with only a very small amount of cytoplasmic vacuolation and mild vascular congestion.

[0111] Kidney HE staining results as follows Figure 10 As shown, in the NC group, the renal cortex structure was intact, the glomeruli were morphologically normal, and the vacuolar degeneration of the renal tubular epithelial cells was very mild. In the MC group, the renal tubular epithelial cells showed extensive vacuolar degeneration and mild edema, significant congestion of the glomeruli and interstitial capillaries, and a large number of erythrocytes aggregated in the lumen. The Met group showed extensive vacuolar degeneration and mild edema, vascular congestion, and erythrocytes aggregated in the lumen. The compound probiotic group showed very mild vacuolar degeneration of the renal tubular epithelial cells.

[0112] from Figure 8 , Figure 9 and Figure 10 It can be seen that both compound probiotics and metformin have protective effects on the liver, pancreas and kidneys of mice, with compound probiotics being more effective than metformin.

[0113] Example 4: Preparation of Yogurt

[0114] To avoid the added blood sugar burden from residual sucrose in yogurt, this process uses sugar-free fermentation. The preparation method of fermented yogurt is as follows: Take 1 L of fresh milk, heat it in a microwave oven for a few minutes until it boils to complete sterilization, let it stand until it reaches room temperature, then divide it into portions, add the starter culture according to the ratio, and incubate it in an incubator for a certain period of time to complete fermentation.

[0115] To ensure the blood sugar reduction effect, taste and viable cell concentration were used as evaluation indicators in the process optimization. The initial fermentation conditions were: inoculum size 5%, fermentation temperature 37℃, and fermentation time 6 h. Based on this, the inoculum size, fermentation temperature, fermentation time, and sweetener addition were optimized one by one, and the optimization results were used as conditions for subsequent experiments.

[0116] 1. Optimization of vaccination volume

[0117] Six inoculum amounts (1%, 3%, 5%, 7%, 9%, and 11%) were selected for fermentation. The pH value and viable bacteria concentration of the prepared yogurt are shown in Table 8.

[0118] Table 8. Effect of inoculum size on lactic acid bacteria concentration

[0119] As shown in Table 8, when the inoculum concentration is 7%, the concentration of live bacteria in the yogurt reaches a relatively high value. Further increasing the inoculum concentration does not significantly change the concentration of bacteria. Moreover, the taste is best when the inoculum concentration is 7%. Therefore, 7% was selected as the inoculum concentration for subsequent optimization.

[0120] 2. Fermentation temperature optimization

[0121] The pH value and live bacteria concentration of the yogurt prepared at five temperatures (30℃, 34℃, 37℃, 40℃, and 43℃) are shown in Table 9.

[0122] Table 9. Effect of fermentation temperature on lactic acid bacteria concentration

[0123] As shown in Table 9, the yogurt has the highest bacterial concentration and the best taste at a temperature of 40℃. Therefore, this temperature was selected as the optimized temperature.

[0124] 3. Fermentation time optimization

[0125] Fermentation was carried out at five time points: 2 h, 4 h, 6 h, 8 h, and 10 h. The pH value and viable bacteria concentration of the prepared yogurt are shown in Table 10.

[0126] Table 10 Effect of fermentation time on lactic acid bacteria concentration

[0127] As shown in Table 10, the yogurt has the best taste and the highest bacterial concentration when the fermentation time is 6 hours. Extending the fermentation time makes the yogurt too acidic and astringent. Therefore, 6 hours is selected as the optimized fermentation time.

[0128] 4. Optimization of sucralose addition amount

[0129] Five sucralose addition amounts of 32.5 ppm, 65 ppm, 97.5 ppm, 130 ppm, and 162.5 ppm were selected for fermentation. The pH value and viable bacteria concentration of the prepared yogurt are shown in Table 11.

[0130] Table 11 Optimization of Sucralose Addition Amount

[0131] As shown in Table 11, the yogurt has the best taste and flavor when the amount of sucralose added is 162.5 ppm.

[0132] 4. Storage stability

[0133] Yogurt was prepared using the optimal conditions obtained above. After fermentation, the yogurt was individually packaged and refrigerated overnight at 4°C for post-ripening. It was then stored at room temperature (25°C) and in a refrigerator (4°C) respectively. The stability of the yogurt was assessed by changes in taste and live bacteria concentration. The taste evaluation method was as follows: Ten students familiar with the sensory evaluation process were invited to form an evaluation group. The group evaluated the yogurt daily based on color, taste and aroma, and texture. The scoring criteria are shown in Table 12.

[0134] Table 12 Sensory Evaluation Criteria for Probiotic Yogurt

[0135] 5.1 Changes in the taste of yogurt during storage

[0136] Depend on Figure 11 It can be seen that, under room temperature (25℃) conditions, the sensory evaluation score of probiotic yogurt shows a trend of first increasing and then decreasing with the extension of storage time, with the best taste on the 4th day. Figure 12 It can be seen that, under refrigerator (4℃) conditions, and provided that the storage time does not exceed 21 days, the sensory score of probiotic yogurt shows a gradual upward trend as the storage time increases.

[0137] 5.2 Changes in the concentration of live bacteria in probiotic yogurt during storage

[0138] Depend on Figure 13 It can be seen that, under room temperature (25℃) conditions, the concentration of live bacteria in probiotic yogurt gradually decreases with prolonged storage time. Figure 14 It can be seen that under refrigerator (4℃) conditions, the live bacteria concentration of probiotic yogurt gradually decreases with the extension of storage time, and the live bacteria concentration remains at 10% throughout the 15-day storage period. 7 CFU / mL or higher.

Claims

1. A strain of *Lactococcus lactis*, characterized in that, It was deposited on November 7, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 36526.

2. A strain of *Lactobacillus plantarum*, characterized in that, It was deposited at the China General Microbiological Culture Collection Center (CGMCC) on March 9, 2026, with accession number CGMCC No. 37876.

3. The application of *Lactococcus lactis* and *Lactobacillus plantarum* as described in claims 1 and 2, characterized in that, The hypoglycemic effect is manifested in the following aspects: (1) In vitro assay, including the ability to inhibit the activity of α-amylase and α-glucosidase; (2) Animal experimental model verification, the model is type 2 diabetic mice, and the verification indicators include changes in mouse body weight, changes in fasting blood glucose and changes in oral glucose tolerance. In the in vitro experiments, the inhibitory activities of Lactococcus lactis and Lactobacillus plantarum on α-amylase were 60%~70% and 45%~55%, respectively, and their inhibitory activities on α-glucosidase were 20%~25% and 20%~30%, respectively, both of which were superior to the positive control group acarbose. In the animal model, a 1:1 mixture of Lactococcus lactis and Lactobacillus plantarum caused type 2 diabetic mice to gain weight more slowly than the metformin group, decrease fasting blood glucose more significantly than the metformin group, and improve oral glucose tolerance more effectively than the metformin group.

4. A blood sugar-lowering yogurt, characterized in that, The blood sugar-lowering yogurt is prepared by co-fermentation of Lactococcus lactis and Lactobacillus plantarum as described in claims 1 and 2.

5. Application of Lactococcus lactis with accession number CGMCC No. 36526 in the preparation of other hypoglycemic products.

Images